Fix typo in fasta/fastq to tabular converters

This commit is contained in:
Kanwei Li
2010-12-10 16:29:03 -05:00
parent f3ac7f9345
commit 7903b53f40
2 changed files with 7 additions and 3 deletions
+6 -2
View File
@@ -63,7 +63,7 @@
This tool converts FASTA formatted sequences to TAB-delimited format.
Many tools consider the first word of the FASTA ">" title line to be an identifier, and any remaing text to be a free form description.
Many tools consider the first word of the FASTA ">" title line to be an identifier, and any remaining text to be a free form description.
It is therefore useful to split this text into two columns in Galaxy (identifier and any description) by setting **How many columns to divide title string into?** to **2**.
In some cases the description can be usefully broken up into more columns -- see the examples .
@@ -76,7 +76,11 @@ With the introduction of the **How many columns to divide title string into?** o
Suppose you have the following FASTA formatted sequences from a Roche (454) FLX sequencing run::
>EYKX4VC02EQLO5 length=108 xy=1826_0455 region=2 run=R_2007_11_07_16_15_57_␍ TCCGCGCCGAGCATGCCCATCTTGGATTCCGGCGCGATGACCATCGCCCGCTCCACCACG␍ TTCGGCCGGCCCTTCTCGTCGAGGAATGACACCAGCGCTTCGCCCACG␍ >EYKX4VC02D4GS2 length=60 xy=1573_3972 region=2 run=R_2007_11_07_16_15_57_␍ AATAAAACTAAATCAGCAAAGACTGGCAAATACTCACAGGCTTATACAATACAAATGTAA
>EYKX4VC02EQLO5 length=108 xy=1826_0455 region=2 run=R_2007_11_07_16_15_57_
TCCGCGCCGAGCATGCCCATCTTGGATTCCGGCGCGATGACCATCGCCCGCTCCACCACG
TTCGGCCGGCCCTTCTCGTCGAGGAATGACACCAGCGCTTCGCCCACG
>EYKX4VC02D4GS2 length=60 xy=1573_3972 region=2 run=R_2007_11_07_16_15_57_
AATAAAACTAAATCAGCAAAGACTGGCAAATACTCACAGGCTTATACAATACAAATGTAA
Running this tool with the default settings will produce this (2 column output):
+1 -1
View File
@@ -36,7 +36,7 @@
This tool converts FASTQ sequencing reads to a Tabular file.
It is conventional to take the first word of the FASTQ "@" title line as the identifier, and any remaing text to be a free form description.
It is conventional to take the first word of the FASTQ "@" title line as the identifier, and any remaining text to be a free form description.
It is therefore often useful to split this text into two columns in Galaxy (identifier and any description) by setting **How many columns to divide title string into?** to **2**.
In some cases the description can be usefully broken up into more columns -- see the examples .