diff --git a/tools/fasta_tools/fasta_to_tabular.xml b/tools/fasta_tools/fasta_to_tabular.xml
index 8edca3c60d8..716d9f00080 100644
--- a/tools/fasta_tools/fasta_to_tabular.xml
+++ b/tools/fasta_tools/fasta_to_tabular.xml
@@ -63,7 +63,7 @@
 
 This tool converts FASTA formatted sequences to TAB-delimited format.
 
-Many tools consider the first word of the FASTA ">" title line to be an identifier, and any remaing text to be a free form description.
+Many tools consider the first word of the FASTA ">" title line to be an identifier, and any remaining text to be a free form description.
 It is therefore useful to split this text into two columns in Galaxy (identifier and any description) by setting **How many columns to divide title string into?** to **2**.
 In some cases the description can be usefully broken up into more columns -- see the examples .
 
@@ -76,7 +76,11 @@ With the introduction of the **How many columns to divide title string into?** o
 
 Suppose you have the following FASTA formatted sequences from a Roche (454) FLX sequencing run::
 
-    >EYKX4VC02EQLO5 length=108 xy=1826_0455 region=2 run=R_2007_11_07_16_15_57_
    TCCGCGCCGAGCATGCCCATCTTGGATTCCGGCGCGATGACCATCGCCCGCTCCACCACG
    TTCGGCCGGCCCTTCTCGTCGAGGAATGACACCAGCGCTTCGCCCACG
    >EYKX4VC02D4GS2 length=60 xy=1573_3972 region=2 run=R_2007_11_07_16_15_57_
    AATAAAACTAAATCAGCAAAGACTGGCAAATACTCACAGGCTTATACAATACAAATGTAA
+    >EYKX4VC02EQLO5 length=108 xy=1826_0455 region=2 run=R_2007_11_07_16_15_57_
+    TCCGCGCCGAGCATGCCCATCTTGGATTCCGGCGCGATGACCATCGCCCGCTCCACCACG
+    TTCGGCCGGCCCTTCTCGTCGAGGAATGACACCAGCGCTTCGCCCACG
+    >EYKX4VC02D4GS2 length=60 xy=1573_3972 region=2 run=R_2007_11_07_16_15_57_
+    AATAAAACTAAATCAGCAAAGACTGGCAAATACTCACAGGCTTATACAATACAAATGTAA
 
 Running this tool with the default settings will produce this (2 column output):
 
diff --git a/tools/fastq/fastq_to_tabular.xml b/tools/fastq/fastq_to_tabular.xml
index bf67c5392f0..114aa26f587 100644
--- a/tools/fastq/fastq_to_tabular.xml
+++ b/tools/fastq/fastq_to_tabular.xml
@@ -36,7 +36,7 @@
 
 This tool converts FASTQ sequencing reads to a Tabular file.
 
-It is conventional to take the first word of the FASTQ "@" title line as the identifier, and any remaing text to be a free form description.
+It is conventional to take the first word of the FASTQ "@" title line as the identifier, and any remaining text to be a free form description.
 It is therefore often useful to split this text into two columns in Galaxy (identifier and any description) by setting **How many columns to divide title string into?** to **2**.
 In some cases the description can be usefully broken up into more columns -- see the examples .