mirror of
https://github.com/galaxyproject/galaxy.git
synced 2026-09-24 16:30:27 +08:00
Integration of Assaf Gordon's Solexa toolkit into Galaxy - (all tools except 3 are working fine).
This commit is contained in:
Guruprasad Anada
Binary file not shown.
|
After Width: | Height: | Size: 38 KiB |
Binary file not shown.
|
After Width: | Height: | Size: 3.5 KiB |
Binary file not shown.
|
After Width: | Height: | Size: 5.3 KiB |
Binary file not shown.
|
After Width: | Height: | Size: 12 KiB |
Binary file not shown.
|
After Width: | Height: | Size: 6.9 KiB |
Binary file not shown.
|
After Width: | Height: | Size: 13 KiB |
Binary file not shown.
|
After Width: | Height: | Size: 13 KiB |
Binary file not shown.
|
After Width: | Height: | Size: 10 KiB |
Binary file not shown.
|
After Width: | Height: | Size: 10 KiB |
Binary file not shown.
|
After Width: | Height: | Size: 12 KiB |
Binary file not shown.
|
After Width: | Height: | Size: 44 KiB |
Binary file not shown.
|
After Width: | Height: | Size: 9.8 KiB |
@@ -288,6 +288,25 @@
|
||||
<tool file="fasta_tools/fasta_to_tabular.xml" />
|
||||
<tool file="fasta_tools/tabular_to_fasta.xml" />
|
||||
</section>
|
||||
<section name="FASTA/Q Information" id="cshl_library_information">
|
||||
<tool file="fastx_toolkit/fastq_qual_stat.xml" />
|
||||
<tool file="fastx_toolkit/fastq_quality_boxplot.xml" />
|
||||
<tool file="fastx_toolkit/fastq_nucleotides_distribution.xml" />
|
||||
<!-- <tool file="fastx_toolkit/fasta_clipping_histogram.xml" /> -->
|
||||
</section>
|
||||
|
||||
<section name="FASTA/Q Preprocessing" id="cshl_fastx_manipulation">
|
||||
<tool file="fastx_toolkit/fastq_to_fasta.xml" />
|
||||
<tool file="fastx_toolkit/fastq_qual_conv.xml" />
|
||||
<!-- <tool file="fastx_toolkit/fastx_clipper.xml" /> -->
|
||||
<tool file="fastx_toolkit/fastx_trimmer.xml" />
|
||||
<tool file="fastx_toolkit/fastx_reverse_complement.xml" />
|
||||
<tool file="fastx_toolkit/fastx_artifacts_filter.xml" />
|
||||
<tool file="fastx_toolkit/fastq_quality_filter.xml" />
|
||||
<!-- <tool file="fastx_toolkit/fasta_collapser.xml" /> -->
|
||||
<!-- <tool file="fastx_toolkit/fastx_barcode_splitter.xml" /> -->
|
||||
</section>
|
||||
|
||||
<section name="Short Read QC and Manipulation" id="short_read_analysis">
|
||||
<tool file="metag_tools/short_reads_figure_score.xml" />
|
||||
<tool file="metag_tools/short_reads_figure_high_quality_length.xml" />
|
||||
|
||||
@@ -0,0 +1,38 @@
|
||||
<tool id="cshl_fasta_clipping_histogram" name="Length Distribution">
|
||||
<description>chart</description>
|
||||
<command>fasta_clipping_histogram.pl $input $outfile</command>
|
||||
|
||||
<inputs>
|
||||
<param format="fasta" name="input" type="data" label="Library to analyze" />
|
||||
</inputs>
|
||||
|
||||
<outputs>
|
||||
<data format="png" name="outfile" metadata_source="input" />
|
||||
</outputs>
|
||||
<help>
|
||||
|
||||
**What it does**
|
||||
|
||||
This tool creates a histogram image of sequence lengths distribution in a given fasta data set file.
|
||||
|
||||
**TIP:** Use this tool after clipping your library (with **FASTX Clipper tool**), to visualize the clipping results.
|
||||
|
||||
-----
|
||||
|
||||
**Output Examples**
|
||||
|
||||
|
||||
In the following library, most sequences are 24-mers to 27-mers.
|
||||
This could indicate an abundance of endo-siRNAs (depending of course of what you've tried to sequence in the first place).
|
||||
|
||||
.. image:: ../static/fastx_icons/fasta_clipping_histogram_1.png
|
||||
|
||||
|
||||
In the following library, most sequences are 19,22 or 23-mers.
|
||||
This could indicate an abundance of miRNAs (depending of course of what you've tried to sequence in the first place).
|
||||
|
||||
.. image:: ../static/fastx_icons/fasta_clipping_histogram_2.png
|
||||
|
||||
</help>
|
||||
</tool>
|
||||
<!-- FASTA-Clipping-Histogram is part of the FASTX-toolkit, by A.Gordon (gordon@cshl.edu) -->
|
||||
@@ -0,0 +1,75 @@
|
||||
<tool id="cshl_fasta_collapser" name="Collapse">
|
||||
<description>sequences</description>
|
||||
<command>fasta_collapser.pl $input $output</command>
|
||||
|
||||
<inputs>
|
||||
<param format="fasta" name="input" type="data" label="Library to collapse" />
|
||||
</inputs>
|
||||
|
||||
<tests>
|
||||
<test>
|
||||
<param name="input" value="fasta_collapser1.fasta" />
|
||||
<output name="output" file="fasta_collapser1.out" />
|
||||
</test>
|
||||
</tests>
|
||||
|
||||
<outputs>
|
||||
<data format="fasta" name="output" metadata_source="input" />
|
||||
</outputs>
|
||||
<help>
|
||||
|
||||
**What it does**
|
||||
|
||||
This tool collapses identical sequences in a FASTA file into a single sequence.
|
||||
|
||||
--------
|
||||
|
||||
**Example**
|
||||
|
||||
Example Input File (Sequence "ATAT" appears multiple times)::
|
||||
|
||||
>CSHL_2_FC0042AGLLOO_1_1_605_414
|
||||
TGCG
|
||||
>CSHL_2_FC0042AGLLOO_1_1_537_759
|
||||
ATAT
|
||||
>CSHL_2_FC0042AGLLOO_1_1_774_520
|
||||
TGGC
|
||||
>CSHL_2_FC0042AGLLOO_1_1_742_502
|
||||
ATAT
|
||||
>CSHL_2_FC0042AGLLOO_1_1_781_514
|
||||
TGAG
|
||||
>CSHL_2_FC0042AGLLOO_1_1_757_487
|
||||
TTCA
|
||||
>CSHL_2_FC0042AGLLOO_1_1_903_769
|
||||
ATAT
|
||||
>CSHL_2_FC0042AGLLOO_1_1_724_499
|
||||
ATAT
|
||||
|
||||
Example Output file::
|
||||
|
||||
>1-1
|
||||
TGCG
|
||||
>2-4
|
||||
ATAT
|
||||
>3-1
|
||||
TGGC
|
||||
>4-1
|
||||
TGAG
|
||||
>5-1
|
||||
TTCA
|
||||
|
||||
.. class:: infomark
|
||||
|
||||
Original Sequence Names / Lane descriptions (e.g. "CSHL_2_FC0042AGLLOO_1_1_742_502") are discarded.
|
||||
|
||||
The output seqeunce name is composed of two numbers: the first is the sequence's number, the second is the multiplicity value.
|
||||
|
||||
The following output::
|
||||
|
||||
>2-4
|
||||
ATAT
|
||||
|
||||
means that the sequence "ATAT" is the second sequence in the file, and it appeared 4 times in the input FASTA file.
|
||||
|
||||
</help>
|
||||
</tool>
|
||||
@@ -0,0 +1,66 @@
|
||||
<tool id="cshl_fastq_nucleotides_distribution" name="Nucleotides Distribution">
|
||||
<description>chart</description>
|
||||
<command>fastq_nucleotide_distribution_graph.sh -t '$input.name' -i $input -o $output</command>
|
||||
|
||||
<inputs>
|
||||
<param format="txt" name="input" type="data" label="Statistics Text File (output of 'FASTQ Statistics' tool)" />
|
||||
</inputs>
|
||||
|
||||
<outputs>
|
||||
<data format="png" name="output" metadata_source="input" />
|
||||
</outputs>
|
||||
<help>
|
||||
|
||||
**What it does**
|
||||
|
||||
Creates a stacked-histogram graph for the nucleotide distribution in the Solexa library.
|
||||
|
||||
.. class:: infomark
|
||||
|
||||
**TIP:** Use the **FASTQ Statistics** tool to generate the report file needed for this tool.
|
||||
|
||||
-----
|
||||
|
||||
**Output Examples**
|
||||
|
||||
|
||||
|
||||
The following chart clearly shows the barcode used at the 5'-end of the library: **GATCT**
|
||||
|
||||
.. image:: ../static/fastx_icons/fastq_nucleotides_distribution_1.png
|
||||
|
||||
|
||||
|
||||
|
||||
|
||||
|
||||
|
||||
In the following chart, one can almost 'read' the most abundant sequence by looking at the dominant values: **TGATA TCGTA TTGAT GACTG AA...**
|
||||
|
||||
.. image:: ../static/fastx_icons/fastq_nucleotides_distribution_2.png
|
||||
|
||||
|
||||
|
||||
|
||||
|
||||
|
||||
|
||||
|
||||
The following chart shows a growing number of unknown (N) nucleotides towards later cycles (which might indicate a sequencing problem):
|
||||
|
||||
.. image:: ../static/fastx_icons/fastq_nucleotides_distribution_3.png
|
||||
|
||||
|
||||
|
||||
|
||||
|
||||
|
||||
|
||||
|
||||
But most of the time, the chart will look rather random:
|
||||
|
||||
.. image:: ../static/fastx_icons/fastq_nucleotides_distribution_4.png
|
||||
|
||||
</help>
|
||||
</tool>
|
||||
<!-- FASTQ-Nucleotides-Distribution is part of the FASTX-toolkit, by A.Gordon (gordon@cshl.edu) -->
|
||||
@@ -0,0 +1,82 @@
|
||||
<tool id="cshl_fastq_qual_conv" name="Quality format converter">
|
||||
<description>(ASCII-Numeric)</description>
|
||||
<command>zcat -f $input | fastq_quality_converter $QUAL_FORMAT -o $output</command>
|
||||
<inputs>
|
||||
<param format="fastqsolexa" name="input" type="data" label="Library to convert" />
|
||||
|
||||
<param name="QUAL_FORMAT" type="select" label="Desired output format">
|
||||
<option value="-a">ASCII (letters) quality scores</option>
|
||||
<option value="-n">Numeric quality scores</option>
|
||||
</param>
|
||||
</inputs>
|
||||
|
||||
<tests>
|
||||
<test>
|
||||
<!-- ASCII to NUMERIC -->
|
||||
<param name="input" value="fastq_qual_conv1.fastq" />
|
||||
<param name="QUAL_FORMAT" value="Numeric quality scores" />
|
||||
<output name="output" file="fastq_qual_conv1.out" />
|
||||
</test>
|
||||
<test>
|
||||
<!-- ASCII to ASCII (basically, a no-op, but it should still produce a valid output -->
|
||||
<param name="input" value="fastq_qual_conv1.fastq" />
|
||||
<param name="QUAL_FORMAT" value="ASCII (letters) quality scores" />
|
||||
<output name="output" file="fastq_qual_conv1a.out" />
|
||||
</test>
|
||||
<test>
|
||||
<!-- NUMERIC to ASCII -->
|
||||
<param name="input" value="fastq_qual_conv2.fastq" />
|
||||
<param name="QUAL_FORMAT" value="ASCII (letters) quality scores" />
|
||||
<output name="output" file="fastq_qual_conv2.out" />
|
||||
</test>
|
||||
<test>
|
||||
<!-- NUMERIC to NUMERIC (basically, a no-op, but it should still produce a valid output -->
|
||||
<param name="input" value="fastq_qual_conv2.fastq" />
|
||||
<param name="QUAL_FORMAT" value="Numeric quality scores" />
|
||||
<output name="output" file="fastq_qual_conv2n.out" />
|
||||
</test>
|
||||
</tests>
|
||||
|
||||
<outputs>
|
||||
<data format="fastqsolexa" name="output" metadata_source="input" />
|
||||
</outputs>
|
||||
<help>
|
||||
|
||||
**What it does**
|
||||
|
||||
Converts a solexa FASTQ file to/from numeric or ASCII quality format.
|
||||
|
||||
.. class:: warningmark
|
||||
|
||||
Re-scaling is **not** performed. (e.g. conversion from Phred scale to Solexa scale).
|
||||
|
||||
|
||||
-----
|
||||
|
||||
FASTQ with Numeric quality scores::
|
||||
|
||||
@CSHL__2_FC042AGWWWXX:8:1:120:202
|
||||
ACGATAGATCGGAAGAGCTAGTATGCCGTTTTCTGC
|
||||
+CSHL__2_FC042AGWWWXX:8:1:120:202
|
||||
40 40 40 40 20 40 40 40 40 6 40 40 28 40 40 25 40 20 40 -1 30 40 14 27 40 8 1 3 7 -1 11 10 -1 21 10 8
|
||||
@CSHL__2_FC042AGWWWXX:8:1:103:1185
|
||||
ATCACGATAGATCGGCAGAGCTCGTTTACCGTCTTC
|
||||
+CSHL__2_FC042AGWWWXX:8:1:103:1185
|
||||
40 40 40 40 40 35 33 31 40 40 40 32 30 22 40 -0 9 22 17 14 8 36 15 34 22 12 23 3 10 -0 8 2 4 25 30 2
|
||||
|
||||
|
||||
FASTQ with ASCII quality scores::
|
||||
|
||||
@CSHL__2_FC042AGWWWXX:8:1:120:202
|
||||
ACGATAGATCGGAAGAGCTAGTATGCCGTTTTCTGC
|
||||
+CSHL__2_FC042AGWWWXX:8:1:120:202
|
||||
hhhhThhhhFhh\hhYhTh?^hN[hHACG?KJ?UJH
|
||||
@CSHL__2_FC042AGWWWXX:8:1:103:1185
|
||||
ATCACGATAGATCGGCAGAGCTCGTTTACCGTCTTC
|
||||
+CSHL__2_FC042AGWWWXX:8:1:103:1185
|
||||
hhhhhca_hhh`^Vh@IVQNHdObVLWCJ@HBDY^B
|
||||
|
||||
|
||||
</help>
|
||||
</tool>
|
||||
<!-- FASTQ-Quality-Converter is part of the FASTX-toolkit, by A.Gordon (gordon@cshl.edu) -->
|
||||
@@ -0,0 +1,100 @@
|
||||
<tool id="cshl_fastq_qual_stat" name="Quality Statistics">
|
||||
<description></description>
|
||||
<command>zcat -f $input | fastq_quality_stats -o $output</command>
|
||||
|
||||
<inputs>
|
||||
<param format="fastqsolexa" name="input" type="data" label="Library to analyse" />
|
||||
</inputs>
|
||||
|
||||
<tests>
|
||||
<test>
|
||||
<param name="input" value="fastq_stats1.fastq" />
|
||||
<output name="output" file="fastq_stats1.out" />
|
||||
</test>
|
||||
</tests>
|
||||
|
||||
<outputs>
|
||||
<data format="txt" name="output" metadata_source="input" />
|
||||
</outputs>
|
||||
|
||||
<help>
|
||||
|
||||
**What it does**
|
||||
|
||||
Creates quality statistics report for the given Solexa/FASTQ library.
|
||||
|
||||
.. class:: infomark
|
||||
|
||||
**TIP:** This statistics report can be used as input for **Quality Score** and **Nucleotides Distribution** tools.
|
||||
|
||||
-----
|
||||
|
||||
**The output file will contain the following fields:**
|
||||
|
||||
* column = column number (1 to 36 for a 36-cycles read solexa file)
|
||||
* count = number of bases found in this column.
|
||||
* min = Lowest quality score value found in this column.
|
||||
* max = Highest quality score value found in this column.
|
||||
* sum = Sum of quality score values for this column.
|
||||
* mean = Mean quality score value for this column.
|
||||
* Q1 = 1st quartile quality score.
|
||||
* med = Median quality score.
|
||||
* Q3 = 3rd quartile quality score.
|
||||
* IQR = Inter-Quartile range (Q3-Q1).
|
||||
* lW = 'Left-Whisker' value (for boxplotting).
|
||||
* rW = 'Right-Whisker' value (for boxplotting).
|
||||
* A_Count = Count of 'A' nucleotides found in this column.
|
||||
* C_Count = Count of 'C' nucleotides found in this column.
|
||||
* G_Count = Count of 'G' nucleotides found in this column.
|
||||
* T_Count = Count of 'T' nucleotides found in this column.
|
||||
* N_Count = Count of 'N' nucleotides found in this column.
|
||||
|
||||
|
||||
|
||||
|
||||
|
||||
|
||||
**Output Example**::
|
||||
|
||||
column count min max sum mean Q1 med Q3 IQR lW rW A_Count C_Count G_Count T_Count N_Count
|
||||
1 6362991 -4 40 250734117 39.41 40 40 40 0 40 40 1396976 1329101 678730 2958184 0
|
||||
2 6362991 -5 40 250531036 39.37 40 40 40 0 40 40 1786786 1055766 1738025 1782414 0
|
||||
3 6362991 -5 40 248722469 39.09 40 40 40 0 40 40 2296384 984875 1443989 1637743 0
|
||||
4 6362991 -5 40 247654797 38.92 40 40 40 0 40 40 1683197 1410855 1722633 1546306 0
|
||||
5 6362991 -4 40 248214827 39.01 40 40 40 0 40 40 2536861 1167423 1248968 1409739 0
|
||||
6 6362991 -5 40 248499903 39.05 40 40 40 0 40 40 1598956 1236081 1568608 1959346 0
|
||||
7 6362991 -4 40 247719760 38.93 40 40 40 0 40 40 1692667 1822140 1496741 1351443 0
|
||||
8 6362991 -5 40 245745205 38.62 40 40 40 0 40 40 2230936 1343260 1529928 1258867 0
|
||||
9 6362991 -5 40 245766735 38.62 40 40 40 0 40 40 1702064 1306257 1336511 2018159 0
|
||||
10 6362991 -5 40 245089706 38.52 40 40 40 0 40 40 1519917 1446370 1450995 1945709 0
|
||||
11 6362991 -5 40 242641359 38.13 40 40 40 0 40 40 1717434 1282975 1387804 1974778 0
|
||||
12 6362991 -5 40 242026113 38.04 40 40 40 0 40 40 1662872 1202041 1519721 1978357 0
|
||||
13 6362991 -5 40 238704245 37.51 40 40 40 0 40 40 1549965 1271411 1973291 1566681 1643
|
||||
14 6362991 -5 40 235622401 37.03 40 40 40 0 40 40 2101301 1141451 1603990 1515774 475
|
||||
15 6362991 -5 40 230766669 36.27 40 40 40 0 40 40 2344003 1058571 1440466 1519865 86
|
||||
16 6362991 -5 40 224466237 35.28 38 40 40 2 35 40 2203515 1026017 1474060 1651582 7817
|
||||
17 6362991 -5 40 219990002 34.57 34 40 40 6 25 40 1522515 1125455 2159183 1555765 73
|
||||
18 6362991 -5 40 214104778 33.65 30 40 40 10 15 40 1479795 2068113 1558400 1249337 7346
|
||||
19 6362991 -5 40 212934712 33.46 30 40 40 10 15 40 1432749 1231352 1769799 1920093 8998
|
||||
20 6362991 -5 40 212787944 33.44 29 40 40 11 13 40 1311657 1411663 2126316 1513282 73
|
||||
21 6362991 -5 40 211369187 33.22 28 40 40 12 10 40 1887985 1846300 1300326 1318380 10000
|
||||
22 6362991 -5 40 213371720 33.53 30 40 40 10 15 40 542299 3446249 516615 1848190 9638
|
||||
23 6362991 -5 40 221975899 34.89 36 40 40 4 30 40 347679 1233267 926621 3855355 69
|
||||
24 6362991 -5 40 194378421 30.55 21 40 40 19 -5 40 433560 674358 3262764 1992242 67
|
||||
25 6362991 -5 40 199773985 31.40 23 40 40 17 -2 40 944760 325595 1322800 3769641 195
|
||||
26 6362991 -5 40 179404759 28.20 17 34 40 23 -5 40 3457922 156013 1494664 1254293 99
|
||||
27 6362991 -5 40 163386668 25.68 13 28 40 27 -5 40 1392177 281250 3867895 821491 178
|
||||
28 6362991 -5 40 156230534 24.55 12 25 40 28 -5 40 907189 981249 4174945 299437 171
|
||||
29 6362991 -5 40 163236046 25.65 13 28 40 27 -5 40 1097171 3418678 1567013 280008 121
|
||||
30 6362991 -5 40 151309826 23.78 12 23 40 28 -5 40 3514775 2036194 566277 245613 132
|
||||
31 6362991 -5 40 141392520 22.22 10 21 40 30 -5 40 1569000 4571357 124732 97721 181
|
||||
32 6362991 -5 40 143436943 22.54 10 21 40 30 -5 40 1453607 4519441 38176 351107 660
|
||||
33 6362991 -5 40 114269843 17.96 6 14 30 24 -5 40 3311001 2161254 155505 734297 934
|
||||
34 6362991 -5 40 140638447 22.10 10 20 40 30 -5 40 1501615 1637357 18113 3205237 669
|
||||
35 6362991 -5 40 138910532 21.83 10 20 40 30 -5 40 1532519 3495057 23229 1311834 352
|
||||
36 6362991 -5 40 117158566 18.41 7 15 30 23 -5 40 4074444 1402980 63287 822035 245
|
||||
|
||||
|
||||
</help>
|
||||
</tool>
|
||||
<!-- FASTQ-Statistics is part of the FASTX-toolkit, by A.Gordon (gordon@cshl.edu) -->
|
||||
@@ -0,0 +1,47 @@
|
||||
<tool id="cshl_fastq_quality_boxplot" name="Quality Score">
|
||||
<description>chart</description>
|
||||
|
||||
<command>fastq_quality_boxplot_graph.sh -t '$input.name' -i $input -o $output</command>
|
||||
|
||||
<inputs>
|
||||
<param format="txt" name="input" type="data" label="Statistics report file (output of 'FASTQ Statistics' tool)" />
|
||||
</inputs>
|
||||
|
||||
<outputs>
|
||||
<data format="png" name="output" metadata_source="input" />
|
||||
</outputs>
|
||||
<help>
|
||||
|
||||
**What it does**
|
||||
|
||||
Creates a boxplot graph for the quality scores in the library.
|
||||
|
||||
.. class:: infomark
|
||||
|
||||
**TIP:** Use the **FASTQ Statistics** tool to generate the report file needed for this tool.
|
||||
|
||||
-----
|
||||
|
||||
**Output Examples**
|
||||
|
||||
* Black horizontal lines are medians
|
||||
* Rectangular red boxes show the Inter-quartile Range (IQR) (top value is Q3, bottom value is Q1)
|
||||
* Whiskers show outlier at max. 1.5*IQR
|
||||
|
||||
|
||||
An excellent quality library (median quality is 40 for almost all 36 cycles):
|
||||
|
||||
.. image:: ../static/fastx_icons/fastq_quality_boxplot_1.png
|
||||
|
||||
|
||||
A relatively good quality library (median quality degrades towards later cycles):
|
||||
|
||||
.. image:: ../static/fastx_icons/fastq_quality_boxplot_2.png
|
||||
|
||||
A low quality library (median drops quickly):
|
||||
|
||||
.. image:: ../static/fastx_icons/fastq_quality_boxplot_3.png
|
||||
|
||||
</help>
|
||||
</tool>
|
||||
<!-- FASTQ-Quality-Boxplot is part of the FASTX-toolkit, by A.Gordon (gordon@cshl.edu) -->
|
||||
@@ -0,0 +1,73 @@
|
||||
<tool id="cshl_fastq_quality_filter" name="Quality Filter">
|
||||
<description></description>
|
||||
|
||||
<command>zcat -f '$input' | fastq_quality_filter -q $quality -p $percent -v -o $output</command>
|
||||
|
||||
<inputs>
|
||||
<param format="fastqsolexa" name="input" type="data" label="Library to filter" />
|
||||
|
||||
<param name="quality" size="4" type="integer" value="20">
|
||||
<label>Quality cut-off value</label>
|
||||
</param>
|
||||
|
||||
<param name="percent" size="4" type="integer" value="90">
|
||||
<label>Percent of bases in sequence that must have quality equal to / higher than cut-off value</label>
|
||||
</param>
|
||||
</inputs>
|
||||
|
||||
<tests>
|
||||
<test>
|
||||
<!-- Test1: 100% of bases with quality 33 or higher (pretty steep requirement...) -->
|
||||
<param name="input" value="fastq_qual_filter1.fastq" />
|
||||
<param name="quality" value="33"/>
|
||||
<param name="percent" value="100"/>
|
||||
<output name="output" file="fastq_qual_filter1a.out" />
|
||||
</test>
|
||||
<test>
|
||||
<!-- Test2: 80% of bases with quality 20 or higher -->
|
||||
<param name="input" value="fastq_qual_filter1.fastq" />
|
||||
<param name="quality" value="20"/>
|
||||
<param name="percent" value="80"/>
|
||||
<output name="output" file="fastq_qual_filter1b.out" />
|
||||
</test>
|
||||
</tests>
|
||||
|
||||
<outputs>
|
||||
<data format="input" name="output" metadata_source="input" />
|
||||
</outputs>
|
||||
|
||||
<help>
|
||||
**What it does**
|
||||
|
||||
This tool filters reads based on quality scores.
|
||||
|
||||
.. class:: infomark
|
||||
|
||||
Using **percent = 100** requires all cycles of all reads to be at least the quality cut-off value.
|
||||
|
||||
.. class:: infomark
|
||||
|
||||
Using **percent = 50** requires the median quality of the cycles (in each read) to be at least the quality cut-off value.
|
||||
|
||||
--------
|
||||
|
||||
Quality score distribution (of all cycles) is calculated for each read. If it is lower than the quality cut-off value - the read is discarded.
|
||||
|
||||
|
||||
**Example**::
|
||||
|
||||
@CSHL_4_FC042AGOOII:1:2:214:584
|
||||
GACAATAAAC
|
||||
+CSHL_4_FC042AGOOII:1:2:214:584
|
||||
30 30 30 30 30 30 30 30 20 10
|
||||
|
||||
Using **percent = 50** and **cut-off = 30** - This read will not be discarded (the median quality is higher than 30).
|
||||
|
||||
Using **percent = 90** and **cut-off = 30** - This read will be discarded (90% of the cycles do no have quality equal to / higher than 30).
|
||||
|
||||
Using **percent = 100** and **cut-off = 20** - This read will be discarded (not all cycles have quality equal to / higher than 20).
|
||||
|
||||
|
||||
</help>
|
||||
</tool>
|
||||
<!-- FASTQ-Quality-Filter is part of the FASTX-toolkit, by A.Gordon (gordon@cshl.edu) -->
|
||||
@@ -0,0 +1,70 @@
|
||||
<tool id="cshl_fastq_to_fasta" name="FASTQ to FASTA">
|
||||
<description>converter</description>
|
||||
<command>gunzip -cf $input | fastq_to_fasta $SKIPN $RENAMESEQ -o $output -v </command>
|
||||
|
||||
<inputs>
|
||||
<param format="fastqsolexa" name="input" type="data" label="FASTQ Library to convert" />
|
||||
|
||||
<param name="SKIPN" type="select" label="Discard sequences with unknown (N) bases ">
|
||||
<option value="">yes</option>
|
||||
<option value="-n">no</option>
|
||||
</param>
|
||||
|
||||
<param name="RENAMESEQ" type="select" label="Rename sequence names in output file (reduces file size)">
|
||||
<option value="-r">yes</option>
|
||||
<option value="">no</option>
|
||||
</param>
|
||||
|
||||
</inputs>
|
||||
|
||||
<tests>
|
||||
<test>
|
||||
<!-- FASTQ-To-FASTA, keep N, don't rename -->
|
||||
<param name="input" value="fastq_to_fasta1.fastq" />
|
||||
<param name="SKIPN" value=""/>
|
||||
<param name="RENAMESEQ" value=""/>
|
||||
<output name="output" file="fastq_to_fasta1a.out" />
|
||||
</test>
|
||||
<test>
|
||||
<!-- FASTQ-To-FASTA, discard N, rename -->
|
||||
<param name="input" value="fastq_to_fasta1.fastq" />
|
||||
<param name="SKIPN" value="no"/>
|
||||
<param name="RENAMESEQ" value="yes"/>
|
||||
<output name="output" file="fastq_to_fasta1b.out" />
|
||||
</test>
|
||||
</tests>
|
||||
|
||||
<outputs>
|
||||
<data format="fasta" name="output" metadata_source="input" />
|
||||
</outputs>
|
||||
|
||||
<help>
|
||||
|
||||
**What it does**
|
||||
|
||||
This tool converts data from Solexa format to FASTA format (scroll down for format description).
|
||||
|
||||
--------
|
||||
|
||||
**Example**
|
||||
|
||||
The following data in Solexa-FASTQ format::
|
||||
|
||||
@CSHL_4_FC042GAMMII_2_1_517_596
|
||||
GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT
|
||||
+CSHL_4_FC042GAMMII_2_1_517_596
|
||||
40 40 40 40 40 40 40 40 40 40 38 40 40 40 40 40 14 40 40 40 40 40 36 40 13 14 24 24 9 24 9 40 10 10 15 40
|
||||
|
||||
Will be converted to FASTA (with 'rename sequence names' = NO)::
|
||||
|
||||
>CSHL_4_FC042GAMMII_2_1_517_596
|
||||
GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT
|
||||
|
||||
Will be converted to FASTA (with 'rename sequence names' = YES)::
|
||||
|
||||
>1
|
||||
GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT
|
||||
|
||||
</help>
|
||||
</tool>
|
||||
<!-- FASTQ-to-FASTA is part of the FASTX-toolkit, by A.Gordon (gordon@cshl.edu) -->
|
||||
@@ -0,0 +1,80 @@
|
||||
<tool id="cshl_fastx_artifacts_filter" name="Artifacts Filter">
|
||||
<description></description>
|
||||
<command>zcat -f '$input' | fastx_artifacts_filter -v -o "$output"</command>
|
||||
|
||||
<inputs>
|
||||
<param format="fasta,fastqsolexa" name="input" type="data" label="Library to filter" />
|
||||
|
||||
</inputs>
|
||||
|
||||
<tests>
|
||||
<test>
|
||||
<!-- Filter FASTA file -->
|
||||
<param name="input" value="fastx_artifacts1.fasta" />
|
||||
<output name="output" file="fastx_artifacts1.out" />
|
||||
</test>
|
||||
<test>
|
||||
<!-- Filter FASTQ file -->
|
||||
<param name="input" value="fastx_artifacts2.fastq" />
|
||||
<output name="output" file="fastx_artifacts2.out" />
|
||||
</test>
|
||||
</tests>
|
||||
|
||||
<outputs>
|
||||
<data format="input" name="output" metadata_source="input" />
|
||||
</outputs>
|
||||
<help>
|
||||
**What it does**
|
||||
|
||||
This tool filters sequencing artifacts (reads with all but 3 identical bases).
|
||||
|
||||
--------
|
||||
|
||||
**The following is an example of sequences which will be filtered out**::
|
||||
|
||||
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
|
||||
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
|
||||
AAAAAAAAAAAAAAAAAAAACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
|
||||
AAAAAAAAAAAAAAAAAAACACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
|
||||
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
|
||||
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
|
||||
AAAAAAAAAAAAAAAAAAACACAAAAAAAAAAAAAAAAAAAAAAAAAAAAACACAAAAAA
|
||||
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
|
||||
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
|
||||
AAAAAAAAAAAAAAAAAAAAAAAAAACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
|
||||
AAAAAACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
|
||||
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
|
||||
CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC
|
||||
AAAAACACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
|
||||
AAAAAAAAAAAAAAAAAAAAAAAAACACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
|
||||
AAAAAAAAAAAAAAAAAAACACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAAAAAA
|
||||
AAAAAAAAAAACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
|
||||
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAAAA
|
||||
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
|
||||
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAAAAAA
|
||||
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACA
|
||||
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAAAAAAA
|
||||
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAA
|
||||
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAA
|
||||
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAAA
|
||||
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAAAAAAAAAA
|
||||
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAAAAA
|
||||
AAAAAAAAAACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
|
||||
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAAAAAAAAA
|
||||
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
|
||||
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAAAAAAAA
|
||||
AAAAAAAAAAAAAAAAAAACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
|
||||
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAAAAAAAAAAAA
|
||||
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
|
||||
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAAAAAAAAAAAAAA
|
||||
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAAAAAAAAAAAAAAAAAAAAA
|
||||
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAAAAAAAAAAAAAAAAAAAAAAAA
|
||||
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
|
||||
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
|
||||
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAAAAAAAAAAAAAAAAAAAAAAA
|
||||
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAAAAAAAAAAAAAAA
|
||||
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAAAAAAAAAAA
|
||||
|
||||
</help>
|
||||
</tool>
|
||||
<!-- FASTX-Artifacts-filter is part of the FASTX-toolkit, by A.Gordon (gordon@cshl.edu) -->
|
||||
@@ -0,0 +1,68 @@
|
||||
<tool id="cshl_fastx_barcode_splitter" name="Barcode Splitter">
|
||||
<description></description>
|
||||
<command>fastx_barcode_splitter_galaxy_wrapper.sh $BARCODE $input "$input.name" --mismatches $mismatches --partial $partial $EOL > $output </command>
|
||||
|
||||
<inputs>
|
||||
<param format="txt" name="BARCODE" type="data" label="Barcodes to use" />
|
||||
<param format="fasta,fastqsolexa" name="input" type="data" label="Library to split" />
|
||||
|
||||
<param name="EOL" type="select" label="Barcodes found at">
|
||||
<option value="--bol">Start of sequence (5' end)</option>
|
||||
<option value="--eol">End of sequence (3' end)</option>
|
||||
</param>
|
||||
|
||||
<param name="mismatches" type="integer" size="3" value="2" label="Number of allowed mismatches" />
|
||||
|
||||
<param name="partial" type="integer" size="3" value="0" label="Number of allowed barcodes nucleotide deletions" />
|
||||
|
||||
</inputs>
|
||||
|
||||
<tests>
|
||||
<test>
|
||||
<!-- Split a FASTQ file -->
|
||||
<param name="BARCODE" value="fastx_barcode_splitter1.txt" />
|
||||
<param name="input" value="fastx_barcode_splitter1.fastq" />
|
||||
<param name="EOL" value="Start of sequence (5' end)" />
|
||||
<param name="mismatches" value="2" />
|
||||
<param name="partial" value="0" />
|
||||
<output name="output" file="fastx_barcode_splitter1.out" />
|
||||
</test>
|
||||
</tests>
|
||||
|
||||
<outputs>
|
||||
<data format="html" name="output" />
|
||||
</outputs>
|
||||
<help>
|
||||
|
||||
**What it does**
|
||||
|
||||
This tool splits a solexa library (FASTQ file) or a regular FASTA file to several files, using barcodes as the split criteria.
|
||||
|
||||
--------
|
||||
|
||||
**Barcode file Format**
|
||||
|
||||
Barcode files are simple text files.
|
||||
Each line should contain an identifier (descriptive name for the barcode), and the barcode itself (A/C/G/T), separated by a TAB character.
|
||||
Example::
|
||||
|
||||
#This line is a comment (starts with a 'number' sign)
|
||||
BC1 GATCT
|
||||
BC2 ATCGT
|
||||
BC3 GTGAT
|
||||
BC4 TGTCT
|
||||
|
||||
For each barcode, a new FASTQ file will be created (with the barcode's identifier as part of the file name).
|
||||
Sequences matching the barcode will be stored in the appropriate file.
|
||||
|
||||
One additional FASTQ file will be created (the 'unmatched' file), where sequences not matching any barcode will be stored.
|
||||
|
||||
The output of this tool is an HTML file, displaying the split counts and the file locations.
|
||||
|
||||
**Output Example**
|
||||
|
||||
.. image:: ../static/fastx_icons/barcode_splitter_output_example.png
|
||||
|
||||
</help>
|
||||
</tool>
|
||||
<!-- FASTX-barcode-splitter is part of the FASTX-toolkit, by A.Gordon (gordon@cshl.edu) -->
|
||||
@@ -0,0 +1,109 @@
|
||||
<tool id="cshl_fastx_clipper" name="Clip" version="1.0.1" >
|
||||
<description>adapter sequences</description>
|
||||
<command>
|
||||
zcat -f $input | fastx_clipper -s $maxmismatches -l $minlength -a $clip_source.clip_sequence -d $keepdelta -o $output -v $KEEP_N $DISCARD_OPTIONS
|
||||
</command>
|
||||
|
||||
<inputs>
|
||||
<param format="fasta,fastqsolexa" name="input" type="data" label="Library to clip" />
|
||||
|
||||
<param name="maxmismatches" size="4" type="integer" value="2">
|
||||
<label>Maximum number of mismatches allowed (when matching the adapter sequence)</label>
|
||||
</param>
|
||||
|
||||
<param name="minlength" size="4" type="integer" value="15">
|
||||
<label>Minimum sequence length (after clipping, sequences shorter than this length will be discarded)</label>
|
||||
</param>
|
||||
|
||||
<conditional name="clip_source">
|
||||
<param name="clip_source_list" type="select" label="Source">
|
||||
<option value="prebuilt" selected="true">Standard (select from the list below)</option>
|
||||
<option value="user">Enter custom sequence</option>
|
||||
</param>
|
||||
|
||||
<when value="user">
|
||||
<param name="clip_sequence" size="30" label="Enter custom clipping sequence" type="text" value="AATTGGCC" />
|
||||
</when>
|
||||
|
||||
<when value="prebuilt">
|
||||
<param name="clip_sequence" type="select" label="Choose Adapter">
|
||||
<options from_file="fastx_clipper_sequences.txt">
|
||||
<column name="name" index="1"/>
|
||||
<column name="value" index="0"/>
|
||||
</options>
|
||||
</param>
|
||||
</when>
|
||||
</conditional>
|
||||
|
||||
<param name="keepdelta" size="2" type="integer" value="0">
|
||||
<label>enter non-zero value to keep the adapter sequence and x bases that follow it</label>
|
||||
<help>use this for hairpin barcoding. keep at 0 unless you know what you're doing.</help>
|
||||
</param>
|
||||
|
||||
<param name="KEEP_N" type="select" label="Discard sequences with unknown (N) bases">
|
||||
<option value="">Yes</option>
|
||||
<option value="-n">No</option>
|
||||
</param>
|
||||
|
||||
<param name="DISCARD_OPTIONS" type="select" label="Output options">
|
||||
<option value="-c">Output only clipped seqeunces (i.e. sequences which contained the adapter)</option>
|
||||
<option value="-C">Output only non-clipped seqeunces (i.e. sequences which did not contained the adapter)</option>
|
||||
<option value="">Output both clipped and non-clipped sequences</option>
|
||||
</param>
|
||||
|
||||
</inputs>
|
||||
|
||||
<tests>
|
||||
<test>
|
||||
<!-- Clip a FASTQ file -->
|
||||
<param name="input" value="fastx_clipper1.fastq" />
|
||||
<param name="maxmismatches" value="2" />
|
||||
<param name="minlength" value="15" />
|
||||
<param name="clip_source.clip_source_list" value="user" />
|
||||
<param name="clip_source.clip_sequence" value="CAATTGGTTAATCCCCCTATATA" />
|
||||
<param name="keepdelta" value="0" />
|
||||
<param name="KEEP_N" value="-n" />
|
||||
<param name="DISCARD_OPTIONS" value="-c" />
|
||||
<output name="output" file="fastx_clipper1a.out" />
|
||||
</test>
|
||||
</tests>
|
||||
|
||||
<outputs>
|
||||
<data format="input" name="output" metadata_source="input" />
|
||||
</outputs>
|
||||
|
||||
<help>
|
||||
**What it does**
|
||||
|
||||
This tool clips adapters from the 3'-end of the sequences in a FASTA/FASTQ file.
|
||||
|
||||
--------
|
||||
|
||||
|
||||
**Clipping Illustration:**
|
||||
|
||||
.. image:: ../static/fastx_icons/fastx_clipper_illustration.png
|
||||
|
||||
|
||||
|
||||
|
||||
|
||||
|
||||
|
||||
|
||||
**Clipping Example:**
|
||||
|
||||
.. image:: ../static/fastx_icons/fastx_clipper_example.png
|
||||
|
||||
|
||||
|
||||
**In the above example:**
|
||||
|
||||
* Sequence no. 1 was discarded since it wasn't clipped (i.e. didn't contain the adapter sequence). (**Output** parameter).
|
||||
* Sequence no. 5 was discarded --- it's length (after clipping) was shorter than 15 nt (**Minimum Sequence Length** parameter).
|
||||
|
||||
|
||||
|
||||
|
||||
</help>
|
||||
</tool>
|
||||
@@ -0,0 +1,52 @@
|
||||
<tool id="cshl_fastx_reverse_complement" name="Reverse-Complement">
|
||||
<description>sequences</description>
|
||||
<command>zcat -f '$input' | fastx_reverse_complement -v -o $output</command>
|
||||
<inputs>
|
||||
<param format="fasta,fastqsolexa" name="input" type="data" label="Library to reverse-complement" />
|
||||
</inputs>
|
||||
|
||||
<tests>
|
||||
<test>
|
||||
<!-- Reverse-complement a FASTA file -->
|
||||
<param name="input" value="fastx_rev_comp1.fasta" />
|
||||
<output name="output" file="fastx_reverse_complement1.out" />
|
||||
</test>
|
||||
<test>
|
||||
<!-- Reverse-complement a FASTQ file -->
|
||||
<param name="input" value="fastx_rev_comp2.fastq" />
|
||||
<output name="output" file="fastx_reverse_complement2.out" />
|
||||
</test>
|
||||
</tests>
|
||||
|
||||
|
||||
<outputs>
|
||||
<data format="input" name="output" metadata_source="input" />
|
||||
</outputs>
|
||||
|
||||
<help>
|
||||
**What it does**
|
||||
|
||||
This tool reverse-complements each sequence in a library.
|
||||
If the library is a FASTQ, the quality-scores are also reversed.
|
||||
|
||||
--------
|
||||
|
||||
**Example**
|
||||
|
||||
Input FASTQ file::
|
||||
|
||||
@CSHL_1_FC42AGWWWXX:8:1:3:740
|
||||
TGTCTGTAGCCTCNTCCTTGTAATTCAAAGNNGGTA
|
||||
+CSHL_1_FC42AGWWWXX:8:1:3:740
|
||||
33 33 33 34 33 33 33 33 33 33 33 33 27 5 27 33 33 33 33 33 33 27 21 27 33 32 31 29 26 24 5 5 15 17 27 26
|
||||
|
||||
|
||||
Output FASTQ file::
|
||||
|
||||
@CSHL_1_FC42AGWWWXX:8:1:3:740
|
||||
TACCNNCTTTGAATTACAAGGANGAGGCTACAGACA
|
||||
+CSHL_1_FC42AGWWWXX:8:1:3:740
|
||||
26 27 17 15 5 5 24 26 29 31 32 33 27 21 27 33 33 33 33 33 33 27 5 27 33 33 33 33 33 33 33 33 34 33 33 33
|
||||
|
||||
</help>
|
||||
</tool>
|
||||
@@ -0,0 +1,70 @@
|
||||
<tool id="cshl_fastx_trimmer" name="Trim">
|
||||
<description>sequences</description>
|
||||
<command>zcat -f '$input' | fastx_trimmer -v -f $first -l $last -o $output</command>
|
||||
|
||||
<inputs>
|
||||
<param format="fasta,fastqsolexa" name="input" type="data" label="Library to clip" />
|
||||
|
||||
<param name="first" size="4" type="integer" value="1">
|
||||
<label>First base to keep</label>
|
||||
</param>
|
||||
|
||||
<param name="last" size="4" type="integer" value="21">
|
||||
<label>Last base to keep</label>
|
||||
</param>
|
||||
</inputs>
|
||||
|
||||
<tests>
|
||||
<test>
|
||||
<!-- Trim a FASTA file - remove first four bases (e.g. a barcode) -->
|
||||
<param name="input" value="fastx_trimmer1.fasta" />
|
||||
<param name="first" value="5"/>
|
||||
<param name="last" value="36"/>
|
||||
<output name="output" file="fastx_trimmer1.out" />
|
||||
</test>
|
||||
<test>
|
||||
<!-- Trim a FASTQ file - remove last 9 bases (e.g. keep only miRNA length sequences) -->
|
||||
<param name="input" value="fastx_trimmer2.fastq" />
|
||||
<param name="first" value="1"/>
|
||||
<param name="last" value="27"/>
|
||||
<output name="output" file="fastx_trimmer2.out" />
|
||||
</test>
|
||||
</tests>
|
||||
|
||||
<outputs>
|
||||
<data format="input" name="output" metadata_source="input" />
|
||||
</outputs>
|
||||
<help>
|
||||
**What it does**
|
||||
|
||||
This tool trims (cut bases from) sequences in a FASTA/Q file.
|
||||
|
||||
--------
|
||||
|
||||
**Example**
|
||||
|
||||
Input Fasta file (with 36 bases in each sequences)::
|
||||
|
||||
>1-1
|
||||
TATGGTCAGAAACCATATGCAGAGCCTGTAGGCACC
|
||||
>2-1
|
||||
CAGCGAGGCTTTAATGCCATTTGGCTGTAGGCACCA
|
||||
|
||||
|
||||
Trimming with First=1 and Last=21, we get a FASTA file with 21 bases in each sequences (starting from the first base)::
|
||||
|
||||
>1-1
|
||||
TATGGTCAGAAACCATATGCA
|
||||
>2-1
|
||||
CAGCGAGGCTTTAATGCCATT
|
||||
|
||||
Trimming with First=6 and Last=10, will generate a FASTA file with 5 bases (bases 6,7,8,9,10) in each sequences::
|
||||
|
||||
>1-1
|
||||
TCAGA
|
||||
>2-1
|
||||
AGGCT
|
||||
|
||||
</help>
|
||||
</tool>
|
||||
<!-- FASTX-Trimmer is part of the FASTX-toolkit, by A.Gordon (gordon@cshl.edu) -->
|
||||
Reference in New Issue
Block a user