diff --git a/static/fastx_icons/barcode_splitter_output_example.png b/static/fastx_icons/barcode_splitter_output_example.png
new file mode 100644
index 00000000000..49dfd6c4cdb
Binary files /dev/null and b/static/fastx_icons/barcode_splitter_output_example.png differ
diff --git a/static/fastx_icons/fasta_clipping_histogram_1.png b/static/fastx_icons/fasta_clipping_histogram_1.png
new file mode 100644
index 00000000000..a9416f68d9d
Binary files /dev/null and b/static/fastx_icons/fasta_clipping_histogram_1.png differ
diff --git a/static/fastx_icons/fasta_clipping_histogram_2.png b/static/fastx_icons/fasta_clipping_histogram_2.png
new file mode 100644
index 00000000000..471be686bc1
Binary files /dev/null and b/static/fastx_icons/fasta_clipping_histogram_2.png differ
diff --git a/static/fastx_icons/fastq_nucleotides_distribution_1.png b/static/fastx_icons/fastq_nucleotides_distribution_1.png
new file mode 100644
index 00000000000..f238587ad02
Binary files /dev/null and b/static/fastx_icons/fastq_nucleotides_distribution_1.png differ
diff --git a/static/fastx_icons/fastq_nucleotides_distribution_2.png b/static/fastx_icons/fastq_nucleotides_distribution_2.png
new file mode 100644
index 00000000000..e935576e64c
Binary files /dev/null and b/static/fastx_icons/fastq_nucleotides_distribution_2.png differ
diff --git a/static/fastx_icons/fastq_nucleotides_distribution_3.png b/static/fastx_icons/fastq_nucleotides_distribution_3.png
new file mode 100644
index 00000000000..cae0c53a88c
Binary files /dev/null and b/static/fastx_icons/fastq_nucleotides_distribution_3.png differ
diff --git a/static/fastx_icons/fastq_nucleotides_distribution_4.png b/static/fastx_icons/fastq_nucleotides_distribution_4.png
new file mode 100644
index 00000000000..7f8369e57f4
Binary files /dev/null and b/static/fastx_icons/fastq_nucleotides_distribution_4.png differ
diff --git a/static/fastx_icons/fastq_quality_boxplot_1.png b/static/fastx_icons/fastq_quality_boxplot_1.png
new file mode 100644
index 00000000000..c3621fabf6c
Binary files /dev/null and b/static/fastx_icons/fastq_quality_boxplot_1.png differ
diff --git a/static/fastx_icons/fastq_quality_boxplot_2.png b/static/fastx_icons/fastq_quality_boxplot_2.png
new file mode 100644
index 00000000000..95af2c1a648
Binary files /dev/null and b/static/fastx_icons/fastq_quality_boxplot_2.png differ
diff --git a/static/fastx_icons/fastq_quality_boxplot_3.png b/static/fastx_icons/fastq_quality_boxplot_3.png
new file mode 100644
index 00000000000..6121c84edbe
Binary files /dev/null and b/static/fastx_icons/fastq_quality_boxplot_3.png differ
diff --git a/static/fastx_icons/fastx_clipper_example.png b/static/fastx_icons/fastx_clipper_example.png
new file mode 100644
index 00000000000..8d4ff4cc21a
Binary files /dev/null and b/static/fastx_icons/fastx_clipper_example.png differ
diff --git a/static/fastx_icons/fastx_clipper_illustration.png b/static/fastx_icons/fastx_clipper_illustration.png
new file mode 100644
index 00000000000..5acf892fac9
Binary files /dev/null and b/static/fastx_icons/fastx_clipper_illustration.png differ
diff --git a/tool_conf.xml.sample b/tool_conf.xml.sample
index a047871b85e..9a6851b13d3 100644
--- a/tool_conf.xml.sample
+++ b/tool_conf.xml.sample
@@ -288,6 +288,25 @@
+
+
+
+
diff --git a/tools/fastx_toolkit/fasta_clipping_histogram.xml b/tools/fastx_toolkit/fasta_clipping_histogram.xml
new file mode 100644
index 00000000000..a76de578f29
--- /dev/null
+++ b/tools/fastx_toolkit/fasta_clipping_histogram.xml
@@ -0,0 +1,38 @@
+
+ chart
+ fasta_clipping_histogram.pl $input $outfile
+
+
+
+
+
+
+
+
+
+
+**What it does**
+
+This tool creates a histogram image of sequence lengths distribution in a given fasta data set file.
+
+**TIP:** Use this tool after clipping your library (with **FASTX Clipper tool**), to visualize the clipping results.
+
+-----
+
+**Output Examples**
+
+
+In the following library, most sequences are 24-mers to 27-mers.
+This could indicate an abundance of endo-siRNAs (depending of course of what you've tried to sequence in the first place).
+
+.. image:: ../static/fastx_icons/fasta_clipping_histogram_1.png
+
+
+In the following library, most sequences are 19,22 or 23-mers.
+This could indicate an abundance of miRNAs (depending of course of what you've tried to sequence in the first place).
+
+.. image:: ../static/fastx_icons/fasta_clipping_histogram_2.png
+
+
+
+
diff --git a/tools/fastx_toolkit/fasta_collapser.xml b/tools/fastx_toolkit/fasta_collapser.xml
new file mode 100644
index 00000000000..032f0656bb3
--- /dev/null
+++ b/tools/fastx_toolkit/fasta_collapser.xml
@@ -0,0 +1,75 @@
+
+ sequences
+ fasta_collapser.pl $input $output
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+**What it does**
+
+This tool collapses identical sequences in a FASTA file into a single sequence.
+
+--------
+
+**Example**
+
+Example Input File (Sequence "ATAT" appears multiple times)::
+
+ >CSHL_2_FC0042AGLLOO_1_1_605_414
+ TGCG
+ >CSHL_2_FC0042AGLLOO_1_1_537_759
+ ATAT
+ >CSHL_2_FC0042AGLLOO_1_1_774_520
+ TGGC
+ >CSHL_2_FC0042AGLLOO_1_1_742_502
+ ATAT
+ >CSHL_2_FC0042AGLLOO_1_1_781_514
+ TGAG
+ >CSHL_2_FC0042AGLLOO_1_1_757_487
+ TTCA
+ >CSHL_2_FC0042AGLLOO_1_1_903_769
+ ATAT
+ >CSHL_2_FC0042AGLLOO_1_1_724_499
+ ATAT
+
+Example Output file::
+
+ >1-1
+ TGCG
+ >2-4
+ ATAT
+ >3-1
+ TGGC
+ >4-1
+ TGAG
+ >5-1
+ TTCA
+
+.. class:: infomark
+
+Original Sequence Names / Lane descriptions (e.g. "CSHL_2_FC0042AGLLOO_1_1_742_502") are discarded.
+
+The output seqeunce name is composed of two numbers: the first is the sequence's number, the second is the multiplicity value.
+
+The following output::
+
+ >2-4
+ ATAT
+
+means that the sequence "ATAT" is the second sequence in the file, and it appeared 4 times in the input FASTA file.
+
+
+
diff --git a/tools/fastx_toolkit/fastq_nucleotides_distribution.xml b/tools/fastx_toolkit/fastq_nucleotides_distribution.xml
new file mode 100644
index 00000000000..bbae04eb47b
--- /dev/null
+++ b/tools/fastx_toolkit/fastq_nucleotides_distribution.xml
@@ -0,0 +1,66 @@
+
+ chart
+ fastq_nucleotide_distribution_graph.sh -t '$input.name' -i $input -o $output
+
+
+
+
+
+
+
+
+
+
+**What it does**
+
+Creates a stacked-histogram graph for the nucleotide distribution in the Solexa library.
+
+.. class:: infomark
+
+**TIP:** Use the **FASTQ Statistics** tool to generate the report file needed for this tool.
+
+-----
+
+**Output Examples**
+
+
+
+The following chart clearly shows the barcode used at the 5'-end of the library: **GATCT**
+
+.. image:: ../static/fastx_icons/fastq_nucleotides_distribution_1.png
+
+
+
+
+
+
+
+In the following chart, one can almost 'read' the most abundant sequence by looking at the dominant values: **TGATA TCGTA TTGAT GACTG AA...**
+
+.. image:: ../static/fastx_icons/fastq_nucleotides_distribution_2.png
+
+
+
+
+
+
+
+
+The following chart shows a growing number of unknown (N) nucleotides towards later cycles (which might indicate a sequencing problem):
+
+.. image:: ../static/fastx_icons/fastq_nucleotides_distribution_3.png
+
+
+
+
+
+
+
+
+But most of the time, the chart will look rather random:
+
+.. image:: ../static/fastx_icons/fastq_nucleotides_distribution_4.png
+
+
+
+
diff --git a/tools/fastx_toolkit/fastq_qual_conv.xml b/tools/fastx_toolkit/fastq_qual_conv.xml
new file mode 100644
index 00000000000..a19f32c9f04
--- /dev/null
+++ b/tools/fastx_toolkit/fastq_qual_conv.xml
@@ -0,0 +1,82 @@
+
+ (ASCII-Numeric)
+ zcat -f $input | fastq_quality_converter $QUAL_FORMAT -o $output
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+**What it does**
+
+Converts a solexa FASTQ file to/from numeric or ASCII quality format.
+
+.. class:: warningmark
+
+Re-scaling is **not** performed. (e.g. conversion from Phred scale to Solexa scale).
+
+
+-----
+
+FASTQ with Numeric quality scores::
+
+ @CSHL__2_FC042AGWWWXX:8:1:120:202
+ ACGATAGATCGGAAGAGCTAGTATGCCGTTTTCTGC
+ +CSHL__2_FC042AGWWWXX:8:1:120:202
+ 40 40 40 40 20 40 40 40 40 6 40 40 28 40 40 25 40 20 40 -1 30 40 14 27 40 8 1 3 7 -1 11 10 -1 21 10 8
+ @CSHL__2_FC042AGWWWXX:8:1:103:1185
+ ATCACGATAGATCGGCAGAGCTCGTTTACCGTCTTC
+ +CSHL__2_FC042AGWWWXX:8:1:103:1185
+ 40 40 40 40 40 35 33 31 40 40 40 32 30 22 40 -0 9 22 17 14 8 36 15 34 22 12 23 3 10 -0 8 2 4 25 30 2
+
+
+FASTQ with ASCII quality scores::
+
+ @CSHL__2_FC042AGWWWXX:8:1:120:202
+ ACGATAGATCGGAAGAGCTAGTATGCCGTTTTCTGC
+ +CSHL__2_FC042AGWWWXX:8:1:120:202
+ hhhhThhhhFhh\hhYhTh?^hN[hHACG?KJ?UJH
+ @CSHL__2_FC042AGWWWXX:8:1:103:1185
+ ATCACGATAGATCGGCAGAGCTCGTTTACCGTCTTC
+ +CSHL__2_FC042AGWWWXX:8:1:103:1185
+ hhhhhca_hhh`^Vh@IVQNHdObVLWCJ@HBDY^B
+
+
+
+
+
diff --git a/tools/fastx_toolkit/fastq_qual_stat.xml b/tools/fastx_toolkit/fastq_qual_stat.xml
new file mode 100644
index 00000000000..c7a1de21477
--- /dev/null
+++ b/tools/fastx_toolkit/fastq_qual_stat.xml
@@ -0,0 +1,100 @@
+
+
+ zcat -f $input | fastq_quality_stats -o $output
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+**What it does**
+
+Creates quality statistics report for the given Solexa/FASTQ library.
+
+.. class:: infomark
+
+**TIP:** This statistics report can be used as input for **Quality Score** and **Nucleotides Distribution** tools.
+
+-----
+
+**The output file will contain the following fields:**
+
+* column = column number (1 to 36 for a 36-cycles read solexa file)
+* count = number of bases found in this column.
+* min = Lowest quality score value found in this column.
+* max = Highest quality score value found in this column.
+* sum = Sum of quality score values for this column.
+* mean = Mean quality score value for this column.
+* Q1 = 1st quartile quality score.
+* med = Median quality score.
+* Q3 = 3rd quartile quality score.
+* IQR = Inter-Quartile range (Q3-Q1).
+* lW = 'Left-Whisker' value (for boxplotting).
+* rW = 'Right-Whisker' value (for boxplotting).
+* A_Count = Count of 'A' nucleotides found in this column.
+* C_Count = Count of 'C' nucleotides found in this column.
+* G_Count = Count of 'G' nucleotides found in this column.
+* T_Count = Count of 'T' nucleotides found in this column.
+* N_Count = Count of 'N' nucleotides found in this column.
+
+
+
+
+
+
+**Output Example**::
+
+ column count min max sum mean Q1 med Q3 IQR lW rW A_Count C_Count G_Count T_Count N_Count
+ 1 6362991 -4 40 250734117 39.41 40 40 40 0 40 40 1396976 1329101 678730 2958184 0
+ 2 6362991 -5 40 250531036 39.37 40 40 40 0 40 40 1786786 1055766 1738025 1782414 0
+ 3 6362991 -5 40 248722469 39.09 40 40 40 0 40 40 2296384 984875 1443989 1637743 0
+ 4 6362991 -5 40 247654797 38.92 40 40 40 0 40 40 1683197 1410855 1722633 1546306 0
+ 5 6362991 -4 40 248214827 39.01 40 40 40 0 40 40 2536861 1167423 1248968 1409739 0
+ 6 6362991 -5 40 248499903 39.05 40 40 40 0 40 40 1598956 1236081 1568608 1959346 0
+ 7 6362991 -4 40 247719760 38.93 40 40 40 0 40 40 1692667 1822140 1496741 1351443 0
+ 8 6362991 -5 40 245745205 38.62 40 40 40 0 40 40 2230936 1343260 1529928 1258867 0
+ 9 6362991 -5 40 245766735 38.62 40 40 40 0 40 40 1702064 1306257 1336511 2018159 0
+ 10 6362991 -5 40 245089706 38.52 40 40 40 0 40 40 1519917 1446370 1450995 1945709 0
+ 11 6362991 -5 40 242641359 38.13 40 40 40 0 40 40 1717434 1282975 1387804 1974778 0
+ 12 6362991 -5 40 242026113 38.04 40 40 40 0 40 40 1662872 1202041 1519721 1978357 0
+ 13 6362991 -5 40 238704245 37.51 40 40 40 0 40 40 1549965 1271411 1973291 1566681 1643
+ 14 6362991 -5 40 235622401 37.03 40 40 40 0 40 40 2101301 1141451 1603990 1515774 475
+ 15 6362991 -5 40 230766669 36.27 40 40 40 0 40 40 2344003 1058571 1440466 1519865 86
+ 16 6362991 -5 40 224466237 35.28 38 40 40 2 35 40 2203515 1026017 1474060 1651582 7817
+ 17 6362991 -5 40 219990002 34.57 34 40 40 6 25 40 1522515 1125455 2159183 1555765 73
+ 18 6362991 -5 40 214104778 33.65 30 40 40 10 15 40 1479795 2068113 1558400 1249337 7346
+ 19 6362991 -5 40 212934712 33.46 30 40 40 10 15 40 1432749 1231352 1769799 1920093 8998
+ 20 6362991 -5 40 212787944 33.44 29 40 40 11 13 40 1311657 1411663 2126316 1513282 73
+ 21 6362991 -5 40 211369187 33.22 28 40 40 12 10 40 1887985 1846300 1300326 1318380 10000
+ 22 6362991 -5 40 213371720 33.53 30 40 40 10 15 40 542299 3446249 516615 1848190 9638
+ 23 6362991 -5 40 221975899 34.89 36 40 40 4 30 40 347679 1233267 926621 3855355 69
+ 24 6362991 -5 40 194378421 30.55 21 40 40 19 -5 40 433560 674358 3262764 1992242 67
+ 25 6362991 -5 40 199773985 31.40 23 40 40 17 -2 40 944760 325595 1322800 3769641 195
+ 26 6362991 -5 40 179404759 28.20 17 34 40 23 -5 40 3457922 156013 1494664 1254293 99
+ 27 6362991 -5 40 163386668 25.68 13 28 40 27 -5 40 1392177 281250 3867895 821491 178
+ 28 6362991 -5 40 156230534 24.55 12 25 40 28 -5 40 907189 981249 4174945 299437 171
+ 29 6362991 -5 40 163236046 25.65 13 28 40 27 -5 40 1097171 3418678 1567013 280008 121
+ 30 6362991 -5 40 151309826 23.78 12 23 40 28 -5 40 3514775 2036194 566277 245613 132
+ 31 6362991 -5 40 141392520 22.22 10 21 40 30 -5 40 1569000 4571357 124732 97721 181
+ 32 6362991 -5 40 143436943 22.54 10 21 40 30 -5 40 1453607 4519441 38176 351107 660
+ 33 6362991 -5 40 114269843 17.96 6 14 30 24 -5 40 3311001 2161254 155505 734297 934
+ 34 6362991 -5 40 140638447 22.10 10 20 40 30 -5 40 1501615 1637357 18113 3205237 669
+ 35 6362991 -5 40 138910532 21.83 10 20 40 30 -5 40 1532519 3495057 23229 1311834 352
+ 36 6362991 -5 40 117158566 18.41 7 15 30 23 -5 40 4074444 1402980 63287 822035 245
+
+
+
+
+
diff --git a/tools/fastx_toolkit/fastq_quality_boxplot.xml b/tools/fastx_toolkit/fastq_quality_boxplot.xml
new file mode 100644
index 00000000000..2ba0f04d517
--- /dev/null
+++ b/tools/fastx_toolkit/fastq_quality_boxplot.xml
@@ -0,0 +1,47 @@
+
+ chart
+
+ fastq_quality_boxplot_graph.sh -t '$input.name' -i $input -o $output
+
+
+
+
+
+
+
+
+
+
+**What it does**
+
+Creates a boxplot graph for the quality scores in the library.
+
+.. class:: infomark
+
+**TIP:** Use the **FASTQ Statistics** tool to generate the report file needed for this tool.
+
+-----
+
+**Output Examples**
+
+* Black horizontal lines are medians
+* Rectangular red boxes show the Inter-quartile Range (IQR) (top value is Q3, bottom value is Q1)
+* Whiskers show outlier at max. 1.5*IQR
+
+
+An excellent quality library (median quality is 40 for almost all 36 cycles):
+
+.. image:: ../static/fastx_icons/fastq_quality_boxplot_1.png
+
+
+A relatively good quality library (median quality degrades towards later cycles):
+
+.. image:: ../static/fastx_icons/fastq_quality_boxplot_2.png
+
+A low quality library (median drops quickly):
+
+.. image:: ../static/fastx_icons/fastq_quality_boxplot_3.png
+
+
+
+
diff --git a/tools/fastx_toolkit/fastq_quality_filter.xml b/tools/fastx_toolkit/fastq_quality_filter.xml
new file mode 100644
index 00000000000..28c7044b33c
--- /dev/null
+++ b/tools/fastx_toolkit/fastq_quality_filter.xml
@@ -0,0 +1,73 @@
+
+
+
+ zcat -f '$input' | fastq_quality_filter -q $quality -p $percent -v -o $output
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+**What it does**
+
+This tool filters reads based on quality scores.
+
+.. class:: infomark
+
+Using **percent = 100** requires all cycles of all reads to be at least the quality cut-off value.
+
+.. class:: infomark
+
+Using **percent = 50** requires the median quality of the cycles (in each read) to be at least the quality cut-off value.
+
+--------
+
+Quality score distribution (of all cycles) is calculated for each read. If it is lower than the quality cut-off value - the read is discarded.
+
+
+**Example**::
+
+ @CSHL_4_FC042AGOOII:1:2:214:584
+ GACAATAAAC
+ +CSHL_4_FC042AGOOII:1:2:214:584
+ 30 30 30 30 30 30 30 30 20 10
+
+Using **percent = 50** and **cut-off = 30** - This read will not be discarded (the median quality is higher than 30).
+
+Using **percent = 90** and **cut-off = 30** - This read will be discarded (90% of the cycles do no have quality equal to / higher than 30).
+
+Using **percent = 100** and **cut-off = 20** - This read will be discarded (not all cycles have quality equal to / higher than 20).
+
+
+
+
+
diff --git a/tools/fastx_toolkit/fastq_to_fasta.xml b/tools/fastx_toolkit/fastq_to_fasta.xml
new file mode 100644
index 00000000000..530857faa49
--- /dev/null
+++ b/tools/fastx_toolkit/fastq_to_fasta.xml
@@ -0,0 +1,70 @@
+
+ converter
+ gunzip -cf $input | fastq_to_fasta $SKIPN $RENAMESEQ -o $output -v
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+**What it does**
+
+This tool converts data from Solexa format to FASTA format (scroll down for format description).
+
+--------
+
+**Example**
+
+The following data in Solexa-FASTQ format::
+
+ @CSHL_4_FC042GAMMII_2_1_517_596
+ GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT
+ +CSHL_4_FC042GAMMII_2_1_517_596
+ 40 40 40 40 40 40 40 40 40 40 38 40 40 40 40 40 14 40 40 40 40 40 36 40 13 14 24 24 9 24 9 40 10 10 15 40
+
+Will be converted to FASTA (with 'rename sequence names' = NO)::
+
+ >CSHL_4_FC042GAMMII_2_1_517_596
+ GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT
+
+Will be converted to FASTA (with 'rename sequence names' = YES)::
+
+ >1
+ GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT
+
+
+
+
diff --git a/tools/fastx_toolkit/fastx_artifacts_filter.xml b/tools/fastx_toolkit/fastx_artifacts_filter.xml
new file mode 100644
index 00000000000..2397f9652aa
--- /dev/null
+++ b/tools/fastx_toolkit/fastx_artifacts_filter.xml
@@ -0,0 +1,80 @@
+
+
+ zcat -f '$input' | fastx_artifacts_filter -v -o "$output"
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+**What it does**
+
+This tool filters sequencing artifacts (reads with all but 3 identical bases).
+
+--------
+
+**The following is an example of sequences which will be filtered out**::
+
+ AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
+ AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
+ AAAAAAAAAAAAAAAAAAAACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
+ AAAAAAAAAAAAAAAAAAACACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
+ AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
+ AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
+ AAAAAAAAAAAAAAAAAAACACAAAAAAAAAAAAAAAAAAAAAAAAAAAAACACAAAAAA
+ AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
+ AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
+ AAAAAAAAAAAAAAAAAAAAAAAAAACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
+ AAAAAACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
+ AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
+ CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC
+ AAAAACACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
+ AAAAAAAAAAAAAAAAAAAAAAAAACACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
+ AAAAAAAAAAAAAAAAAAACACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAAAAAA
+ AAAAAAAAAAACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
+ AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAAAA
+ AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
+ AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAAAAAA
+ AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACA
+ AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAAAAAAA
+ AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAA
+ AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAA
+ AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAAA
+ AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAAAAAAAAAA
+ AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAAAAA
+ AAAAAAAAAACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
+ AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAAAAAAAAA
+ AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
+ AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAAAAAAAA
+ AAAAAAAAAAAAAAAAAAACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
+ AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAAAAAAAAAAAA
+ AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
+ AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAAAAAAAAAAAAAA
+ AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAAAAAAAAAAAAAAAAAAAAA
+ AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAAAAAAAAAAAAAAAAAAAAAAAA
+ AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
+ AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
+ AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAAAAAAAAAAAAAAAAAAAAAAA
+ AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAAAAAAAAAAAAAAA
+ AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAAAAAAAAAAA
+
+
+
+
diff --git a/tools/fastx_toolkit/fastx_barcode_splitter.xml b/tools/fastx_toolkit/fastx_barcode_splitter.xml
new file mode 100644
index 00000000000..0b22466adb7
--- /dev/null
+++ b/tools/fastx_toolkit/fastx_barcode_splitter.xml
@@ -0,0 +1,68 @@
+
+
+ fastx_barcode_splitter_galaxy_wrapper.sh $BARCODE $input "$input.name" --mismatches $mismatches --partial $partial $EOL > $output
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+**What it does**
+
+This tool splits a solexa library (FASTQ file) or a regular FASTA file to several files, using barcodes as the split criteria.
+
+--------
+
+**Barcode file Format**
+
+Barcode files are simple text files.
+Each line should contain an identifier (descriptive name for the barcode), and the barcode itself (A/C/G/T), separated by a TAB character.
+Example::
+
+ #This line is a comment (starts with a 'number' sign)
+ BC1 GATCT
+ BC2 ATCGT
+ BC3 GTGAT
+ BC4 TGTCT
+
+For each barcode, a new FASTQ file will be created (with the barcode's identifier as part of the file name).
+Sequences matching the barcode will be stored in the appropriate file.
+
+One additional FASTQ file will be created (the 'unmatched' file), where sequences not matching any barcode will be stored.
+
+The output of this tool is an HTML file, displaying the split counts and the file locations.
+
+**Output Example**
+
+.. image:: ../static/fastx_icons/barcode_splitter_output_example.png
+
+
+
+
diff --git a/tools/fastx_toolkit/fastx_clipper.xml b/tools/fastx_toolkit/fastx_clipper.xml
new file mode 100644
index 00000000000..f0ed8a9a416
--- /dev/null
+++ b/tools/fastx_toolkit/fastx_clipper.xml
@@ -0,0 +1,109 @@
+
+ adapter sequences
+
+ zcat -f $input | fastx_clipper -s $maxmismatches -l $minlength -a $clip_source.clip_sequence -d $keepdelta -o $output -v $KEEP_N $DISCARD_OPTIONS
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+ use this for hairpin barcoding. keep at 0 unless you know what you're doing.
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+**What it does**
+
+This tool clips adapters from the 3'-end of the sequences in a FASTA/FASTQ file.
+
+--------
+
+
+**Clipping Illustration:**
+
+.. image:: ../static/fastx_icons/fastx_clipper_illustration.png
+
+
+
+
+
+
+
+
+**Clipping Example:**
+
+.. image:: ../static/fastx_icons/fastx_clipper_example.png
+
+
+
+**In the above example:**
+
+* Sequence no. 1 was discarded since it wasn't clipped (i.e. didn't contain the adapter sequence). (**Output** parameter).
+* Sequence no. 5 was discarded --- it's length (after clipping) was shorter than 15 nt (**Minimum Sequence Length** parameter).
+
+
+
+
+
+
diff --git a/tools/fastx_toolkit/fastx_reverse_complement.xml b/tools/fastx_toolkit/fastx_reverse_complement.xml
new file mode 100644
index 00000000000..a4321eb846d
--- /dev/null
+++ b/tools/fastx_toolkit/fastx_reverse_complement.xml
@@ -0,0 +1,52 @@
+
+ sequences
+ zcat -f '$input' | fastx_reverse_complement -v -o $output
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+**What it does**
+
+This tool reverse-complements each sequence in a library.
+If the library is a FASTQ, the quality-scores are also reversed.
+
+--------
+
+**Example**
+
+Input FASTQ file::
+
+ @CSHL_1_FC42AGWWWXX:8:1:3:740
+ TGTCTGTAGCCTCNTCCTTGTAATTCAAAGNNGGTA
+ +CSHL_1_FC42AGWWWXX:8:1:3:740
+ 33 33 33 34 33 33 33 33 33 33 33 33 27 5 27 33 33 33 33 33 33 27 21 27 33 32 31 29 26 24 5 5 15 17 27 26
+
+
+Output FASTQ file::
+
+ @CSHL_1_FC42AGWWWXX:8:1:3:740
+ TACCNNCTTTGAATTACAAGGANGAGGCTACAGACA
+ +CSHL_1_FC42AGWWWXX:8:1:3:740
+ 26 27 17 15 5 5 24 26 29 31 32 33 27 21 27 33 33 33 33 33 33 27 5 27 33 33 33 33 33 33 33 33 34 33 33 33
+
+
+
diff --git a/tools/fastx_toolkit/fastx_trimmer.xml b/tools/fastx_toolkit/fastx_trimmer.xml
new file mode 100644
index 00000000000..96d5e16c9db
--- /dev/null
+++ b/tools/fastx_toolkit/fastx_trimmer.xml
@@ -0,0 +1,70 @@
+
+ sequences
+ zcat -f '$input' | fastx_trimmer -v -f $first -l $last -o $output
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+**What it does**
+
+This tool trims (cut bases from) sequences in a FASTA/Q file.
+
+--------
+
+**Example**
+
+Input Fasta file (with 36 bases in each sequences)::
+
+ >1-1
+ TATGGTCAGAAACCATATGCAGAGCCTGTAGGCACC
+ >2-1
+ CAGCGAGGCTTTAATGCCATTTGGCTGTAGGCACCA
+
+
+Trimming with First=1 and Last=21, we get a FASTA file with 21 bases in each sequences (starting from the first base)::
+
+ >1-1
+ TATGGTCAGAAACCATATGCA
+ >2-1
+ CAGCGAGGCTTTAATGCCATT
+
+Trimming with First=6 and Last=10, will generate a FASTA file with 5 bases (bases 6,7,8,9,10) in each sequences::
+
+ >1-1
+ TCAGA
+ >2-1
+ AGGCT
+
+
+
+