mirror of
https://github.com/galaxyproject/galaxy.git
synced 2026-09-24 16:30:27 +08:00
Modified Solid_to_Fastq's underlying perl script so that it would not produce the None file, and also uncommented tests and updated example
This commit is contained in:
Kelly Vincent
@@ -8,9 +8,9 @@ use warnings;
|
||||
use Getopt::Std;
|
||||
|
||||
my %opts;
|
||||
my $version = '0.1.2';
|
||||
my $version = '0.1.3';
|
||||
my $usage = qq{
|
||||
Usage: solid2fastq.pl <paired> <outfile1> <outfile2> <outfile3> <F3.csfasta> <F3.qual> <R3.csfasta> <R3.qual>
|
||||
Usage: solid2fastq.pl <paired> <outfile1> <outfile2> <F3.csfasta> <F3.qual> <R3.csfasta> <R3.qual>
|
||||
|
||||
Note: <in.title> is the string showed in the `# Title:' line of a
|
||||
".csfasta" read file. Then <in.title>F3.csfasta is read sequence
|
||||
@@ -25,13 +25,11 @@ Note: <in.title> is the string showed in the `# Title:' line of a
|
||||
};
|
||||
|
||||
getopts('', \%opts);
|
||||
die($usage) if (@ARGV != 8);
|
||||
my ($is_paired,$outfile1,$outfile2,$outfile3,$f3reads,$f3qual,$r3reads,$r3qual) = @ARGV;
|
||||
die($usage) if (@ARGV != 7);
|
||||
my ($is_paired,$outfile1,$outfile2,$f3reads,$f3qual,$r3reads,$r3qual) = @ARGV;
|
||||
my (@fhr, @fhw);
|
||||
my $fn = '';
|
||||
my @fn_suff = ($f3reads,$f3qual,$r3reads,$r3qual);
|
||||
#my @fn_suff = ('F3.csfasta', 'F3_QV.qual', 'R3.csfasta', 'R3_QV.qual');
|
||||
#my $is_paired = (-f "$title$fn_suff[2]" || -f "$title$fn_suff[2].gz")? 1 : 0;
|
||||
if ($is_paired eq "yes") { # paired end
|
||||
for (0 .. 3) {
|
||||
$fn = $fn_suff[$_];
|
||||
@@ -40,33 +38,12 @@ if ($is_paired eq "yes") { # paired end
|
||||
}
|
||||
open($fhw[0], "|gzip >$outfile2") || die;
|
||||
open($fhw[1], "|gzip >$outfile1") || die;
|
||||
open($fhw[2], "|gzip >$outfile3") || die;
|
||||
my (@df, @dr);
|
||||
@df = &read1(1); @dr = &read1(2);
|
||||
while (@df && @dr) {
|
||||
if ($df[0] eq $dr[0]) { # mate pair
|
||||
print {$fhw[0]} $df[1]; print {$fhw[1]} $dr[1];
|
||||
@df = &read1(1); @dr = &read1(2);
|
||||
} else {
|
||||
if ($df[0] le $dr[0]) {
|
||||
print {$fhw[2]} $df[1];
|
||||
@df = &read1(1);
|
||||
} else {
|
||||
print {$fhw[2]} $dr[1];
|
||||
@dr = &read1(2);
|
||||
}
|
||||
}
|
||||
}
|
||||
if (@df) {
|
||||
print {$fhw[2]} $df[1];
|
||||
while (@df = &read1(1, $fhr[0], $fhr[1])) {
|
||||
print {$fhw[2]} $df[1];
|
||||
}
|
||||
}
|
||||
if (@dr) {
|
||||
print {$fhw[2]} $dr[1];
|
||||
while (@dr = &read1(2, $fhr[2], $fhr[3])) {
|
||||
print {$fhw[2]} $dr[1];
|
||||
}
|
||||
}
|
||||
close($fhr[$_]) for (0 .. $#fhr);
|
||||
@@ -95,7 +72,7 @@ sub read1 {
|
||||
my $t = <$fhq>;
|
||||
if (/^>(\d+)_(\d+)_(\d+)_[FR]3/) {
|
||||
$key = sprintf("%.4d_%.4d_%.4d", $1, $2, $3); # this line could be improved on 64-bit machines
|
||||
#print $key;
|
||||
#print $key;
|
||||
die(qq/** unmatched read name: '$_' != '$_'\n/) unless ($_ eq $t);
|
||||
my $name = "$1_$2_$3/$i";
|
||||
$_ = substr(<$fhs>, 2);
|
||||
@@ -106,7 +83,7 @@ sub read1 {
|
||||
s/(\d+)\s*/chr($1+33)/eg;
|
||||
$seq = qq/\@$name\n$s+\n$_\n/;
|
||||
last;
|
||||
}
|
||||
}
|
||||
}
|
||||
return defined($seq)? ($key, $seq) : ();
|
||||
}
|
||||
|
||||
@@ -30,7 +30,7 @@ def __main__():
|
||||
tmpf = tempfile.NamedTemporaryFile() #forward reads
|
||||
if options.input3 != "None" and options.input4 != "None":
|
||||
tmpr = tempfile.NamedTemporaryFile() #reverse reads
|
||||
cmd1 = "%s/bwa_solid2fastq_modified.pl 'yes' %s %s %s %s %s %s %s 2>&1" %(os.path.split(sys.argv[0])[0], tmpf.name,tmpr.name,None,options.input1,options.input2,options.input3,options.input4)
|
||||
cmd1 = "%s/bwa_solid2fastq_modified.pl 'yes' %s %s %s %s %s %s 2>&1" %(os.path.split(sys.argv[0])[0], tmpf.name,tmpr.name,options.input1,options.input2,options.input3,options.input4)
|
||||
try:
|
||||
os.system(cmd1)
|
||||
os.system('gunzip -c %s >> %s' %(tmpf.name,options.output1))
|
||||
@@ -40,7 +40,7 @@ def __main__():
|
||||
tmpr.close()
|
||||
# if single-end data
|
||||
else:
|
||||
cmd1 = "%s/bwa_solid2fastq_modified.pl 'no' %s %s %s %s %s %s %s 2>&1" % (os.path.split(sys.argv[0])[0], tmpf.name, None, None, options.input1, options.input2, None, None)
|
||||
cmd1 = "%s/bwa_solid2fastq_modified.pl 'no' %s %s %s %s %s %s 2>&1" % (os.path.split(sys.argv[0])[0], tmpf.name, None, options.input1, options.input2, None, None)
|
||||
try:
|
||||
os.system(cmd1)
|
||||
os.system('gunzip -c %s >> %s' % (tmpf.name, options.output1))
|
||||
|
||||
@@ -44,15 +44,12 @@
|
||||
</data>
|
||||
</outputs>
|
||||
<tests>
|
||||
<!--
|
||||
<test>
|
||||
<param name="pairedSingle" value="single" />
|
||||
<param name="input1" value="s2fq_phiX.csfasta" ftype="csfasta" />
|
||||
<param name="input2" value="s2fq_phiX.qualsolid" ftype="qualsolid" />
|
||||
<output name="output1" file="s2fq_out1.fastqsanger" />
|
||||
</test>
|
||||
-->
|
||||
<!-- testing framework does not deal with multiple outputs yet
|
||||
<test>
|
||||
<param name="pairedSingle" value="paired" />
|
||||
<param name="input1" value="s2fq_paired_F3.csfasta" ftype="csfasta" />
|
||||
@@ -60,9 +57,10 @@
|
||||
<param name="input3" value="s2fq_paired_R3.csfasta" ftype="csfasta" />
|
||||
<param name="input4" value="s2fq_paired_R3_QV.qualsolid" ftype="qualsolid" />
|
||||
<output name="output1" file="s2fq_out2.fastqsanger" />
|
||||
<!-- testing framework does not deal with multiple outputs yet
|
||||
<output name="output2" file="s2fq_out3.fastqsanger" />
|
||||
-->
|
||||
</test>
|
||||
-->
|
||||
</tests>
|
||||
<help>
|
||||
|
||||
@@ -76,25 +74,25 @@ This tool takes reads and quality files and converts them to FASTQ data ( Sanger
|
||||
|
||||
- Converting the following sequences::
|
||||
|
||||
>seq1
|
||||
>1831_573_1004_F3
|
||||
T00030133312212111300011021310132222
|
||||
>seq2
|
||||
>1831_573_1567_F3
|
||||
T03330322230322112131010221102122113
|
||||
|
||||
- and quality scores::
|
||||
|
||||
>seq1
|
||||
4 29 34 34 32 32 24 24 20 17 10 34 29 20 34 13 30 34 22 24 11 28 19 17 34 17 24 17 25 34 7 24 14 12 22
|
||||
>seq2
|
||||
8 26 31 31 16 22 30 31 28 29 22 30 30 31 32 23 30 28 28 31 19 32 30 32 19 8 32 10 13 6 32 10 6 16 11
|
||||
>1831_573_1004_F3
|
||||
4 29 34 34 32 32 24 24 20 17 10 34 29 20 34 13 30 34 22 24 11 28 19 17 34 17 24 17 25 34 7 24 14 12 22
|
||||
>1831_573_1567_F3
|
||||
8 26 31 31 16 22 30 31 28 29 22 30 30 31 32 23 30 28 28 31 19 32 30 32 19 8 32 10 13 6 32 10 6 16 11
|
||||
|
||||
- will produce the following Sanger FASTQ data::
|
||||
|
||||
@seq1
|
||||
@1831_573_1004/1
|
||||
AATACTTTCGGCGCCCTAAACCAGCTCACTGGGG
|
||||
+
|
||||
>CCAA9952+C>5C.?C79,=42C292:C(9/-7
|
||||
@seq2
|
||||
@1831_573_1567/1
|
||||
TTTATGGGTATGGCCGCTCACAGGCCAGCGGCCT
|
||||
+
|
||||
;@@17?@=>7??@A8?==@4A?A4)A+.'A+'1,
|
||||
|
||||
Reference in New Issue
Block a user