From 6dc8d3b3c49e44b4aa156e6a8dea8c90ad65ee7f Mon Sep 17 00:00:00 2001 From: Kelly Vincent Date: Tue, 13 Oct 2009 16:49:38 -0400 Subject: [PATCH] Modified Solid_to_Fastq's underlying perl script so that it would not produce the None file, and also uncommented tests and updated example --- .../bwa_solid2fastq_modified.pl | 35 ++++--------------- tools/next_gen_conversion/solid_to_fastq.py | 4 +-- tools/next_gen_conversion/solid_to_fastq.xml | 22 ++++++------ 3 files changed, 18 insertions(+), 43 deletions(-) diff --git a/tools/next_gen_conversion/bwa_solid2fastq_modified.pl b/tools/next_gen_conversion/bwa_solid2fastq_modified.pl index d38d38732e1..8147d973cda 100755 --- a/tools/next_gen_conversion/bwa_solid2fastq_modified.pl +++ b/tools/next_gen_conversion/bwa_solid2fastq_modified.pl @@ -8,9 +8,9 @@ use warnings; use Getopt::Std; my %opts; -my $version = '0.1.2'; +my $version = '0.1.3'; my $usage = qq{ -Usage: solid2fastq.pl +Usage: solid2fastq.pl Note: is the string showed in the `# Title:' line of a ".csfasta" read file. Then F3.csfasta is read sequence @@ -25,13 +25,11 @@ Note: is the string showed in the `# Title:' line of a }; getopts('', \%opts); -die($usage) if (@ARGV != 8); -my ($is_paired,$outfile1,$outfile2,$outfile3,$f3reads,$f3qual,$r3reads,$r3qual) = @ARGV; +die($usage) if (@ARGV != 7); +my ($is_paired,$outfile1,$outfile2,$f3reads,$f3qual,$r3reads,$r3qual) = @ARGV; my (@fhr, @fhw); my $fn = ''; my @fn_suff = ($f3reads,$f3qual,$r3reads,$r3qual); -#my @fn_suff = ('F3.csfasta', 'F3_QV.qual', 'R3.csfasta', 'R3_QV.qual'); -#my $is_paired = (-f "$title$fn_suff[2]" || -f "$title$fn_suff[2].gz")? 1 : 0; if ($is_paired eq "yes") { # paired end for (0 .. 3) { $fn = $fn_suff[$_]; @@ -40,33 +38,12 @@ if ($is_paired eq "yes") { # paired end } open($fhw[0], "|gzip >$outfile2") || die; open($fhw[1], "|gzip >$outfile1") || die; - open($fhw[2], "|gzip >$outfile3") || die; my (@df, @dr); @df = &read1(1); @dr = &read1(2); while (@df && @dr) { if ($df[0] eq $dr[0]) { # mate pair print {$fhw[0]} $df[1]; print {$fhw[1]} $dr[1]; @df = &read1(1); @dr = &read1(2); - } else { - if ($df[0] le $dr[0]) { - print {$fhw[2]} $df[1]; - @df = &read1(1); - } else { - print {$fhw[2]} $dr[1]; - @dr = &read1(2); - } - } - } - if (@df) { - print {$fhw[2]} $df[1]; - while (@df = &read1(1, $fhr[0], $fhr[1])) { - print {$fhw[2]} $df[1]; - } - } - if (@dr) { - print {$fhw[2]} $dr[1]; - while (@dr = &read1(2, $fhr[2], $fhr[3])) { - print {$fhw[2]} $dr[1]; } } close($fhr[$_]) for (0 .. $#fhr); @@ -95,7 +72,7 @@ sub read1 { my $t = <$fhq>; if (/^>(\d+)_(\d+)_(\d+)_[FR]3/) { $key = sprintf("%.4d_%.4d_%.4d", $1, $2, $3); # this line could be improved on 64-bit machines - #print $key; + #print $key; die(qq/** unmatched read name: '$_' != '$_'\n/) unless ($_ eq $t); my $name = "$1_$2_$3/$i"; $_ = substr(<$fhs>, 2); @@ -106,7 +83,7 @@ sub read1 { s/(\d+)\s*/chr($1+33)/eg; $seq = qq/\@$name\n$s+\n$_\n/; last; - } + } } return defined($seq)? ($key, $seq) : (); } diff --git a/tools/next_gen_conversion/solid_to_fastq.py b/tools/next_gen_conversion/solid_to_fastq.py index 90bc890b734..544cb80ae47 100644 --- a/tools/next_gen_conversion/solid_to_fastq.py +++ b/tools/next_gen_conversion/solid_to_fastq.py @@ -30,7 +30,7 @@ def __main__(): tmpf = tempfile.NamedTemporaryFile() #forward reads if options.input3 != "None" and options.input4 != "None": tmpr = tempfile.NamedTemporaryFile() #reverse reads - cmd1 = "%s/bwa_solid2fastq_modified.pl 'yes' %s %s %s %s %s %s %s 2>&1" %(os.path.split(sys.argv[0])[0], tmpf.name,tmpr.name,None,options.input1,options.input2,options.input3,options.input4) + cmd1 = "%s/bwa_solid2fastq_modified.pl 'yes' %s %s %s %s %s %s 2>&1" %(os.path.split(sys.argv[0])[0], tmpf.name,tmpr.name,options.input1,options.input2,options.input3,options.input4) try: os.system(cmd1) os.system('gunzip -c %s >> %s' %(tmpf.name,options.output1)) @@ -40,7 +40,7 @@ def __main__(): tmpr.close() # if single-end data else: - cmd1 = "%s/bwa_solid2fastq_modified.pl 'no' %s %s %s %s %s %s %s 2>&1" % (os.path.split(sys.argv[0])[0], tmpf.name, None, None, options.input1, options.input2, None, None) + cmd1 = "%s/bwa_solid2fastq_modified.pl 'no' %s %s %s %s %s %s 2>&1" % (os.path.split(sys.argv[0])[0], tmpf.name, None, options.input1, options.input2, None, None) try: os.system(cmd1) os.system('gunzip -c %s >> %s' % (tmpf.name, options.output1)) diff --git a/tools/next_gen_conversion/solid_to_fastq.xml b/tools/next_gen_conversion/solid_to_fastq.xml index afe56f47a3c..7cc0086a422 100644 --- a/tools/next_gen_conversion/solid_to_fastq.xml +++ b/tools/next_gen_conversion/solid_to_fastq.xml @@ -44,15 +44,12 @@ - - - --> @@ -76,25 +74,25 @@ This tool takes reads and quality files and converts them to FASTQ data ( Sanger - Converting the following sequences:: - >seq1 + >1831_573_1004_F3 T00030133312212111300011021310132222 - >seq2 + >1831_573_1567_F3 T03330322230322112131010221102122113 - and quality scores:: - >seq1 - 4 29 34 34 32 32 24 24 20 17 10 34 29 20 34 13 30 34 22 24 11 28 19 17 34 17 24 17 25 34 7 24 14 12 22 - >seq2 - 8 26 31 31 16 22 30 31 28 29 22 30 30 31 32 23 30 28 28 31 19 32 30 32 19 8 32 10 13 6 32 10 6 16 11 + >1831_573_1004_F3 + 4 29 34 34 32 32 24 24 20 17 10 34 29 20 34 13 30 34 22 24 11 28 19 17 34 17 24 17 25 34 7 24 14 12 22 + >1831_573_1567_F3 + 8 26 31 31 16 22 30 31 28 29 22 30 30 31 32 23 30 28 28 31 19 32 30 32 19 8 32 10 13 6 32 10 6 16 11 - will produce the following Sanger FASTQ data:: - @seq1 + @1831_573_1004/1 AATACTTTCGGCGCCCTAAACCAGCTCACTGGGG + >CCAA9952+C>5C.?C79,=42C292:C(9/-7 - @seq2 + @1831_573_1567/1 TTTATGGGTATGGCCGCTCACAGGCCAGCGGCCT + ;@@17?@=>7??@A8?==@4A?A4)A+.'A+'1,