EMBOSS tools upgrade to version 5.0 - msbar, needle and newcpgseek

This commit is contained in:
Chinmay Rao
2007-12-11 21:17:10 +00:00
parent 73e52be7a0
commit 5f4ea17fd8
3 changed files with 275 additions and 0 deletions
+116
View File
@@ -0,0 +1,116 @@
<tool id="EMBOSS_msbar55" name="msbar">
<description>Mutate sequence beyond all recognition</description>
<command>msbar -sequence $input1 -outseq $out_file1 -count $count -point $point -block $block -codon $codon -inframe $inframe -minimum $minimum -maximum $maximum -osformat2 $out_format1
-auto</command>
<inputs>
<param format="fasta" name="input1" type="data">
<label>Sequence 1</label>
</param>
<param name="count" size="4" type="text" value="1">
<label>Number of times to perform the mutation operations</label>
</param>
<param name="point" type="select">
<label>Types of point mutations to perform</label>
<option value="0">None</option>
<option value="1">Any of the following</option>
<option value="2">Insertions</option>
<option value="3">Deletions</option>
<option value="4">Changes</option>
<option value="5">Duplications</option>
<option value="6">Moves</option>
</param>
<param name="block" type="select">
<label>Types of block mutations to perform</label>
<option value="0">None</option>
<option value="1">Any of the following</option>
<option value="2">Insertions</option>
<option value="3">Deletions</option>
<option value="4">Changes</option>
<option value="5">Duplications</option>
<option value="6">Moves</option>
</param>
<param name="codon" type="select">
<label>Types of codon mutations to perform. These are only done if the sequence is nucleic</label>
<option value="0">None</option>
<option value="1">Any of the following</option>
<option value="2">Insertions</option>
<option value="3">Deletions</option>
<option value="4">Changes</option>
<option value="5">Duplications</option>
<option value="6">Moves</option>
</param>
<param name="inframe" type="select">
<label>Do 'codon' and 'block' operations in frame</label>
<option value="no">No</option>
<option value="yes">Yes</option>
</param>
<param name="minimum" size="4" type="text" value="1">
<label>Minimum size for a block mutation</label>
</param>
<param name="maximum" size="4" type="text" value="10">
<label>Maximum size for a block mutation</label>
</param>
<param name="out_format1" type="select">
<label>Output Sequence File Format</label>
<option value="fasta">FASTA (m)</option>
<option value="acedb">ACeDB (m)</option>
<option value="asn1">ASN.1 (m)</option>
<option value="clustal">Clustal (m)</option>
<option value="codata">CODATA (m)</option>
<option value="embl">EMBL (m)</option>
<option value="fitch">Fitch (m)</option>
<option value="gcg">Wisconsin Package GCG 9.x and 10.x (s)</option>
<option value="genbank">GENBANK (m)</option>
<option value="gff">GFF (m)</option>
<option value="hennig86">Hennig86 (m)</option>
<option value="ig">Intelligenetics (m)</option>
<option value="jackknifer">Jackknifer (m)</option>
<option value="jackknifernon">Jackknifernon (m)</option>
<option value="mega">Mega (m)</option>
<option value="meganon">Meganon (m)</option>
<option value="msf">Wisconsin Package GCG's MSF (m)</option>
<option value="pir">NBRF (PIR) (m)</option>
<option value="ncbi">NCBI style FASTA (m)</option>
<option value="nexus">Nexus/PAUP (m)</option>
<option value="nexusnon">Nexusnon/PAUPnon (m)</option>
<option value="phylip">PHYLIP interleaved (m)</option>
<option value="phylipnon">PHYLIP non-interleaved (m)</option>
<option value="selex">SELEX (m)</option>
<option value="staden">Staden (s)</option>
<option value="strider">DNA strider (m)</option>
<option value="swiss">SwisProt entry (m)</option>
<option value="text">Plain sequence (s)</option>
<option value="treecon">Treecon (m)</option>
</param>
</inputs>
<outputs>
<data format="fasta" name="out_file1" />
</outputs>
<tests>
<test>
<param name="input1" value="2.fasta"/>
<param name="count" value="1"/>
<param name="point" value="0"/>
<param name="block" value="0"/>
<param name="codon" value="0"/>
<param name="inframe" value="no"/>
<param name="minimum" value="1"/>
<param name="maximum" value="10"/>
<param name="out_format1" value="fasta"/>
<output name="out_file1" file="emboss_msbar_out.fasta"/>
</test>
</tests>
<code file="emboss_format_corrector.py" />
<help>
.. class:: warningmark
The input dataset needs to be sequences.
-----
You can view the original documentation here_.
.. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/msbar.html
</help>
</tool>
+125
View File
@@ -0,0 +1,125 @@
<tool id="EMBOSS_needle56" name="needle">
<description>Needleman-Wunsch global alignment</description>
<command>needle -asequence $input1 -bsequence $input2 -outfile $out_file1 -gapopen $gapopen -gapextend $gapextend -brief $brief -aformat3 $out_format1 -auto</command>
<inputs>
<param format="fasta" name="input1" type="data">
<label>Sequence 1</label>
</param>
<param format="fasta" name="input2" type="data">
<label>Sequence 2</label>
</param>
<param name="gapopen" size="4" type="text" value="10.0">
<label>Gap open penalty</label>
</param>
<param name="gapextend" size="4" type="text" value="0.5">
<label>Gap extension penalty</label>
</param>
<param name="brief" type="select">
<label>Brief identity and similarity</label>
<option value="yes">Yes</option>
<option value="no">No</option>
</param>
<param name="out_format1" type="select">
<label>Output Alignment File Format</label>
<option value="srspair">SRS pair (p)</option>
<option value="simple">Simple (m)</option>
<option value="fasta">FASTA (m)</option>
<option value="msf">MSF (m)</option>
<option value="srs">SRS (m)</option>
<option value="pair">Pair (p)</option>
<option value="markx0">Markx0 (p)</option>
<option value="markx1">Markx1 (p)</option>
<option value="markx2">Markx2 (p)</option>
<option value="markx3">Markx3 (p)</option>
<option value="markx10">Markx10 (p)</option>
<option value="score">Score (p)</option>
</param>
</inputs>
<outputs>
<data format="needle" name="out_file1" />
</outputs>
<tests>
<test>
<param name="input1" value="2.fasta"/>
<param name="input2" value="1.fasta"/>
<param name="gapopen" value="10"/>
<param name="gapextend" value="0.5"/>
<param name="brief" value="yes"/>
<param name="out_format1" value="score"/>
<output name="out_file1" file="emboss_needle_out.score"/>
</test>
</tests>
<code file="emboss_format_corrector.py" />
<help>
.. class:: warningmark
needle reads any two sequences of the same type (DNA or protein).
-----
**Syntax**
This tool uses the Needleman-Wunsch global alignment algorithm to find the optimum alignment (including gaps) of two sequences when considering their entire length.
- **Optimal alignment:** Dynamic programming methods ensure the optimal global alignment by exploring all possible alignments and choosing the best.
- **The Needleman-Wunsch algorithm** is a member of the class of algorithms that can calculate the best score and alignment in the order of mn steps, (where 'n' and 'm' are the lengths of the two sequences).
- **Gap open penalty:** [10.0 for any sequence] The gap open penalty is the score taken away when a gap is created. The best value depends on the choice of comparison matrix. The default value assumes you are using the EBLOSUM62 matrix for protein sequences, and the EDNAFULL matrix for nucleotide sequences. (Floating point number from 1.0 to 100.0)
- **Gap extension penalty:** [0.5 for any sequence] The gap extension, penalty is added to the standard gap penalty for each base or residue in the gap. This is how long gaps are penalized. Usually you will expect a few long gaps rather than many short gaps, so the gap extension penalty should be lower than the gap penalty. An exception is where one or both sequences are single reads with possible sequencing errors in which case you would expect many single base gaps. You can get this result by setting the gap open penalty to zero (or very low) and using the gap extension penalty to control gap scoring. (Floating point number from 0.0 to 10.0)
You can view the original documentation here_.
.. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/needle.html
-----
**Example**
- Input File::
>hg18_dna range=chrX:151073054-151073136 5'pad=0 3'pad=0 revComp=FALSE strand=? repeatMasking=none
TTTATGTCTATAATCCTTACCAAAAGTTACCTTGGAATAAGAAGAAGTCA
GTAAAAAGAAGGCTGTTGTTCCGTGAAATACTG
- If both Sequence1 and Sequence2 take the above file as input, Gap open penalty equals 10.0, Gap extension penalty equals 0.5, Brief identity and similarity is set to Yes, Output Alignment File Format is set to SRS pairs, the output file is::
########################################
# Program: needle
# Rundate: Mon Apr 02 2007 14:23:16
# Align_format: srspair
# Report_file: ./database/files/dataset_7.dat
########################################
#=======================================
#
# Aligned_sequences: 2
# 1: hg18_dna
# 2: hg18_dna
# Matrix: EDNAFULL
# Gap_penalty: 10.0
# Extend_penalty: 0.5
#
# Length: 83
# Identity: 83/83 (100.0%)
# Similarity: 83/83 (100.0%)
# Gaps: 0/83 ( 0.0%)
# Score: 415.0
#
#=======================================
hg18_dna 1 TTTATGTCTATAATCCTTACCAAAAGTTACCTTGGAATAAGAAGAAGTCA 50
||||||||||||||||||||||||||||||||||||||||||||||||||
hg18_dna 1 TTTATGTCTATAATCCTTACCAAAAGTTACCTTGGAATAAGAAGAAGTCA 50
hg18_dna 51 GTAAAAAGAAGGCTGTTGTTCCGTGAAATACTG 83
|||||||||||||||||||||||||||||||||
hg18_dna 51 GTAAAAAGAAGGCTGTTGTTCCGTGAAATACTG 83
#---------------------------------------
#---------------------------------------
</help>
</tool>
+34
View File
@@ -0,0 +1,34 @@
<tool id="EMBOSS_newcpgseek58" name="newcpgseek">
<description>Reports CpG rich region</description>
<command>newcpgseek -sequence $input1 -outfile $out_file1 -score $score -auto</command>
<inputs>
<param format="fasta" name="input1" type="data">
<label>Sequence</label>
</param>
<param name="score" size="4" type="text" value="17">
<label>CpG score</label>
</param>
</inputs>
<outputs>
<data format="newcpgseek" name="out_file1" />
</outputs>
<tests>
<test>
<param name="input1" value="2.fasta"/>
<param name="score" value="17"/>
<output name="out_file1" file="emboss_newcpgseek_out.newcpgseek"/>
</test>
</tests>
<help>
.. class:: warningmark
The input dataset needs to be sequences.
-----
You can view the original documentation here_.
.. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/newcpgseek.html
</help>
</tool>