diff --git a/tools/emboss_5/emboss_msbar.xml b/tools/emboss_5/emboss_msbar.xml
new file mode 100644
index 00000000000..2d82a5b77f4
--- /dev/null
+++ b/tools/emboss_5/emboss_msbar.xml
@@ -0,0 +1,116 @@
+
+ Mutate sequence beyond all recognition
+ msbar -sequence $input1 -outseq $out_file1 -count $count -point $point -block $block -codon $codon -inframe $inframe -minimum $minimum -maximum $maximum -osformat2 $out_format1
+ -auto
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+.. class:: warningmark
+
+The input dataset needs to be sequences.
+
+-----
+
+ You can view the original documentation here_.
+
+ .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/msbar.html
+
+
diff --git a/tools/emboss_5/emboss_needle.xml b/tools/emboss_5/emboss_needle.xml
new file mode 100644
index 00000000000..c57b1a0ca41
--- /dev/null
+++ b/tools/emboss_5/emboss_needle.xml
@@ -0,0 +1,125 @@
+
+ Needleman-Wunsch global alignment
+ needle -asequence $input1 -bsequence $input2 -outfile $out_file1 -gapopen $gapopen -gapextend $gapextend -brief $brief -aformat3 $out_format1 -auto
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+.. class:: warningmark
+
+needle reads any two sequences of the same type (DNA or protein).
+
+-----
+
+**Syntax**
+
+This tool uses the Needleman-Wunsch global alignment algorithm to find the optimum alignment (including gaps) of two sequences when considering their entire length.
+
+- **Optimal alignment:** Dynamic programming methods ensure the optimal global alignment by exploring all possible alignments and choosing the best.
+
+- **The Needleman-Wunsch algorithm** is a member of the class of algorithms that can calculate the best score and alignment in the order of mn steps, (where 'n' and 'm' are the lengths of the two sequences).
+
+- **Gap open penalty:** [10.0 for any sequence] The gap open penalty is the score taken away when a gap is created. The best value depends on the choice of comparison matrix. The default value assumes you are using the EBLOSUM62 matrix for protein sequences, and the EDNAFULL matrix for nucleotide sequences. (Floating point number from 1.0 to 100.0)
+
+- **Gap extension penalty:** [0.5 for any sequence] The gap extension, penalty is added to the standard gap penalty for each base or residue in the gap. This is how long gaps are penalized. Usually you will expect a few long gaps rather than many short gaps, so the gap extension penalty should be lower than the gap penalty. An exception is where one or both sequences are single reads with possible sequencing errors in which case you would expect many single base gaps. You can get this result by setting the gap open penalty to zero (or very low) and using the gap extension penalty to control gap scoring. (Floating point number from 0.0 to 10.0)
+
+You can view the original documentation here_.
+
+ .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/needle.html
+
+-----
+
+**Example**
+
+- Input File::
+
+ >hg18_dna range=chrX:151073054-151073136 5'pad=0 3'pad=0 revComp=FALSE strand=? repeatMasking=none
+ TTTATGTCTATAATCCTTACCAAAAGTTACCTTGGAATAAGAAGAAGTCA
+ GTAAAAAGAAGGCTGTTGTTCCGTGAAATACTG
+
+- If both Sequence1 and Sequence2 take the above file as input, Gap open penalty equals 10.0, Gap extension penalty equals 0.5, Brief identity and similarity is set to Yes, Output Alignment File Format is set to SRS pairs, the output file is::
+
+ ########################################
+ # Program: needle
+ # Rundate: Mon Apr 02 2007 14:23:16
+ # Align_format: srspair
+ # Report_file: ./database/files/dataset_7.dat
+ ########################################
+
+ #=======================================
+ #
+ # Aligned_sequences: 2
+ # 1: hg18_dna
+ # 2: hg18_dna
+ # Matrix: EDNAFULL
+ # Gap_penalty: 10.0
+ # Extend_penalty: 0.5
+ #
+ # Length: 83
+ # Identity: 83/83 (100.0%)
+ # Similarity: 83/83 (100.0%)
+ # Gaps: 0/83 ( 0.0%)
+ # Score: 415.0
+ #
+ #=======================================
+
+ hg18_dna 1 TTTATGTCTATAATCCTTACCAAAAGTTACCTTGGAATAAGAAGAAGTCA 50
+ ||||||||||||||||||||||||||||||||||||||||||||||||||
+ hg18_dna 1 TTTATGTCTATAATCCTTACCAAAAGTTACCTTGGAATAAGAAGAAGTCA 50
+
+ hg18_dna 51 GTAAAAAGAAGGCTGTTGTTCCGTGAAATACTG 83
+ |||||||||||||||||||||||||||||||||
+ hg18_dna 51 GTAAAAAGAAGGCTGTTGTTCCGTGAAATACTG 83
+
+ #---------------------------------------
+ #---------------------------------------
+
+
+
diff --git a/tools/emboss_5/emboss_newcpgseek.xml b/tools/emboss_5/emboss_newcpgseek.xml
new file mode 100644
index 00000000000..bff9d36b3bb
--- /dev/null
+++ b/tools/emboss_5/emboss_newcpgseek.xml
@@ -0,0 +1,34 @@
+
+ Reports CpG rich region
+ newcpgseek -sequence $input1 -outfile $out_file1 -score $score -auto
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+.. class:: warningmark
+
+The input dataset needs to be sequences.
+
+-----
+
+ You can view the original documentation here_.
+
+ .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/newcpgseek.html
+
+