opensource/galaxy
3
0
Fork 0
mirror of https://github.com/galaxyproject/galaxy.git synced 2026-09-24 16:30:27 +08:00
Code Issues Packages Projects Releases Wiki Activity

Add annotated citations for MAF tools.

Browse Source 
Add macro file to centralize this and in help citation description as well.
This commit is contained in:
John Chilton
2014-08-06 09:41:38 -04:00
parent 51306cc343
commit 4ddab82e9e
17 changed files with 108 additions and 122 deletions
Download Patch File Download Diff File Expand all files Collapse all files
tools/maf/genebed_maf_to_fasta.xml
+6 -8
View File
@@ -1,5 +1,8 @@
<tool id="GeneBed_Maf_Fasta2" name="Stitch Gene blocks" version="1.0.1">
<description>given a set of coding exon intervals</description>
<macros>
<import>macros.xml</import>
</macros>
<command interpreter="python">
#if $maf_source_type.maf_source == "user" #interval_maf_to_merged_fasta.py --dbkey=$dbkey --species=$maf_source_type.species --mafSource=$maf_source_type.maf_file --mafIndex=$maf_source_type.maf_file.metadata.maf_index --interval_file=$input1 --output_file=$out_file1 --mafSourceType=$maf_source_type.maf_source --geneBED --mafIndexFileDir=${GALAXY_DATA_INDEX_DIR}
#else #interval_maf_to_merged_fasta.py --dbkey=$dbkey --species=$maf_source_type.species --mafSource=$maf_source_type.maf_identifier --interval_file=$input1 --output_file=$out_file1 --mafSourceType=$maf_source_type.maf_source --geneBED --mafIndexFileDir=${GALAXY_DATA_INDEX_DIR}
@@ -87,12 +90,7 @@ The coding sequence of genes are usually composed of several coding exons. Each
* stitches blocks together and resolves overlaps based on alignment score;
* outputs alignments in FASTA format.
------
**Citation**
If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. &lt;http://www.ncbi.nlm.nih.gov/pubmed/21775304&gt;`_
</help>
@HELP_CITATIONS@
</help>
<expand macro="citations" />
</tool>
tools/maf/interval2maf.xml
+6 -8
View File
@@ -1,5 +1,8 @@
<tool id="Interval2Maf1" name="Extract MAF blocks" version="1.0.1">
<description>given a set of genomic intervals</description>
<macros>
<import>macros.xml</import>
</macros>
<command interpreter="python">
#if $maf_source_type.maf_source == "user" #interval2maf.py --dbkey=${input1.dbkey} --chromCol=${input1.metadata.chromCol} --startCol=${input1.metadata.startCol} --endCol=${input1.metadata.endCol} --strandCol=${input1.metadata.strandCol} --mafFile=$maf_source_type.mafFile --mafIndex=$maf_source_type.mafFile.metadata.maf_index --interval_file=$input1 --output_file=$out_file1 --mafIndexFile=${GALAXY_DATA_INDEX_DIR}/maf_index.loc --species=$maf_source_type.species
#else #interval2maf.py --dbkey=${input1.dbkey} --chromCol=${input1.metadata.chromCol} --startCol=${input1.metadata.startCol} --endCol=${input1.metadata.endCol} --strandCol=${input1.metadata.strandCol} --mafType=$maf_source_type.mafType --interval_file=$input1 --output_file=$out_file1 --mafIndexFile=${GALAXY_DATA_INDEX_DIR}/maf_index.loc --species=$maf_source_type.species
@@ -283,12 +286,7 @@ the tool will create **a single** history item containing 12 alignment blocks (n
s species2.chr1 129723925 79 + 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTC------AG
s species3.chr3 68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG
------
**Citation**
If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. &lt;http://www.ncbi.nlm.nih.gov/pubmed/21775304&gt;`_
</help>
@HELP_CITATIONS@
</help>
<expand macro="citations" />
</tool>
tools/maf/interval2maf_pairwise.xml
+6 -8
View File
@@ -1,5 +1,8 @@
<tool id="Interval2Maf_pairwise1" name="Extract Pairwise MAF blocks" version="1.0.1">
<description>given a set of genomic intervals</description>
<macros>
<import>macros.xml</import>
</macros>
<command interpreter="python">interval2maf.py --dbkey=${input1.dbkey} --chromCol=${input1.metadata.chromCol} --startCol=${input1.metadata.startCol} --endCol=${input1.metadata.endCol} --strandCol=${input1.metadata.strandCol} --mafType=$mafType --interval_file=$input1 --output_file=$out_file1 --indexLocation=${GALAXY_DATA_INDEX_DIR}/maf_pairwise.loc</command>
<inputs>
<param name="input1" type="data" format="interval" label="Interval File">
@@ -39,12 +42,7 @@ Here a single interval is superimposed on three MAF blocks. Blocks 1 and 3 are t
.. image:: ${static_path}/images/maf_icons/interval2maf.png
------
**Citation**
If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. &lt;http://www.ncbi.nlm.nih.gov/pubmed/21775304&gt;`_
</help>
@HELP_CITATIONS@
</help>
<expand macro="citations" />
</tool>
tools/maf/interval_maf_to_merged_fasta.xml
+6 -8
View File
@@ -1,5 +1,8 @@
<tool id="Interval_Maf_Merged_Fasta2" name="Stitch MAF blocks" version="1.0.1">
<description>given a set of genomic intervals</description>
<macros>
<import>macros.xml</import>
</macros>
<command interpreter="python">
#if $maf_source_type.maf_source == "user" #interval_maf_to_merged_fasta.py --dbkey=$dbkey --species=$maf_source_type.species --mafSource=$maf_source_type.maf_file --mafIndex=$maf_source_type.maf_file.metadata.maf_index --interval_file=$input1 --output_file=$out_file1 --chromCol=${input1.metadata.chromCol} --startCol=${input1.metadata.startCol} --endCol=${input1.metadata.endCol} --strandCol=${input1.metadata.strandCol} --mafSourceType=$maf_source_type.maf_source --mafIndexFileDir=${GALAXY_DATA_INDEX_DIR}
#else #interval_maf_to_merged_fasta.py --dbkey=$dbkey --species=$maf_source_type.species --mafSource=$maf_source_type.maf_identifier --interval_file=$input1 --output_file=$out_file1 --chromCol=${input1.metadata.chromCol} --startCol=${input1.metadata.startCol} --endCol=${input1.metadata.endCol} --strandCol=${input1.metadata.strandCol} --mafSourceType=$maf_source_type.maf_source --mafIndexFileDir=${GALAXY_DATA_INDEX_DIR}
@@ -103,12 +106,7 @@ Here three MAF blocks overlapping a single interval are stitched together. Space
.. image:: ${static_path}/images/maf_icons/stitchMaf.png
------
**Citation**
If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. &lt;http://www.ncbi.nlm.nih.gov/pubmed/21775304&gt;`_
</help>
@HELP_CITATIONS@
</help>
<expand macro="citations" />
</tool>
tools/maf/macros.xml
+16
View File
@@ -0,0 +1,16 @@
<macros>
<token name="@HELP_CITATIONS@">
------
**Citation**
If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. &lt;http://www.ncbi.nlm.nih.gov/pubmed/21775304&gt;`_
</token>
<xml name="citations">
<citations>
<citation type="doi">10.1093/bioinformatics/btr398</citation>
</citations>
</xml>
</macros>
tools/maf/maf_by_block_number.xml
+6 -8
View File
@@ -1,5 +1,8 @@
<tool id="maf_by_block_number1" name="Extract MAF by block number" version="1.0.1">
<description>given a set of block numbers and a MAF file</description>
<macros>
<import>macros.xml</import>
</macros>
<command interpreter="python">maf_by_block_number.py $input1 $input2 $out_file1 $block_col $species</command>
<inputs>
<param format="txt" name="input1" type="data" label="Block Numbers"/>
@@ -29,12 +32,7 @@
This tool takes a list of block numbers, one per line, and extracts the corresponding MAF blocks from the provided file. Block numbers start at 0.
------
**Citation**
If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. &lt;http://www.ncbi.nlm.nih.gov/pubmed/21775304&gt;`_
</help>
@HELP_CITATIONS@
</help>
<expand macro="citations" />
</tool>
tools/maf/maf_filter.xml
+6 -8
View File
@@ -1,5 +1,8 @@
<tool id="MAF_filter" name="Filter MAF" version="1.0.1">
<description>by specified attributes</description>
<macros>
<import>macros.xml</import>
</macros>
<command interpreter="python">maf_filter.py $maf_filter_file $input1 $out_file1 $out_file1.files_path $species $min_size $max_size $min_species_per_block $exclude_incomplete_blocks ${input1.metadata.species}</command>
<inputs>
<page>
@@ -191,12 +194,7 @@ This tool allows the user to remove any undesired species from a MAF file. If no
You can also provide a size range and limit your output to the MAF blocks which fall within the specified range.
------
**Citation**
If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. &lt;http://www.ncbi.nlm.nih.gov/pubmed/21775304&gt;`_
</help>
@HELP_CITATIONS@
</help>
<expand macro="citations" />
</tool>
tools/maf/maf_limit_size.xml
+6 -8
View File
@@ -1,5 +1,8 @@
<tool id="maf_limit_size1" name="Filter MAF blocks" version="1.0.1">
<description>by Size</description>
<macros>
<import>macros.xml</import>
</macros>
<command interpreter="python">maf_limit_size.py $input1 $out_file1 $min_size $max_size</command>
<inputs>
<page>
@@ -25,12 +28,7 @@
This tool takes a MAF file and a size range and extracts the MAF blocks which fall within the specified range.
------
**Citation**
If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. &lt;http://www.ncbi.nlm.nih.gov/pubmed/21775304&gt;`_
</help>
@HELP_CITATIONS@
</help>
<expand macro="citations" />
</tool>
tools/maf/maf_limit_to_species.xml
+6 -8
View File
@@ -1,5 +1,8 @@
<tool id="MAF_Limit_To_Species1" name="Filter MAF blocks">
<description>by Species</description>
<macros>
<import>macros.xml</import>
</macros>
<command interpreter="python">maf_limit_to_species.py $species $input1 $out_file1 $allow_partial $min_species</command>
<inputs>
<param name="input1" type="data" format="maf" label="MAF file"/>
@@ -39,13 +42,8 @@ This tool allows the user to remove any undesired species from a MAF file. Colum
* **Exclude blocks with have only one species** - if this option is set to **YES** all single sequence alignment blocks WILL NOT be returned.
------
**Citation**
If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. &lt;http://www.ncbi.nlm.nih.gov/pubmed/21775304&gt;`_
</help>
@HELP_CITATIONS@
</help>
<expand macro="citations" />
</tool>
tools/maf/maf_reverse_complement.xml
+6 -8
View File
@@ -1,5 +1,8 @@
<tool id="MAF_Reverse_Complement_1" name="Reverse Complement" version="1.0.1">
<description>a MAF file</description>
<macros>
<import>macros.xml</import>
</macros>
<command interpreter="python">maf_reverse_complement.py $input1 $out_file1 $species</command>
<inputs>
<page>
@@ -42,12 +45,7 @@ becomes::
s panTro1.chr6 31691510 58 - 161576975 CCTCTTCCACTATAGACCTCCTTAAACAAAATAATGAAAAACGAATAAACCACAAATT
s mm5.chr6 120816549 54 - 149721531 CCTCTTCCACTGAGGAATTTCTTTTTTTAAATGATGAGCAATCAATGAAACG----TT
------
**Citation**
If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. &lt;http://www.ncbi.nlm.nih.gov/pubmed/21775304&gt;`_
</help>
@HELP_CITATIONS@
</help>
<expand macro="citations" />
</tool>
tools/maf/maf_split_by_species.xml
+5 -7
View File
@@ -1,5 +1,8 @@
<tool id="MAF_split_blocks_by_species1" name="Split MAF blocks" version="1.0.0">
<description>by Species</description>
<macros>
<import>macros.xml</import>
</macros>
<command interpreter="python">maf_split_by_species.py $input1 $out_file1 $collapse_columns</command>
<inputs>
<param format="maf" name="input1" type="data" label="MAF file to split"/>
@@ -211,13 +214,8 @@ the tool will create **a single** history item containing 12 alignment blocks (n
- An "i" line containing information about what is in the aligned species DNA before and after the immediately preceding "s" line;
- An "e" line containing information about the size of the gap between the alignments that span the current block.
------
**Citation**
If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. &lt;http://www.ncbi.nlm.nih.gov/pubmed/21775304&gt;`_
@HELP_CITATIONS@
</help>
<expand macro="citations" />
</tool>
tools/maf/maf_stats.xml
+6 -8
View File
@@ -1,5 +1,8 @@
<tool id="maf_stats1" name="MAF Coverage Stats" version="1.0.1">
<description>Alignment coverage information</description>
<macros>
<import>macros.xml</import>
</macros>
<command interpreter="python">
maf_stats.py
#if $maf_source_type.maf_source == "user":
@@ -109,12 +112,7 @@ Alternatively, you can request only summary information for a set of intervals:
where **coverage** is the number of nucleotides divided by the total length of the provided intervals.
------
**Citation**
If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. &lt;http://www.ncbi.nlm.nih.gov/pubmed/21775304&gt;`_
</help>
@HELP_CITATIONS@
</help>
<expand macro="citations" />
</tool>
tools/maf/maf_thread_for_species.xml
+6 -7
View File
@@ -1,5 +1,8 @@
<tool id="MAF_Thread_For_Species1" name="Join MAF blocks">
<description>by Species</description>
<macros>
<import>macros.xml</import>
</macros>
<command interpreter="python">maf_thread_for_species.py $input1 $out_file1 $species</command>
<inputs>
<param format="maf" name="input1" type="data" label="MAF file"/>
@@ -48,13 +51,9 @@ results in::
s hg17.chr7 127471195 389 + 158628139 gtttgccatcttttgctgctctagggaatccagcagctgtcaccatgtaaacaagcccaggctagaccaGTTACCCTCATCATCTTAGCTGATAGCCAGCCAGCCACCACAGGCAtgagtcaggccatattgctggacccacagaattatgagctaaataaatagtcttgggttaagccactaagttttaggcatagtgtgttatgtaTCTCACAAACATATAAGACTGTGTGTTTGTTGACTGGAGGAAGAGATGCTATAAAGACCACCTTTTAAAACTTCCCAAATACTGCCACTGATGTCCTGATGGAGGTATGAAAACATCCACTAAAATTTGTGGTTTATTCATTTTTCATTATTTTGTTTAAGGAGGTCTATAGTGGAAGAGG
s panTro1.chr6 129885076 389 + 161576975 gtttgccatcttttgctgctcttgggaatccagcagctgtcaccatgtaaacaagcccaggctagaccaGTTACCCTCATCATCTTAGCTGATAGCCAGCCAGCCACCACAGGCAtgagtcaggccatattgctggacccacagaattatgagctaaataaatagtcttgggttaagccactaagttttaggcatagtgtgttatgtaTCTCACAAACATATAAGACTGTGTGTTTGTTGACTGGAGGAAGAGATGCTATAAAGACCACCTTTTGAAACTTCCCAAATACTGCCACTGATGTCCTGATGGAGGTATGAAAACATCCACTAAAATTTGTGGTTTATTCGTTTTTCATTATTTTGTTTAAGGAGGTCTATAGTGGAAGAGG
------
@HELP_CITATIONS@
</help>
<expand macro="citations" />
**Citation**
If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. &lt;http://www.ncbi.nlm.nih.gov/pubmed/21775304&gt;`_
</help>
</tool>
tools/maf/maf_to_bed.xml
+5 -7
View File
@@ -1,5 +1,8 @@
<tool id="MAF_To_BED1" name="MAF to BED" force_history_refresh="True">
<description>Converts a MAF formatted file to the BED format</description>
<macros>
<import>macros.xml</import>
</macros>
<command interpreter="python">maf_to_bed.py "${ input1 }" "${ out_file1 }" "${ species }" "${ complete_blocks }" "." "${ out_file1.id }"</command>
<inputs>
<param format="maf" name="input1" type="data" label="MAF file to convert"/>
@@ -123,14 +126,9 @@ Additional (optional) fields are::
5. score - A score between 0 and 1000.
6. strand - Defines the strand - either '+' or '-'.
------
**Citation**
If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. &lt;http://www.ncbi.nlm.nih.gov/pubmed/21775304&gt;`_
@HELP_CITATIONS@
</help>
<expand macro="citations" />
<code file="maf_to_bed_code.py"/>
</tool>
tools/maf/maf_to_fasta.xml
+6 -8
View File
@@ -1,5 +1,8 @@
<tool id="MAF_To_Fasta1" name="MAF to FASTA" version="1.0.1">
<description>Converts a MAF formatted file to FASTA format</description>
<macros>
<import>macros.xml</import>
</macros>
<command interpreter="python">
#if $fasta_target_type.fasta_type == "multiple" #maf_to_fasta_multiple_sets.py $input1 $out_file1 $fasta_target_type.species $fasta_target_type.complete_blocks
#else #maf_to_fasta_concat.py $fasta_target_type.species $input1 $out_file1
@@ -188,12 +191,7 @@ will be converted to (**note** that the second MAF block, which does not have mm
- An "i" line containing information about what is in the aligned species DNA before and after the immediately preceding "s" line;
- An "e" line containing information about the size of the gap between the alignments that span the current block.
------
**Citation**
If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. &lt;http://www.ncbi.nlm.nih.gov/pubmed/21775304&gt;`_
</help>
@HELP_CITATIONS@
</help>
<expand macro="citations" />
</tool>
tools/maf/maf_to_interval.xml
+5 -7
View File
@@ -1,5 +1,8 @@
<tool id="MAF_To_Interval1" name="MAF to Interval" force_history_refresh="True">
<description>Converts a MAF formatted file to the Interval format</description>
<macros>
<import>macros.xml</import>
</macros>
<command interpreter="python">maf_to_interval.py "${ input1 }" "${ out_file1 }" "${ out_file1.id }" "." "${ input1.dbkey }" "${ species }" "${ input1.metadata.species }" "${ complete_blocks }" "${ remove_gaps }"</command>
<inputs>
<param format="maf" name="input1" type="data" label="MAF file to convert"/>
@@ -121,13 +124,8 @@ History item **2** (for mm8)::
- An "i" line containing information about what is in the aligned species DNA before and after the immediately preceding "s" line;
- An "e" line containing information about the size of the gap between the alignments that span the current block.
------
**Citation**
If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. &lt;http://www.ncbi.nlm.nih.gov/pubmed/21775304&gt;`_
@HELP_CITATIONS@
</help>
<expand macro="citations" />
</tool>
tools/maf/vcf_to_maf_customtrack.xml
+5 -6
View File
@@ -1,5 +1,8 @@
<tool id="vcf_to_maf_customtrack1" name="VCF to MAF Custom Track">
<description>for display at UCSC</description>
<macros>
<import>macros.xml</import>
</macros>
<command interpreter="python">vcf_to_maf_customtrack.py '$out_file1'
#if $vcf_source_type.vcf_file
'${vcf_source_type.vcf_file[0].vcf_input.dbkey}'
@@ -121,12 +124,8 @@ Results in the following MAF custom track::
s CHB+JPT_1.5 0 1 + 1 *------
s CHB+JPT_2.5 0 7 + 7 *GGA***
------
**Citation**
If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. &lt;http://www.ncbi.nlm.nih.gov/pubmed/21775304&gt;`_
@HELP_CITATIONS@
</help>
<expand macro="citations" />
</tool>