diff --git a/tools/maf/genebed_maf_to_fasta.xml b/tools/maf/genebed_maf_to_fasta.xml index 3a52c983ead..44673e63986 100644 --- a/tools/maf/genebed_maf_to_fasta.xml +++ b/tools/maf/genebed_maf_to_fasta.xml @@ -1,5 +1,8 @@ given a set of coding exon intervals + + macros.xml + #if $maf_source_type.maf_source == "user" #interval_maf_to_merged_fasta.py --dbkey=$dbkey --species=$maf_source_type.species --mafSource=$maf_source_type.maf_file --mafIndex=$maf_source_type.maf_file.metadata.maf_index --interval_file=$input1 --output_file=$out_file1 --mafSourceType=$maf_source_type.maf_source --geneBED --mafIndexFileDir=${GALAXY_DATA_INDEX_DIR} #else #interval_maf_to_merged_fasta.py --dbkey=$dbkey --species=$maf_source_type.species --mafSource=$maf_source_type.maf_identifier --interval_file=$input1 --output_file=$out_file1 --mafSourceType=$maf_source_type.maf_source --geneBED --mafIndexFileDir=${GALAXY_DATA_INDEX_DIR} @@ -87,12 +90,7 @@ The coding sequence of genes are usually composed of several coding exons. Each * stitches blocks together and resolves overlaps based on alignment score; * outputs alignments in FASTA format. ------- - -**Citation** - -If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. <http://www.ncbi.nlm.nih.gov/pubmed/21775304>`_ - - - +@HELP_CITATIONS@ + + diff --git a/tools/maf/interval2maf.xml b/tools/maf/interval2maf.xml index 76783e92238..13b8f809e2a 100644 --- a/tools/maf/interval2maf.xml +++ b/tools/maf/interval2maf.xml @@ -1,5 +1,8 @@ given a set of genomic intervals + + macros.xml + #if $maf_source_type.maf_source == "user" #interval2maf.py --dbkey=${input1.dbkey} --chromCol=${input1.metadata.chromCol} --startCol=${input1.metadata.startCol} --endCol=${input1.metadata.endCol} --strandCol=${input1.metadata.strandCol} --mafFile=$maf_source_type.mafFile --mafIndex=$maf_source_type.mafFile.metadata.maf_index --interval_file=$input1 --output_file=$out_file1 --mafIndexFile=${GALAXY_DATA_INDEX_DIR}/maf_index.loc --species=$maf_source_type.species #else #interval2maf.py --dbkey=${input1.dbkey} --chromCol=${input1.metadata.chromCol} --startCol=${input1.metadata.startCol} --endCol=${input1.metadata.endCol} --strandCol=${input1.metadata.strandCol} --mafType=$maf_source_type.mafType --interval_file=$input1 --output_file=$out_file1 --mafIndexFile=${GALAXY_DATA_INDEX_DIR}/maf_index.loc --species=$maf_source_type.species @@ -283,12 +286,7 @@ the tool will create **a single** history item containing 12 alignment blocks (n s species2.chr1 129723925 79 + 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTC------AG s species3.chr3 68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG ------- - -**Citation** - -If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. <http://www.ncbi.nlm.nih.gov/pubmed/21775304>`_ - - - +@HELP_CITATIONS@ + + diff --git a/tools/maf/interval2maf_pairwise.xml b/tools/maf/interval2maf_pairwise.xml index 83762e94d8f..786fa2ac29e 100644 --- a/tools/maf/interval2maf_pairwise.xml +++ b/tools/maf/interval2maf_pairwise.xml @@ -1,5 +1,8 @@ given a set of genomic intervals + + macros.xml + interval2maf.py --dbkey=${input1.dbkey} --chromCol=${input1.metadata.chromCol} --startCol=${input1.metadata.startCol} --endCol=${input1.metadata.endCol} --strandCol=${input1.metadata.strandCol} --mafType=$mafType --interval_file=$input1 --output_file=$out_file1 --indexLocation=${GALAXY_DATA_INDEX_DIR}/maf_pairwise.loc @@ -39,12 +42,7 @@ Here a single interval is superimposed on three MAF blocks. Blocks 1 and 3 are t .. image:: ${static_path}/images/maf_icons/interval2maf.png ------- - -**Citation** - -If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. <http://www.ncbi.nlm.nih.gov/pubmed/21775304>`_ - - - +@HELP_CITATIONS@ + + diff --git a/tools/maf/interval_maf_to_merged_fasta.xml b/tools/maf/interval_maf_to_merged_fasta.xml index 4727ace907f..053b3c45d90 100644 --- a/tools/maf/interval_maf_to_merged_fasta.xml +++ b/tools/maf/interval_maf_to_merged_fasta.xml @@ -1,5 +1,8 @@ given a set of genomic intervals + + macros.xml + #if $maf_source_type.maf_source == "user" #interval_maf_to_merged_fasta.py --dbkey=$dbkey --species=$maf_source_type.species --mafSource=$maf_source_type.maf_file --mafIndex=$maf_source_type.maf_file.metadata.maf_index --interval_file=$input1 --output_file=$out_file1 --chromCol=${input1.metadata.chromCol} --startCol=${input1.metadata.startCol} --endCol=${input1.metadata.endCol} --strandCol=${input1.metadata.strandCol} --mafSourceType=$maf_source_type.maf_source --mafIndexFileDir=${GALAXY_DATA_INDEX_DIR} #else #interval_maf_to_merged_fasta.py --dbkey=$dbkey --species=$maf_source_type.species --mafSource=$maf_source_type.maf_identifier --interval_file=$input1 --output_file=$out_file1 --chromCol=${input1.metadata.chromCol} --startCol=${input1.metadata.startCol} --endCol=${input1.metadata.endCol} --strandCol=${input1.metadata.strandCol} --mafSourceType=$maf_source_type.maf_source --mafIndexFileDir=${GALAXY_DATA_INDEX_DIR} @@ -103,12 +106,7 @@ Here three MAF blocks overlapping a single interval are stitched together. Space .. image:: ${static_path}/images/maf_icons/stitchMaf.png ------- - -**Citation** - -If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. <http://www.ncbi.nlm.nih.gov/pubmed/21775304>`_ - - - +@HELP_CITATIONS@ + + diff --git a/tools/maf/macros.xml b/tools/maf/macros.xml new file mode 100644 index 00000000000..d11af1c13f8 --- /dev/null +++ b/tools/maf/macros.xml @@ -0,0 +1,16 @@ + + +------ + +**Citation** + +If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. <http://www.ncbi.nlm.nih.gov/pubmed/21775304>`_ + + + + + + 10.1093/bioinformatics/btr398 + + + diff --git a/tools/maf/maf_by_block_number.xml b/tools/maf/maf_by_block_number.xml index 4dae63522ed..3b9b578a130 100644 --- a/tools/maf/maf_by_block_number.xml +++ b/tools/maf/maf_by_block_number.xml @@ -1,5 +1,8 @@ given a set of block numbers and a MAF file + + macros.xml + maf_by_block_number.py $input1 $input2 $out_file1 $block_col $species @@ -29,12 +32,7 @@ This tool takes a list of block numbers, one per line, and extracts the corresponding MAF blocks from the provided file. Block numbers start at 0. ------- - -**Citation** - -If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. <http://www.ncbi.nlm.nih.gov/pubmed/21775304>`_ - - - +@HELP_CITATIONS@ + + diff --git a/tools/maf/maf_filter.xml b/tools/maf/maf_filter.xml index 0be3fcbf38a..a69cdc681a7 100644 --- a/tools/maf/maf_filter.xml +++ b/tools/maf/maf_filter.xml @@ -1,5 +1,8 @@ by specified attributes + + macros.xml + maf_filter.py $maf_filter_file $input1 $out_file1 $out_file1.files_path $species $min_size $max_size $min_species_per_block $exclude_incomplete_blocks ${input1.metadata.species} @@ -191,12 +194,7 @@ This tool allows the user to remove any undesired species from a MAF file. If no You can also provide a size range and limit your output to the MAF blocks which fall within the specified range. ------- - -**Citation** - -If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. <http://www.ncbi.nlm.nih.gov/pubmed/21775304>`_ - - - +@HELP_CITATIONS@ + + diff --git a/tools/maf/maf_limit_size.xml b/tools/maf/maf_limit_size.xml index 622a2c84147..51feb29d4ef 100644 --- a/tools/maf/maf_limit_size.xml +++ b/tools/maf/maf_limit_size.xml @@ -1,5 +1,8 @@ by Size + + macros.xml + maf_limit_size.py $input1 $out_file1 $min_size $max_size @@ -25,12 +28,7 @@ This tool takes a MAF file and a size range and extracts the MAF blocks which fall within the specified range. ------- - -**Citation** - -If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. <http://www.ncbi.nlm.nih.gov/pubmed/21775304>`_ - - - +@HELP_CITATIONS@ + + diff --git a/tools/maf/maf_limit_to_species.xml b/tools/maf/maf_limit_to_species.xml index b85fb325455..ba443b4f35a 100644 --- a/tools/maf/maf_limit_to_species.xml +++ b/tools/maf/maf_limit_to_species.xml @@ -1,5 +1,8 @@ by Species + + macros.xml + maf_limit_to_species.py $species $input1 $out_file1 $allow_partial $min_species @@ -39,13 +42,8 @@ This tool allows the user to remove any undesired species from a MAF file. Colum * **Exclude blocks with have only one species** - if this option is set to **YES** all single sequence alignment blocks WILL NOT be returned. ------- - -**Citation** - -If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. <http://www.ncbi.nlm.nih.gov/pubmed/21775304>`_ - - - +@HELP_CITATIONS@ + + diff --git a/tools/maf/maf_reverse_complement.xml b/tools/maf/maf_reverse_complement.xml index 22339aaf7b1..a35b72ffced 100644 --- a/tools/maf/maf_reverse_complement.xml +++ b/tools/maf/maf_reverse_complement.xml @@ -1,5 +1,8 @@ a MAF file + + macros.xml + maf_reverse_complement.py $input1 $out_file1 $species @@ -42,12 +45,7 @@ becomes:: s panTro1.chr6 31691510 58 - 161576975 CCTCTTCCACTATAGACCTCCTTAAACAAAATAATGAAAAACGAATAAACCACAAATT s mm5.chr6 120816549 54 - 149721531 CCTCTTCCACTGAGGAATTTCTTTTTTTAAATGATGAGCAATCAATGAAACG----TT ------- - -**Citation** - -If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. <http://www.ncbi.nlm.nih.gov/pubmed/21775304>`_ - - - +@HELP_CITATIONS@ + + diff --git a/tools/maf/maf_split_by_species.xml b/tools/maf/maf_split_by_species.xml index 89e1deda63d..d1efd45075c 100644 --- a/tools/maf/maf_split_by_species.xml +++ b/tools/maf/maf_split_by_species.xml @@ -1,5 +1,8 @@ by Species + + macros.xml + maf_split_by_species.py $input1 $out_file1 $collapse_columns @@ -211,13 +214,8 @@ the tool will create **a single** history item containing 12 alignment blocks (n - An "i" line containing information about what is in the aligned species DNA before and after the immediately preceding "s" line; - An "e" line containing information about the size of the gap between the alignments that span the current block. ------- - -**Citation** - -If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. <http://www.ncbi.nlm.nih.gov/pubmed/21775304>`_ - - +@HELP_CITATIONS@ + diff --git a/tools/maf/maf_stats.xml b/tools/maf/maf_stats.xml index 7e4c61a062d..4dec43968a9 100644 --- a/tools/maf/maf_stats.xml +++ b/tools/maf/maf_stats.xml @@ -1,5 +1,8 @@ Alignment coverage information + + macros.xml + maf_stats.py #if $maf_source_type.maf_source == "user": @@ -109,12 +112,7 @@ Alternatively, you can request only summary information for a set of intervals: where **coverage** is the number of nucleotides divided by the total length of the provided intervals. ------- - -**Citation** - -If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. <http://www.ncbi.nlm.nih.gov/pubmed/21775304>`_ - - - +@HELP_CITATIONS@ + + diff --git a/tools/maf/maf_thread_for_species.xml b/tools/maf/maf_thread_for_species.xml index 64f9ab18328..56647e192c9 100644 --- a/tools/maf/maf_thread_for_species.xml +++ b/tools/maf/maf_thread_for_species.xml @@ -1,5 +1,8 @@ by Species + + macros.xml + maf_thread_for_species.py $input1 $out_file1 $species @@ -48,13 +51,9 @@ results in:: s hg17.chr7 127471195 389 + 158628139 gtttgccatcttttgctgctctagggaatccagcagctgtcaccatgtaaacaagcccaggctagaccaGTTACCCTCATCATCTTAGCTGATAGCCAGCCAGCCACCACAGGCAtgagtcaggccatattgctggacccacagaattatgagctaaataaatagtcttgggttaagccactaagttttaggcatagtgtgttatgtaTCTCACAAACATATAAGACTGTGTGTTTGTTGACTGGAGGAAGAGATGCTATAAAGACCACCTTTTAAAACTTCCCAAATACTGCCACTGATGTCCTGATGGAGGTATGAAAACATCCACTAAAATTTGTGGTTTATTCATTTTTCATTATTTTGTTTAAGGAGGTCTATAGTGGAAGAGG s panTro1.chr6 129885076 389 + 161576975 gtttgccatcttttgctgctcttgggaatccagcagctgtcaccatgtaaacaagcccaggctagaccaGTTACCCTCATCATCTTAGCTGATAGCCAGCCAGCCACCACAGGCAtgagtcaggccatattgctggacccacagaattatgagctaaataaatagtcttgggttaagccactaagttttaggcatagtgtgttatgtaTCTCACAAACATATAAGACTGTGTGTTTGTTGACTGGAGGAAGAGATGCTATAAAGACCACCTTTTGAAACTTCCCAAATACTGCCACTGATGTCCTGATGGAGGTATGAAAACATCCACTAAAATTTGTGGTTTATTCGTTTTTCATTATTTTGTTTAAGGAGGTCTATAGTGGAAGAGG ------- +@HELP_CITATIONS@ + + -**Citation** - -If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. <http://www.ncbi.nlm.nih.gov/pubmed/21775304>`_ - - - diff --git a/tools/maf/maf_to_bed.xml b/tools/maf/maf_to_bed.xml index c168e81c4a2..9dcda3c6ec8 100644 --- a/tools/maf/maf_to_bed.xml +++ b/tools/maf/maf_to_bed.xml @@ -1,5 +1,8 @@ Converts a MAF formatted file to the BED format + + macros.xml + maf_to_bed.py "${ input1 }" "${ out_file1 }" "${ species }" "${ complete_blocks }" "." "${ out_file1.id }" @@ -123,14 +126,9 @@ Additional (optional) fields are:: 5. score - A score between 0 and 1000. 6. strand - Defines the strand - either '+' or '-'. ------- - -**Citation** - -If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. <http://www.ncbi.nlm.nih.gov/pubmed/21775304>`_ - - +@HELP_CITATIONS@ + diff --git a/tools/maf/maf_to_fasta.xml b/tools/maf/maf_to_fasta.xml index b4dc3944ef4..bddba3c8d9d 100644 --- a/tools/maf/maf_to_fasta.xml +++ b/tools/maf/maf_to_fasta.xml @@ -1,5 +1,8 @@ Converts a MAF formatted file to FASTA format + + macros.xml + #if $fasta_target_type.fasta_type == "multiple" #maf_to_fasta_multiple_sets.py $input1 $out_file1 $fasta_target_type.species $fasta_target_type.complete_blocks #else #maf_to_fasta_concat.py $fasta_target_type.species $input1 $out_file1 @@ -188,12 +191,7 @@ will be converted to (**note** that the second MAF block, which does not have mm - An "i" line containing information about what is in the aligned species DNA before and after the immediately preceding "s" line; - An "e" line containing information about the size of the gap between the alignments that span the current block. ------- - -**Citation** - -If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. <http://www.ncbi.nlm.nih.gov/pubmed/21775304>`_ - - - +@HELP_CITATIONS@ + + diff --git a/tools/maf/maf_to_interval.xml b/tools/maf/maf_to_interval.xml index d127a6f0813..1f30c782d59 100644 --- a/tools/maf/maf_to_interval.xml +++ b/tools/maf/maf_to_interval.xml @@ -1,5 +1,8 @@ Converts a MAF formatted file to the Interval format + + macros.xml + maf_to_interval.py "${ input1 }" "${ out_file1 }" "${ out_file1.id }" "." "${ input1.dbkey }" "${ species }" "${ input1.metadata.species }" "${ complete_blocks }" "${ remove_gaps }" @@ -121,13 +124,8 @@ History item **2** (for mm8):: - An "i" line containing information about what is in the aligned species DNA before and after the immediately preceding "s" line; - An "e" line containing information about the size of the gap between the alignments that span the current block. ------- - -**Citation** - -If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. <http://www.ncbi.nlm.nih.gov/pubmed/21775304>`_ - - +@HELP_CITATIONS@ + diff --git a/tools/maf/vcf_to_maf_customtrack.xml b/tools/maf/vcf_to_maf_customtrack.xml index 26d5a501e22..fbeddbc1f2a 100644 --- a/tools/maf/vcf_to_maf_customtrack.xml +++ b/tools/maf/vcf_to_maf_customtrack.xml @@ -1,5 +1,8 @@ for display at UCSC + + macros.xml + vcf_to_maf_customtrack.py '$out_file1' #if $vcf_source_type.vcf_file '${vcf_source_type.vcf_file[0].vcf_input.dbkey}' @@ -121,12 +124,8 @@ Results in the following MAF custom track:: s CHB+JPT_1.5 0 1 + 1 *------ s CHB+JPT_2.5 0 7 + 7 *GGA*** ------- - -**Citation** - -If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. <http://www.ncbi.nlm.nih.gov/pubmed/21775304>`_ - +@HELP_CITATIONS@ +