Minor tool help updates.

tools/fastq/fastq_combiner.xml

@@ -66,5 +66,12 @@ This tool joins a FASTA file to a Quality Score file, creating a single FASTQ bl
 Specifying a set of quality scores is optional; when not provided, the output will be fastqsanger or fastqcssanger (when a csfasta is provided) with each quality score being the maximal allowed value (93).
 
 Use this tool, for example, to convert 454-type output to FASTQ.
+
+------
+
+**Citation**
+
+If you use this tool, please cite `Blankenberg D, Gordon A, Von Kuster G, Coraor N, Taylor J, Nekrutenko A; Galaxy Team. Manipulation of FASTQ data with Galaxy. Bioinformatics. 2010 Jul 15;26(14):1783-5. <http://www.ncbi.nlm.nih.gov/pubmed/20562416>`_
+
   </help>
 </tool>

tools/fastq/fastq_filter.xml

@@ -307,5 +307,12 @@ This tool allows you to build complex filters to be applied to each read in a FA
 
 Adapter bases in color space reads are excluded from filtering.
 
+------
+
+**Citation**
+
+If you use this tool, please cite `Blankenberg D, Gordon A, Von Kuster G, Coraor N, Taylor J, Nekrutenko A; Galaxy Team. Manipulation of FASTQ data with Galaxy. Bioinformatics. 2010 Jul 15;26(14):1783-5. <http://www.ncbi.nlm.nih.gov/pubmed/20562416>`_
+
+
 </help>
 </tool>

tools/fastq/fastq_groomer.xml

@@ -358,6 +358,12 @@ When converting between color space (csSanger) and base/sequence space (Sanger,
 
 Diagram adapted from http://en.wikipedia.org/wiki/FASTQ_format
 
+------
+
+**Citation**
+
+If you use this tool, please cite `Blankenberg D, Gordon A, Von Kuster G, Coraor N, Taylor J, Nekrutenko A; Galaxy Team. Manipulation of FASTQ data with Galaxy. Bioinformatics. 2010 Jul 15;26(14):1783-5. <http://www.ncbi.nlm.nih.gov/pubmed/20562416>`_
+
 
 .. _Cock PJ, Fields CJ, Goto N, Heuer ML, Rice PM. The Sanger FASTQ file format for sequences with quality scores, and the Solexa/Illumina FASTQ variants. Nucleic Acids Res. 2009 Dec 16.: http://www.ncbi.nlm.nih.gov/pubmed/20015970
 

tools/fastq/fastq_manipulation.xml

@@ -417,5 +417,13 @@ Steps:
 2. Click **Add new Manipulate Reads**, change **Manipulate Reads on** to "Sequence Content", set **Sequence Manipulation Type** to "Change Adapter Base" and set **New Adapter** to "" (an empty text field). 
 3. Click **Add new Manipulate Reads**, change **Manipulate Reads on** to "Sequence Content", set **Sequence Manipulation Type** to "String Translate" and set **From** to "0123." and **To** to "ACGTN".
 4. Click Execute. The new history item will contained double-encoded psuedo-nucleotide space reads.
+
+------
+
+**Citation**
+
+If you use this tool, please cite `Blankenberg D, Gordon A, Von Kuster G, Coraor N, Taylor J, Nekrutenko A; Galaxy Team. Manipulation of FASTQ data with Galaxy. Bioinformatics. 2010 Jul 15;26(14):1783-5. <http://www.ncbi.nlm.nih.gov/pubmed/20562416>`_
+
+
 </help>
 </tool>

tools/fastq/fastq_masker_by_quality.xml

@@ -49,5 +49,12 @@ This tool allows masking base characters in FASTQ format files dependent upon us
 
 This tool is not available for use on color space (csSanger) formats.
 
+------
+
+**Citation**
+
+If you use this tool, please cite `Blankenberg D, Gordon A, Von Kuster G, Coraor N, Taylor J, Nekrutenko A; Galaxy Team. Manipulation of FASTQ data with Galaxy. Bioinformatics. 2010 Jul 15;26(14):1783-5. <http://www.ncbi.nlm.nih.gov/pubmed/20562416>`_
+
+
   </help>
 </tool>

tools/fastq/fastq_paired_end_joiner.xml

@@ -51,5 +51,12 @@ A multiple-fastq file, for example::
     +HWI-EAS91_1_30788AAXX:7:21:1542:1758
     hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh`hfhhVZSWehR
 
+------
+
+**Citation**
+
+If you use this tool, please cite `Blankenberg D, Gordon A, Von Kuster G, Coraor N, Taylor J, Nekrutenko A; Galaxy Team. Manipulation of FASTQ data with Galaxy. Bioinformatics. 2010 Jul 15;26(14):1783-5. <http://www.ncbi.nlm.nih.gov/pubmed/20562416>`_
+
+
   </help>
 </tool>

tools/fastq/fastq_paired_end_splitter.xml

@@ -52,5 +52,12 @@ Right-hand Read::
     +HWI-EAS91_1_30788AAXX:7:21:1542:1758/2
     hhhhhhhhhhhhhhhhhhhhhhhh`hfhhVZSWehR
 
+------
+
+**Citation**
+
+If you use this tool, please cite `Blankenberg D, Gordon A, Von Kuster G, Coraor N, Taylor J, Nekrutenko A; Galaxy Team. Manipulation of FASTQ data with Galaxy. Bioinformatics. 2010 Jul 15;26(14):1783-5. <http://www.ncbi.nlm.nih.gov/pubmed/20562416>`_
+
+
   </help>
 </tool>

tools/fastq/fastq_stats.xml

@@ -60,5 +60,12 @@ For example::
 
 Adapter bases in color space reads are excluded from statistics.
 
+------
+
+**Citation**
+
+If you use this tool, please cite `Blankenberg D, Gordon A, Von Kuster G, Coraor N, Taylor J, Nekrutenko A; Galaxy Team. Manipulation of FASTQ data with Galaxy. Bioinformatics. 2010 Jul 15;26(14):1783-5. <http://www.ncbi.nlm.nih.gov/pubmed/20562416>`_
+
+
   </help>
 </tool>

tools/fastq/fastq_to_fasta.xml

@@ -29,5 +29,12 @@
 
 This tool converts FASTQ sequencing reads to FASTA sequences.
 
+------
+
+**Citation**
+
+If you use this tool, please cite `Blankenberg D, Gordon A, Von Kuster G, Coraor N, Taylor J, Nekrutenko A; Galaxy Team. Manipulation of FASTQ data with Galaxy. Bioinformatics. 2010 Jul 15;26(14):1783-5. <http://www.ncbi.nlm.nih.gov/pubmed/20562416>`_
+
+
   </help>
 </tool>

tools/fastq/fastq_to_tabular.xml

@@ -90,5 +90,12 @@ FSRRS4401BRRTC [length=145] [gc=38.62] [flows=800] [phred_min=0] [phred_max=38]
 
 Note the sequences and quality strings have been truncated for display purposes in the above tables.
 
+------
+
+**Citation**
+
+If you use this tool, please cite `Blankenberg D, Gordon A, Von Kuster G, Coraor N, Taylor J, Nekrutenko A; Galaxy Team. Manipulation of FASTQ data with Galaxy. Bioinformatics. 2010 Jul 15;26(14):1783-5. <http://www.ncbi.nlm.nih.gov/pubmed/20562416>`_
+
+
   </help>
 </tool>

tools/fastq/fastq_trimmer.xml

@@ -109,5 +109,12 @@ Or you set percent offsets of 6% and 20% (corresponds to absolute offsets of 2,7
 
 Trimming a color space read will cause any adapter base to be lost.
 
+------
+
+**Citation**
+
+If you use this tool, please cite `Blankenberg D, Gordon A, Von Kuster G, Coraor N, Taylor J, Nekrutenko A; Galaxy Team. Manipulation of FASTQ data with Galaxy. Bioinformatics. 2010 Jul 15;26(14):1783-5. <http://www.ncbi.nlm.nih.gov/pubmed/20562416>`_
+
+
   </help>
 </tool>

tools/fastq/fastq_trimmer_by_quality.xml

@@ -134,5 +134,12 @@ The user can provide a maximum count of bases that can be excluded from the aggr
 
 Trimming a color space read will cause any adapter base to be lost.
 
+------
+
+**Citation**
+
+If you use this tool, please cite `Blankenberg D, Gordon A, Von Kuster G, Coraor N, Taylor J, Nekrutenko A; Galaxy Team. Manipulation of FASTQ data with Galaxy. Bioinformatics. 2010 Jul 15;26(14):1783-5. <http://www.ncbi.nlm.nih.gov/pubmed/20562416>`_
+
+
   </help>
 </tool>

tools/fastq/tabular_to_fastq.xml

@@ -33,5 +33,12 @@
 
 This tool attempts to convert a tabular file containing sequencing read data to a FASTQ formatted file. The FASTQ Groomer tool should always be used on the output of this tool. 
 
+------
+
+**Citation**
+
+If you use this tool, please cite `Blankenberg D, Gordon A, Von Kuster G, Coraor N, Taylor J, Nekrutenko A; Galaxy Team. Manipulation of FASTQ data with Galaxy. Bioinformatics. 2010 Jul 15;26(14):1783-5. <http://www.ncbi.nlm.nih.gov/pubmed/20562416>`_
+
+
   </help>
 </tool>

tools/maf/genebed_maf_to_fasta.xml

@@ -87,6 +87,12 @@ The coding sequence of genes are usually composed of several coding exons. Each
   * stitches blocks together and resolves overlaps based on alignment score;
   * outputs alignments in FASTA format.
 
+------
+
+**Citation**
+
+If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. <http://www.ncbi.nlm.nih.gov/pubmed/21775304>`_
+
 
   </help>
 </tool>

tools/maf/interval2maf.xml

@@ -283,5 +283,12 @@ the tool will create **a single** history item containing 12 alignment blocks (n
   s species2.chr1 129723925 79 + 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTC------AG 
   s species3.chr3  68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG 
 
+------
+
+**Citation**
+
+If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. <http://www.ncbi.nlm.nih.gov/pubmed/21775304>`_
+
+
   </help>
 </tool>

tools/maf/interval2maf_pairwise.xml

@@ -39,5 +39,12 @@ Here a single interval is superimposed on three MAF blocks. Blocks 1 and 3 are t
 
 .. image:: ./static/images/maf_icons/interval2maf.png
 
+------
+
+**Citation**
+
+If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. <http://www.ncbi.nlm.nih.gov/pubmed/21775304>`_
+
+
   </help>
 </tool>

tools/maf/interval_maf_to_merged_fasta.xml

@@ -103,5 +103,12 @@ Here three MAF blocks overlapping a single interval are stitched together. Space
 
 .. image:: ./static/images/maf_icons/stitchMaf.png
 
+------
+
+**Citation**
+
+If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. <http://www.ncbi.nlm.nih.gov/pubmed/21775304>`_
+
+
   </help>
 </tool>

tools/maf/maf_by_block_number.xml

@@ -28,5 +28,13 @@
 **What it does**
 
 This tool takes a list of block numbers, one per line, and extracts the corresponding MAF blocks from the provided file. Block numbers start at 0.
+
+------
+
+**Citation**
+
+If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. <http://www.ncbi.nlm.nih.gov/pubmed/21775304>`_
+
+
   </help>
 </tool>

tools/maf/maf_filter.xml

@@ -191,5 +191,12 @@ This tool allows the user to remove any undesired species from a MAF file. If no
 
 You can also provide a size range and limit your output to the MAF blocks which fall within the specified range.
 
+------
+
+**Citation**
+
+If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. <http://www.ncbi.nlm.nih.gov/pubmed/21775304>`_
+
+
 </help>
 </tool>

tools/maf/maf_limit_size.xml

@@ -24,5 +24,13 @@
 **What it does**
 
 This tool takes a MAF file and a size range and extracts the MAF blocks which fall within the specified range.
+
+------
+
+**Citation**
+
+If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. <http://www.ncbi.nlm.nih.gov/pubmed/21775304>`_
+
+
   </help>
 </tool>

tools/maf/maf_limit_to_species.xml

@@ -39,6 +39,13 @@ This tool allows the user to remove any undesired species from a MAF file. Colum
 
  * **Exclude blocks with have only one species** - if this option is set to **YES** all single sequence alignment blocks WILL NOT be returned.
 
+------
+
+**Citation**
+
+If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. <http://www.ncbi.nlm.nih.gov/pubmed/21775304>`_
+
+
   </help>
 </tool>
 

tools/maf/maf_reverse_complement.xml

@@ -41,5 +41,13 @@ becomes::
   s hg17.chr7     31156555 58 - 158628139 CCTCTTCCACTATAGACCTCCTTAAACAAAATAATGAAAAATGAATAAACCACAAATT
   s panTro1.chr6  31691510 58 - 161576975 CCTCTTCCACTATAGACCTCCTTAAACAAAATAATGAAAAACGAATAAACCACAAATT
   s mm5.chr6     120816549 54 - 149721531 CCTCTTCCACTGAGGAATTTCTTTTTTTAAATGATGAGCAATCAATGAAACG----TT
+
+------
+
+**Citation**
+
+If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. <http://www.ncbi.nlm.nih.gov/pubmed/21775304>`_
+
+
   </help>
 </tool>

tools/maf/maf_split_by_species.xml

@@ -211,6 +211,13 @@ the tool will create **a single** history item containing 12 alignment blocks (n
    - An "i" line containing information about what is in the aligned species DNA before and after the immediately preceding "s" line; 
    - An "e" line containing information about the size of the gap between the alignments that span the current block.
 
+------
+
+**Citation**
+
+If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. <http://www.ncbi.nlm.nih.gov/pubmed/21775304>`_
+
+
     </help>
 </tool>
 

tools/maf/maf_stats.xml

@@ -108,5 +108,13 @@ Alternatively, you can request only summary information for a set of intervals:
   ========  ===========  ========
 
   where **coverage** is the number of nucleotides divided by the total length of the provided intervals.
+
+------
+
+**Citation**
+
+If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. <http://www.ncbi.nlm.nih.gov/pubmed/21775304>`_
+
+
   </help>
 </tool>

tools/maf/maf_thread_for_species.xml

@@ -48,6 +48,11 @@ results in::
   s hg17.chr7    127471195 389 + 158628139 gtttgccatcttttgctgctctagggaatccagcagctgtcaccatgtaaacaagcccaggctagaccaGTTACCCTCATCATCTTAGCTGATAGCCAGCCAGCCACCACAGGCAtgagtcaggccatattgctggacccacagaattatgagctaaataaatagtcttgggttaagccactaagttttaggcatagtgtgttatgtaTCTCACAAACATATAAGACTGTGTGTTTGTTGACTGGAGGAAGAGATGCTATAAAGACCACCTTTTAAAACTTCCCAAATACTGCCACTGATGTCCTGATGGAGGTATGAAAACATCCACTAAAATTTGTGGTTTATTCATTTTTCATTATTTTGTTTAAGGAGGTCTATAGTGGAAGAGG 
   s panTro1.chr6 129885076 389 + 161576975 gtttgccatcttttgctgctcttgggaatccagcagctgtcaccatgtaaacaagcccaggctagaccaGTTACCCTCATCATCTTAGCTGATAGCCAGCCAGCCACCACAGGCAtgagtcaggccatattgctggacccacagaattatgagctaaataaatagtcttgggttaagccactaagttttaggcatagtgtgttatgtaTCTCACAAACATATAAGACTGTGTGTTTGTTGACTGGAGGAAGAGATGCTATAAAGACCACCTTTTGAAACTTCCCAAATACTGCCACTGATGTCCTGATGGAGGTATGAAAACATCCACTAAAATTTGTGGTTTATTCGTTTTTCATTATTTTGTTTAAGGAGGTCTATAGTGGAAGAGG 
 
+------
+
+**Citation**
+
+If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. <http://www.ncbi.nlm.nih.gov/pubmed/21775304>`_
 
 
   </help>

tools/maf/maf_to_bed.xml

@@ -123,6 +123,12 @@ Additional (optional) fields are::
     5. score - A score between 0 and 1000.
     6. strand - Defines the strand - either '+' or '-'.
 
+------
+
+**Citation**
+
+If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. <http://www.ncbi.nlm.nih.gov/pubmed/21775304>`_
+
 
     </help>
     <code file="maf_to_bed_code.py"/>

tools/maf/maf_to_fasta.xml

@@ -188,6 +188,12 @@ will be converted to (**note** that the second MAF block, which does not have mm
    - An "i" line containing information about what is in the aligned species DNA before and after the immediately preceding "s" line; 
    - An "e" line containing information about the size of the gap between the alignments that span the current block.
 
+------
+
+**Citation**
+
+If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. <http://www.ncbi.nlm.nih.gov/pubmed/21775304>`_
+
 
   </help>
 </tool>

tools/maf/maf_to_interval.xml

@@ -121,6 +121,12 @@ History item **2** (for mm8)::
    - An "i" line containing information about what is in the aligned species DNA before and after the immediately preceding "s" line; 
    - An "e" line containing information about the size of the gap between the alignments that span the current block.
 
+------
+
+**Citation**
+
+If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. <http://www.ncbi.nlm.nih.gov/pubmed/21775304>`_
+
 
     </help>
 </tool>