From 430b953cda735711670c625b1bf0c2def23f2109 Mon Sep 17 00:00:00 2001 From: Daniel Blankenberg Date: Thu, 25 Aug 2011 10:00:09 -0400 Subject: [PATCH] Minor tool help updates. --- tools/fastq/fastq_combiner.xml | 7 +++++++ tools/fastq/fastq_filter.xml | 7 +++++++ tools/fastq/fastq_groomer.xml | 6 ++++++ tools/fastq/fastq_manipulation.xml | 8 ++++++++ tools/fastq/fastq_masker_by_quality.xml | 7 +++++++ tools/fastq/fastq_paired_end_joiner.xml | 7 +++++++ tools/fastq/fastq_paired_end_splitter.xml | 7 +++++++ tools/fastq/fastq_stats.xml | 7 +++++++ tools/fastq/fastq_to_fasta.xml | 7 +++++++ tools/fastq/fastq_to_tabular.xml | 7 +++++++ tools/fastq/fastq_trimmer.xml | 7 +++++++ tools/fastq/fastq_trimmer_by_quality.xml | 7 +++++++ tools/fastq/tabular_to_fastq.xml | 7 +++++++ tools/maf/genebed_maf_to_fasta.xml | 6 ++++++ tools/maf/interval2maf.xml | 7 +++++++ tools/maf/interval2maf_pairwise.xml | 7 +++++++ tools/maf/interval_maf_to_merged_fasta.xml | 7 +++++++ tools/maf/maf_by_block_number.xml | 8 ++++++++ tools/maf/maf_filter.xml | 7 +++++++ tools/maf/maf_limit_size.xml | 8 ++++++++ tools/maf/maf_limit_to_species.xml | 7 +++++++ tools/maf/maf_reverse_complement.xml | 8 ++++++++ tools/maf/maf_split_by_species.xml | 7 +++++++ tools/maf/maf_stats.xml | 8 ++++++++ tools/maf/maf_thread_for_species.xml | 5 +++++ tools/maf/maf_to_bed.xml | 6 ++++++ tools/maf/maf_to_fasta.xml | 6 ++++++ tools/maf/maf_to_interval.xml | 6 ++++++ 28 files changed, 194 insertions(+) diff --git a/tools/fastq/fastq_combiner.xml b/tools/fastq/fastq_combiner.xml index d22fec3019c..2a7787f2152 100644 --- a/tools/fastq/fastq_combiner.xml +++ b/tools/fastq/fastq_combiner.xml @@ -66,5 +66,12 @@ This tool joins a FASTA file to a Quality Score file, creating a single FASTQ bl Specifying a set of quality scores is optional; when not provided, the output will be fastqsanger or fastqcssanger (when a csfasta is provided) with each quality score being the maximal allowed value (93). Use this tool, for example, to convert 454-type output to FASTQ. + +------ + +**Citation** + +If you use this tool, please cite `Blankenberg D, Gordon A, Von Kuster G, Coraor N, Taylor J, Nekrutenko A; Galaxy Team. Manipulation of FASTQ data with Galaxy. Bioinformatics. 2010 Jul 15;26(14):1783-5. <http://www.ncbi.nlm.nih.gov/pubmed/20562416>`_ + diff --git a/tools/fastq/fastq_filter.xml b/tools/fastq/fastq_filter.xml index da15868a1a8..ae691e3eaca 100644 --- a/tools/fastq/fastq_filter.xml +++ b/tools/fastq/fastq_filter.xml @@ -307,5 +307,12 @@ This tool allows you to build complex filters to be applied to each read in a FA Adapter bases in color space reads are excluded from filtering. +------ + +**Citation** + +If you use this tool, please cite `Blankenberg D, Gordon A, Von Kuster G, Coraor N, Taylor J, Nekrutenko A; Galaxy Team. Manipulation of FASTQ data with Galaxy. Bioinformatics. 2010 Jul 15;26(14):1783-5. <http://www.ncbi.nlm.nih.gov/pubmed/20562416>`_ + + diff --git a/tools/fastq/fastq_groomer.xml b/tools/fastq/fastq_groomer.xml index 5eb5afa83ef..5a3738eb08d 100644 --- a/tools/fastq/fastq_groomer.xml +++ b/tools/fastq/fastq_groomer.xml @@ -358,6 +358,12 @@ When converting between color space (csSanger) and base/sequence space (Sanger, Diagram adapted from http://en.wikipedia.org/wiki/FASTQ_format +------ + +**Citation** + +If you use this tool, please cite `Blankenberg D, Gordon A, Von Kuster G, Coraor N, Taylor J, Nekrutenko A; Galaxy Team. Manipulation of FASTQ data with Galaxy. Bioinformatics. 2010 Jul 15;26(14):1783-5. <http://www.ncbi.nlm.nih.gov/pubmed/20562416>`_ + .. _Cock PJ, Fields CJ, Goto N, Heuer ML, Rice PM. The Sanger FASTQ file format for sequences with quality scores, and the Solexa/Illumina FASTQ variants. Nucleic Acids Res. 2009 Dec 16.: http://www.ncbi.nlm.nih.gov/pubmed/20015970 diff --git a/tools/fastq/fastq_manipulation.xml b/tools/fastq/fastq_manipulation.xml index e449a4bd919..226a9731eb1 100644 --- a/tools/fastq/fastq_manipulation.xml +++ b/tools/fastq/fastq_manipulation.xml @@ -417,5 +417,13 @@ Steps: 2. Click **Add new Manipulate Reads**, change **Manipulate Reads on** to "Sequence Content", set **Sequence Manipulation Type** to "Change Adapter Base" and set **New Adapter** to "" (an empty text field). 3. Click **Add new Manipulate Reads**, change **Manipulate Reads on** to "Sequence Content", set **Sequence Manipulation Type** to "String Translate" and set **From** to "0123." and **To** to "ACGTN". 4. Click Execute. The new history item will contained double-encoded psuedo-nucleotide space reads. + +------ + +**Citation** + +If you use this tool, please cite `Blankenberg D, Gordon A, Von Kuster G, Coraor N, Taylor J, Nekrutenko A; Galaxy Team. Manipulation of FASTQ data with Galaxy. Bioinformatics. 2010 Jul 15;26(14):1783-5. <http://www.ncbi.nlm.nih.gov/pubmed/20562416>`_ + + diff --git a/tools/fastq/fastq_masker_by_quality.xml b/tools/fastq/fastq_masker_by_quality.xml index 7e2d57a32c2..c59710ac6d2 100644 --- a/tools/fastq/fastq_masker_by_quality.xml +++ b/tools/fastq/fastq_masker_by_quality.xml @@ -49,5 +49,12 @@ This tool allows masking base characters in FASTQ format files dependent upon us This tool is not available for use on color space (csSanger) formats. +------ + +**Citation** + +If you use this tool, please cite `Blankenberg D, Gordon A, Von Kuster G, Coraor N, Taylor J, Nekrutenko A; Galaxy Team. Manipulation of FASTQ data with Galaxy. Bioinformatics. 2010 Jul 15;26(14):1783-5. <http://www.ncbi.nlm.nih.gov/pubmed/20562416>`_ + + diff --git a/tools/fastq/fastq_paired_end_joiner.xml b/tools/fastq/fastq_paired_end_joiner.xml index eebf7ed1b9f..c4b6e344565 100644 --- a/tools/fastq/fastq_paired_end_joiner.xml +++ b/tools/fastq/fastq_paired_end_joiner.xml @@ -51,5 +51,12 @@ A multiple-fastq file, for example:: +HWI-EAS91_1_30788AAXX:7:21:1542:1758 hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh`hfhhVZSWehR +------ + +**Citation** + +If you use this tool, please cite `Blankenberg D, Gordon A, Von Kuster G, Coraor N, Taylor J, Nekrutenko A; Galaxy Team. Manipulation of FASTQ data with Galaxy. Bioinformatics. 2010 Jul 15;26(14):1783-5. <http://www.ncbi.nlm.nih.gov/pubmed/20562416>`_ + + diff --git a/tools/fastq/fastq_paired_end_splitter.xml b/tools/fastq/fastq_paired_end_splitter.xml index bc5e9a52d92..1d545345b6e 100644 --- a/tools/fastq/fastq_paired_end_splitter.xml +++ b/tools/fastq/fastq_paired_end_splitter.xml @@ -52,5 +52,12 @@ Right-hand Read:: +HWI-EAS91_1_30788AAXX:7:21:1542:1758/2 hhhhhhhhhhhhhhhhhhhhhhhh`hfhhVZSWehR +------ + +**Citation** + +If you use this tool, please cite `Blankenberg D, Gordon A, Von Kuster G, Coraor N, Taylor J, Nekrutenko A; Galaxy Team. Manipulation of FASTQ data with Galaxy. Bioinformatics. 2010 Jul 15;26(14):1783-5. <http://www.ncbi.nlm.nih.gov/pubmed/20562416>`_ + + diff --git a/tools/fastq/fastq_stats.xml b/tools/fastq/fastq_stats.xml index e9183556acf..ef2ac8669f5 100644 --- a/tools/fastq/fastq_stats.xml +++ b/tools/fastq/fastq_stats.xml @@ -60,5 +60,12 @@ For example:: Adapter bases in color space reads are excluded from statistics. +------ + +**Citation** + +If you use this tool, please cite `Blankenberg D, Gordon A, Von Kuster G, Coraor N, Taylor J, Nekrutenko A; Galaxy Team. Manipulation of FASTQ data with Galaxy. Bioinformatics. 2010 Jul 15;26(14):1783-5. <http://www.ncbi.nlm.nih.gov/pubmed/20562416>`_ + + diff --git a/tools/fastq/fastq_to_fasta.xml b/tools/fastq/fastq_to_fasta.xml index de8bf70dca8..9fd8a3abee4 100644 --- a/tools/fastq/fastq_to_fasta.xml +++ b/tools/fastq/fastq_to_fasta.xml @@ -29,5 +29,12 @@ This tool converts FASTQ sequencing reads to FASTA sequences. +------ + +**Citation** + +If you use this tool, please cite `Blankenberg D, Gordon A, Von Kuster G, Coraor N, Taylor J, Nekrutenko A; Galaxy Team. Manipulation of FASTQ data with Galaxy. Bioinformatics. 2010 Jul 15;26(14):1783-5. <http://www.ncbi.nlm.nih.gov/pubmed/20562416>`_ + + diff --git a/tools/fastq/fastq_to_tabular.xml b/tools/fastq/fastq_to_tabular.xml index 114aa26f587..d1a82c32832 100644 --- a/tools/fastq/fastq_to_tabular.xml +++ b/tools/fastq/fastq_to_tabular.xml @@ -90,5 +90,12 @@ FSRRS4401BRRTC [length=145] [gc=38.62] [flows=800] [phred_min=0] [phred_max=38] Note the sequences and quality strings have been truncated for display purposes in the above tables. +------ + +**Citation** + +If you use this tool, please cite `Blankenberg D, Gordon A, Von Kuster G, Coraor N, Taylor J, Nekrutenko A; Galaxy Team. Manipulation of FASTQ data with Galaxy. Bioinformatics. 2010 Jul 15;26(14):1783-5. <http://www.ncbi.nlm.nih.gov/pubmed/20562416>`_ + + diff --git a/tools/fastq/fastq_trimmer.xml b/tools/fastq/fastq_trimmer.xml index c2606d9f509..e5e969f0f73 100644 --- a/tools/fastq/fastq_trimmer.xml +++ b/tools/fastq/fastq_trimmer.xml @@ -109,5 +109,12 @@ Or you set percent offsets of 6% and 20% (corresponds to absolute offsets of 2,7 Trimming a color space read will cause any adapter base to be lost. +------ + +**Citation** + +If you use this tool, please cite `Blankenberg D, Gordon A, Von Kuster G, Coraor N, Taylor J, Nekrutenko A; Galaxy Team. Manipulation of FASTQ data with Galaxy. Bioinformatics. 2010 Jul 15;26(14):1783-5. <http://www.ncbi.nlm.nih.gov/pubmed/20562416>`_ + + diff --git a/tools/fastq/fastq_trimmer_by_quality.xml b/tools/fastq/fastq_trimmer_by_quality.xml index b8196d14810..df6b4d0a5af 100644 --- a/tools/fastq/fastq_trimmer_by_quality.xml +++ b/tools/fastq/fastq_trimmer_by_quality.xml @@ -134,5 +134,12 @@ The user can provide a maximum count of bases that can be excluded from the aggr Trimming a color space read will cause any adapter base to be lost. +------ + +**Citation** + +If you use this tool, please cite `Blankenberg D, Gordon A, Von Kuster G, Coraor N, Taylor J, Nekrutenko A; Galaxy Team. Manipulation of FASTQ data with Galaxy. Bioinformatics. 2010 Jul 15;26(14):1783-5. <http://www.ncbi.nlm.nih.gov/pubmed/20562416>`_ + + diff --git a/tools/fastq/tabular_to_fastq.xml b/tools/fastq/tabular_to_fastq.xml index 0392a21c44d..b8d1b2bafe7 100644 --- a/tools/fastq/tabular_to_fastq.xml +++ b/tools/fastq/tabular_to_fastq.xml @@ -33,5 +33,12 @@ This tool attempts to convert a tabular file containing sequencing read data to a FASTQ formatted file. The FASTQ Groomer tool should always be used on the output of this tool. +------ + +**Citation** + +If you use this tool, please cite `Blankenberg D, Gordon A, Von Kuster G, Coraor N, Taylor J, Nekrutenko A; Galaxy Team. Manipulation of FASTQ data with Galaxy. Bioinformatics. 2010 Jul 15;26(14):1783-5. <http://www.ncbi.nlm.nih.gov/pubmed/20562416>`_ + + diff --git a/tools/maf/genebed_maf_to_fasta.xml b/tools/maf/genebed_maf_to_fasta.xml index 8bed16db235..3a52c983ead 100644 --- a/tools/maf/genebed_maf_to_fasta.xml +++ b/tools/maf/genebed_maf_to_fasta.xml @@ -87,6 +87,12 @@ The coding sequence of genes are usually composed of several coding exons. Each * stitches blocks together and resolves overlaps based on alignment score; * outputs alignments in FASTA format. +------ + +**Citation** + +If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. <http://www.ncbi.nlm.nih.gov/pubmed/21775304>`_ + diff --git a/tools/maf/interval2maf.xml b/tools/maf/interval2maf.xml index 8539a415067..44eaf40b529 100644 --- a/tools/maf/interval2maf.xml +++ b/tools/maf/interval2maf.xml @@ -283,5 +283,12 @@ the tool will create **a single** history item containing 12 alignment blocks (n s species2.chr1 129723925 79 + 229575298 ATGGCGTCGGCCTCCTCCGGGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTC------AG s species3.chr3 68255714 76 - 258222147 ATGGCGTCCGCCTCCTCAGGGCCAGCGGC---GGCGGGGTTTTCACCCCTTGATTCCGGGGTCCCTGCCGGTACCGC------AG +------ + +**Citation** + +If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. <http://www.ncbi.nlm.nih.gov/pubmed/21775304>`_ + + diff --git a/tools/maf/interval2maf_pairwise.xml b/tools/maf/interval2maf_pairwise.xml index 230902cce88..7cfbb104c2e 100644 --- a/tools/maf/interval2maf_pairwise.xml +++ b/tools/maf/interval2maf_pairwise.xml @@ -39,5 +39,12 @@ Here a single interval is superimposed on three MAF blocks. Blocks 1 and 3 are t .. image:: ./static/images/maf_icons/interval2maf.png +------ + +**Citation** + +If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. <http://www.ncbi.nlm.nih.gov/pubmed/21775304>`_ + + diff --git a/tools/maf/interval_maf_to_merged_fasta.xml b/tools/maf/interval_maf_to_merged_fasta.xml index d580292c9de..de299158f6d 100644 --- a/tools/maf/interval_maf_to_merged_fasta.xml +++ b/tools/maf/interval_maf_to_merged_fasta.xml @@ -103,5 +103,12 @@ Here three MAF blocks overlapping a single interval are stitched together. Space .. image:: ./static/images/maf_icons/stitchMaf.png +------ + +**Citation** + +If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. <http://www.ncbi.nlm.nih.gov/pubmed/21775304>`_ + + diff --git a/tools/maf/maf_by_block_number.xml b/tools/maf/maf_by_block_number.xml index 8c05dd35e22..4dae63522ed 100644 --- a/tools/maf/maf_by_block_number.xml +++ b/tools/maf/maf_by_block_number.xml @@ -28,5 +28,13 @@ **What it does** This tool takes a list of block numbers, one per line, and extracts the corresponding MAF blocks from the provided file. Block numbers start at 0. + +------ + +**Citation** + +If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. <http://www.ncbi.nlm.nih.gov/pubmed/21775304>`_ + + diff --git a/tools/maf/maf_filter.xml b/tools/maf/maf_filter.xml index 23dfc7c4b80..0be3fcbf38a 100644 --- a/tools/maf/maf_filter.xml +++ b/tools/maf/maf_filter.xml @@ -191,5 +191,12 @@ This tool allows the user to remove any undesired species from a MAF file. If no You can also provide a size range and limit your output to the MAF blocks which fall within the specified range. +------ + +**Citation** + +If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. <http://www.ncbi.nlm.nih.gov/pubmed/21775304>`_ + + diff --git a/tools/maf/maf_limit_size.xml b/tools/maf/maf_limit_size.xml index 5c5a8d85e6a..622a2c84147 100644 --- a/tools/maf/maf_limit_size.xml +++ b/tools/maf/maf_limit_size.xml @@ -24,5 +24,13 @@ **What it does** This tool takes a MAF file and a size range and extracts the MAF blocks which fall within the specified range. + +------ + +**Citation** + +If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. <http://www.ncbi.nlm.nih.gov/pubmed/21775304>`_ + + diff --git a/tools/maf/maf_limit_to_species.xml b/tools/maf/maf_limit_to_species.xml index 6b10517c024..b85fb325455 100644 --- a/tools/maf/maf_limit_to_species.xml +++ b/tools/maf/maf_limit_to_species.xml @@ -39,6 +39,13 @@ This tool allows the user to remove any undesired species from a MAF file. Colum * **Exclude blocks with have only one species** - if this option is set to **YES** all single sequence alignment blocks WILL NOT be returned. +------ + +**Citation** + +If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. <http://www.ncbi.nlm.nih.gov/pubmed/21775304>`_ + + diff --git a/tools/maf/maf_reverse_complement.xml b/tools/maf/maf_reverse_complement.xml index 0eb16d0e81a..22339aaf7b1 100644 --- a/tools/maf/maf_reverse_complement.xml +++ b/tools/maf/maf_reverse_complement.xml @@ -41,5 +41,13 @@ becomes:: s hg17.chr7 31156555 58 - 158628139 CCTCTTCCACTATAGACCTCCTTAAACAAAATAATGAAAAATGAATAAACCACAAATT s panTro1.chr6 31691510 58 - 161576975 CCTCTTCCACTATAGACCTCCTTAAACAAAATAATGAAAAACGAATAAACCACAAATT s mm5.chr6 120816549 54 - 149721531 CCTCTTCCACTGAGGAATTTCTTTTTTTAAATGATGAGCAATCAATGAAACG----TT + +------ + +**Citation** + +If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. <http://www.ncbi.nlm.nih.gov/pubmed/21775304>`_ + + diff --git a/tools/maf/maf_split_by_species.xml b/tools/maf/maf_split_by_species.xml index d703ba97402..89e1deda63d 100644 --- a/tools/maf/maf_split_by_species.xml +++ b/tools/maf/maf_split_by_species.xml @@ -211,6 +211,13 @@ the tool will create **a single** history item containing 12 alignment blocks (n - An "i" line containing information about what is in the aligned species DNA before and after the immediately preceding "s" line; - An "e" line containing information about the size of the gap between the alignments that span the current block. +------ + +**Citation** + +If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. <http://www.ncbi.nlm.nih.gov/pubmed/21775304>`_ + + diff --git a/tools/maf/maf_stats.xml b/tools/maf/maf_stats.xml index 59d745fe8fb..7e4c61a062d 100644 --- a/tools/maf/maf_stats.xml +++ b/tools/maf/maf_stats.xml @@ -108,5 +108,13 @@ Alternatively, you can request only summary information for a set of intervals: ======== =========== ======== where **coverage** is the number of nucleotides divided by the total length of the provided intervals. + +------ + +**Citation** + +If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. <http://www.ncbi.nlm.nih.gov/pubmed/21775304>`_ + + diff --git a/tools/maf/maf_thread_for_species.xml b/tools/maf/maf_thread_for_species.xml index a5bff427244..64f9ab18328 100644 --- a/tools/maf/maf_thread_for_species.xml +++ b/tools/maf/maf_thread_for_species.xml @@ -48,6 +48,11 @@ results in:: s hg17.chr7 127471195 389 + 158628139 gtttgccatcttttgctgctctagggaatccagcagctgtcaccatgtaaacaagcccaggctagaccaGTTACCCTCATCATCTTAGCTGATAGCCAGCCAGCCACCACAGGCAtgagtcaggccatattgctggacccacagaattatgagctaaataaatagtcttgggttaagccactaagttttaggcatagtgtgttatgtaTCTCACAAACATATAAGACTGTGTGTTTGTTGACTGGAGGAAGAGATGCTATAAAGACCACCTTTTAAAACTTCCCAAATACTGCCACTGATGTCCTGATGGAGGTATGAAAACATCCACTAAAATTTGTGGTTTATTCATTTTTCATTATTTTGTTTAAGGAGGTCTATAGTGGAAGAGG s panTro1.chr6 129885076 389 + 161576975 gtttgccatcttttgctgctcttgggaatccagcagctgtcaccatgtaaacaagcccaggctagaccaGTTACCCTCATCATCTTAGCTGATAGCCAGCCAGCCACCACAGGCAtgagtcaggccatattgctggacccacagaattatgagctaaataaatagtcttgggttaagccactaagttttaggcatagtgtgttatgtaTCTCACAAACATATAAGACTGTGTGTTTGTTGACTGGAGGAAGAGATGCTATAAAGACCACCTTTTGAAACTTCCCAAATACTGCCACTGATGTCCTGATGGAGGTATGAAAACATCCACTAAAATTTGTGGTTTATTCGTTTTTCATTATTTTGTTTAAGGAGGTCTATAGTGGAAGAGG +------ + +**Citation** + +If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. <http://www.ncbi.nlm.nih.gov/pubmed/21775304>`_ diff --git a/tools/maf/maf_to_bed.xml b/tools/maf/maf_to_bed.xml index 955d4c150d4..1f51f9d1502 100644 --- a/tools/maf/maf_to_bed.xml +++ b/tools/maf/maf_to_bed.xml @@ -123,6 +123,12 @@ Additional (optional) fields are:: 5. score - A score between 0 and 1000. 6. strand - Defines the strand - either '+' or '-'. +------ + +**Citation** + +If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. <http://www.ncbi.nlm.nih.gov/pubmed/21775304>`_ + diff --git a/tools/maf/maf_to_fasta.xml b/tools/maf/maf_to_fasta.xml index e76d9ede583..b4dc3944ef4 100644 --- a/tools/maf/maf_to_fasta.xml +++ b/tools/maf/maf_to_fasta.xml @@ -188,6 +188,12 @@ will be converted to (**note** that the second MAF block, which does not have mm - An "i" line containing information about what is in the aligned species DNA before and after the immediately preceding "s" line; - An "e" line containing information about the size of the gap between the alignments that span the current block. +------ + +**Citation** + +If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. <http://www.ncbi.nlm.nih.gov/pubmed/21775304>`_ + diff --git a/tools/maf/maf_to_interval.xml b/tools/maf/maf_to_interval.xml index 17cb41c8e18..22362fa50fa 100644 --- a/tools/maf/maf_to_interval.xml +++ b/tools/maf/maf_to_interval.xml @@ -121,6 +121,12 @@ History item **2** (for mm8):: - An "i" line containing information about what is in the aligned species DNA before and after the immediately preceding "s" line; - An "e" line containing information about the size of the gap between the alignments that span the current block. +------ + +**Citation** + +If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. <http://www.ncbi.nlm.nih.gov/pubmed/21775304>`_ +