opensource/galaxy
3
0
Fork 0
mirror of https://github.com/galaxyproject/galaxy.git synced 2026-09-24 16:30:27 +08:00
Code Issues Packages Projects Releases Wiki Activity

Second pass of help and interface updates. Not done yet...

Browse Source
This commit is contained in:
Anton Nekrutenko
2009-09-22 08:59:36 -04:00
parent 2a3c96e3f2
commit 13c7b84abb
19 changed files with 107 additions and 104 deletions
Download Patch File Download Diff File Expand all files Collapse all files
static/images/solid_qual.png
BIN
View File
Binary file not shown.
Side by Side Swipe Overlay

Before

Width:  |  Height:  |  Size: 7.7 KiB

After

Width:  |  Height:  |  Size: 62 KiB

tool_conf.xml.sample
+2 -2
View File
@@ -70,8 +70,10 @@
<tool file="maf/maf_to_interval.xml" />
<tool file="maf/maf_to_fasta.xml" />
<tool file="fasta_tools/tabular_to_fasta.xml" />
<tool file="fastx_toolkit/fastq_to_fasta.xml" />
<tool file="next_gen_conversion/solid_to_fastq.xml" />
<tool file="next_gen_conversion/fastq_conversions.xml" />
<tool file="fastx_toolkit/fastq_quality_converter.xml" />
</section>
<section name="Extract Features" id="features">
<tool file="filters/ucsc_gene_bed_to_exon_bed.xml" />
@@ -175,8 +177,6 @@
<tool file="fastx_toolkit/fastq_quality_boxplot.xml" />
<tool file="fastx_toolkit/fastx_nucleotides_distribution.xml" />
<!-- <tool file="fastx_toolkit/fasta_clipping_histogram.xml" /> -->
<tool file="fastx_toolkit/fastq_to_fasta.xml" />
<tool file="fastx_toolkit/fastq_quality_converter.xml" />
<!-- <tool file="fastx_toolkit/fastx_clipper.xml" /> -->
<tool file="fastx_toolkit/fastx_trimmer.xml" />
<tool file="fastx_toolkit/fastx_renamer.xml" />
tools/fastx_toolkit/fastq_quality_boxplot.xml
+11 -3
View File
@@ -1,10 +1,10 @@
<tool id="cshl_fastq_quality_boxplot" name="Quality Score">
<description>chart</description>
<tool id="cshl_fastq_quality_boxplot" name="Draw quality score boxplot">
<description></description>
<command>fastq_quality_boxplot_graph.sh -t '$input.name' -i $input -o $output</command>
<inputs>
<param format="txt" name="input" type="data" label="Statistics report file (output of 'FASTQ Statistics' tool)" />
<param format="txt" name="input" type="data" label="Statistics report file" help="output of 'FASTQ Statistics' tool" />
</inputs>
<outputs>
@@ -42,6 +42,14 @@ A low quality library (median drops quickly):
.. image:: ../static/fastx_icons/fastq_quality_boxplot_3.png
------
This tool is based on `FASTX-toolkit`__ by Assaf Gordon.
.. __: http://hannonlab.cshl.edu/fastx_toolkit/
</help>
</tool>
<!-- FASTQ-Quality-Boxplot is part of the FASTX-toolkit, by A.Gordon (gordon@cshl.edu) -->
tools/fastx_toolkit/fastq_quality_converter.xml
+5
View File
@@ -85,7 +85,12 @@ FASTQ with ASCII quality scores::
+CSHL__2_FC042AGWWWXX:8:1:103:1185
hhhhhca_hhh`^Vh@IVQNHdObVLWCJ@HBDY^B
------
This tool is based on `FASTX-toolkit`__ by Assaf Gordon.
.. __: http://hannonlab.cshl.edu/fastx_toolkit/
</help>
</tool>
<!-- FASTQ-Quality-Converter is part of the FASTX-toolkit, by A.Gordon (gordon@cshl.edu) -->
tools/fastx_toolkit/fastq_quality_filter.xml
+6 -2
View File
@@ -1,4 +1,4 @@
<tool id="cshl_fastq_quality_filter" name="Quality Filter">
<tool id="cshl_fastq_quality_filter" name="Filter by quality">
<description></description>
<command>zcat -f '$input' | fastq_quality_filter -q $quality -p $percent -v -o $output</command>
@@ -67,7 +67,11 @@ Using **percent = 90** and **cut-off = 30** - This read will be discarded (90% o
Using **percent = 100** and **cut-off = 20** - This read will be discarded (not all cycles have quality equal to / higher than 20).
------
This tool is based on `FASTX-toolkit`__ by Assaf Gordon.
.. __: http://hannonlab.cshl.edu/fastx_toolkit/
</help>
</tool>
<!-- FASTQ-Quality-Filter is part of the FASTX-toolkit, by A.Gordon (gordon@cshl.edu) -->
tools/fastx_toolkit/fastq_to_fasta.xml
+5
View File
@@ -65,6 +65,11 @@ Will be converted to FASTA (with 'rename sequence names' = YES)::
>1
GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT
------
This tool is based on `FASTX-toolkit`__ by Assaf Gordon.
.. __: http://hannonlab.cshl.edu/fastx_toolkit/
</help>
</tool>
<!-- FASTQ-to-FASTA is part of the FASTX-toolkit, by A.Gordon (gordon@cshl.edu) -->
tools/fastx_toolkit/fastx_artifacts_filter.xml
+7 -2
View File
@@ -1,9 +1,9 @@
<tool id="cshl_fastx_artifacts_filter" name="Artifacts Filter">
<tool id="cshl_fastx_artifacts_filter" name="Remove sequencing artifacts">
<description></description>
<command>zcat -f '$input' | fastx_artifacts_filter -v -o "$output"</command>
<inputs>
<param format="fasta,fastqsolexa" name="input" type="data" label="Library to filter" />
<param format="fasta,fastqsanger" name="input" type="data" label="Library to filter" />
</inputs>
@@ -74,7 +74,12 @@ This tool filters sequencing artifacts (reads with all but 3 identical bases).
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAAAAAAAAAAA
------
This tool is based on `FASTX-toolkit`__ by Assaf Gordon.
.. __: http://hannonlab.cshl.edu/fastx_toolkit/
</help>
</tool>
<!-- FASTX-Artifacts-filter is part of the FASTX-toolkit, by A.Gordon (gordon@cshl.edu) -->
tools/fastx_toolkit/fastx_nucleotides_distribution.xml
+9 -25
View File
@@ -1,9 +1,9 @@
<tool id="cshl_fastx_nucleotides_distribution" name="Nucleotides Distribution">
<description>chart</description>
<tool id="cshl_fastx_nucleotides_distribution" name="Draw nucleotides distribution chart">
<description></description>
<command>fastx_nucleotide_distribution_graph.sh -t '$input.name' -i $input -o $output</command>
<inputs>
<param format="txt" name="input" type="data" label="Statistics Text File (output of 'FASTX Statistics' tool)" />
<param format="txt" name="input" type="data" label="Statistics Text File" help="output of 'FASTX Statistics' tool" />
</inputs>
<outputs>
@@ -23,44 +23,28 @@ Creates a stacked-histogram graph for the nucleotide distribution in the Solexa
**Output Examples**
The following chart clearly shows the barcode used at the 5'-end of the library: **GATCT**
.. image:: ./static/fastx_icons/fastq_nucleotides_distribution_1.png
In the following chart, one can almost 'read' the most abundant sequence by looking at the dominant values: **TGATA TCGTA TTGAT GACTG AA...**
.. image:: ./static/fastx_icons/fastq_nucleotides_distribution_2.png
The following chart shows a growing number of unknown (N) nucleotides towards later cycles (which might indicate a sequencing problem):
.. image:: ./static/fastx_icons/fastq_nucleotides_distribution_3.png
But most of the time, the chart will look rather random:
.. image:: ./static/fastx_icons/fastq_nucleotides_distribution_4.png
------
This tool is based on `FASTX-toolkit`__ by Assaf Gordon.
.. __: http://hannonlab.cshl.edu/fastx_toolkit/
</help>
</tool>
<!-- FASTQ-Nucleotides-Distribution is part of the FASTX-toolkit, by A.Gordon (gordon@cshl.edu) -->
tools/fastx_toolkit/fastx_quality_statistics.xml
+13 -44
View File
@@ -1,4 +1,4 @@
<tool id="cshl_fastx_quality_statistics" name="Quality Statistics">
<tool id="cshl_fastx_quality_statistics" name="Compute quality statistics">
<description></description>
<command>zcat -f $input | fastx_quality_stats -o $output -Q $offset</command>
@@ -55,51 +55,20 @@ Creates quality statistics report for the given Solexa/FASTQ library.
* N_Count = Count of 'N' nucleotides found in this column.
For example::
**Output Example**::
column count min max sum mean Q1 med Q3 IQR lW rW A_Count C_Count G_Count T_Count N_Count
1 6362991 -4 40 250734117 39.41 40 40 40 0 40 40 1396976 1329101 678730 2958184 0
2 6362991 -5 40 250531036 39.37 40 40 40 0 40 40 1786786 1055766 1738025 1782414 0
3 6362991 -5 40 248722469 39.09 40 40 40 0 40 40 2296384 984875 1443989 1637743 0
4 6362991 -5 40 247654797 38.92 40 40 40 0 40 40 1683197 1410855 1722633 1546306 0
5 6362991 -4 40 248214827 39.01 40 40 40 0 40 40 2536861 1167423 1248968 1409739 0
6 6362991 -5 40 248499903 39.05 40 40 40 0 40 40 1598956 1236081 1568608 1959346 0
7 6362991 -4 40 247719760 38.93 40 40 40 0 40 40 1692667 1822140 1496741 1351443 0
8 6362991 -5 40 245745205 38.62 40 40 40 0 40 40 2230936 1343260 1529928 1258867 0
9 6362991 -5 40 245766735 38.62 40 40 40 0 40 40 1702064 1306257 1336511 2018159 0
10 6362991 -5 40 245089706 38.52 40 40 40 0 40 40 1519917 1446370 1450995 1945709 0
11 6362991 -5 40 242641359 38.13 40 40 40 0 40 40 1717434 1282975 1387804 1974778 0
12 6362991 -5 40 242026113 38.04 40 40 40 0 40 40 1662872 1202041 1519721 1978357 0
13 6362991 -5 40 238704245 37.51 40 40 40 0 40 40 1549965 1271411 1973291 1566681 1643
14 6362991 -5 40 235622401 37.03 40 40 40 0 40 40 2101301 1141451 1603990 1515774 475
15 6362991 -5 40 230766669 36.27 40 40 40 0 40 40 2344003 1058571 1440466 1519865 86
16 6362991 -5 40 224466237 35.28 38 40 40 2 35 40 2203515 1026017 1474060 1651582 7817
17 6362991 -5 40 219990002 34.57 34 40 40 6 25 40 1522515 1125455 2159183 1555765 73
18 6362991 -5 40 214104778 33.65 30 40 40 10 15 40 1479795 2068113 1558400 1249337 7346
19 6362991 -5 40 212934712 33.46 30 40 40 10 15 40 1432749 1231352 1769799 1920093 8998
20 6362991 -5 40 212787944 33.44 29 40 40 11 13 40 1311657 1411663 2126316 1513282 73
21 6362991 -5 40 211369187 33.22 28 40 40 12 10 40 1887985 1846300 1300326 1318380 10000
22 6362991 -5 40 213371720 33.53 30 40 40 10 15 40 542299 3446249 516615 1848190 9638
23 6362991 -5 40 221975899 34.89 36 40 40 4 30 40 347679 1233267 926621 3855355 69
24 6362991 -5 40 194378421 30.55 21 40 40 19 -5 40 433560 674358 3262764 1992242 67
25 6362991 -5 40 199773985 31.40 23 40 40 17 -2 40 944760 325595 1322800 3769641 195
26 6362991 -5 40 179404759 28.20 17 34 40 23 -5 40 3457922 156013 1494664 1254293 99
27 6362991 -5 40 163386668 25.68 13 28 40 27 -5 40 1392177 281250 3867895 821491 178
28 6362991 -5 40 156230534 24.55 12 25 40 28 -5 40 907189 981249 4174945 299437 171
29 6362991 -5 40 163236046 25.65 13 28 40 27 -5 40 1097171 3418678 1567013 280008 121
30 6362991 -5 40 151309826 23.78 12 23 40 28 -5 40 3514775 2036194 566277 245613 132
31 6362991 -5 40 141392520 22.22 10 21 40 30 -5 40 1569000 4571357 124732 97721 181
32 6362991 -5 40 143436943 22.54 10 21 40 30 -5 40 1453607 4519441 38176 351107 660
33 6362991 -5 40 114269843 17.96 6 14 30 24 -5 40 3311001 2161254 155505 734297 934
34 6362991 -5 40 140638447 22.10 10 20 40 30 -5 40 1501615 1637357 18113 3205237 669
35 6362991 -5 40 138910532 21.83 10 20 40 30 -5 40 1532519 3495057 23229 1311834 352
36 6362991 -5 40 117158566 18.41 7 15 30 23 -5 40 4074444 1402980 63287 822035 245
1 6362991 -4 40 250734117 39.41 40 40 40 0 40 40 1396976 1329101 678730 2958184 0
2 6362991 -5 40 250531036 39.37 40 40 40 0 40 40 1786786 1055766 1738025 1782414 0
3 6362991 -5 40 248722469 39.09 40 40 40 0 40 40 2296384 984875 1443989 1637743 0
4 6362991 -4 40 248214827 39.01 40 40 40 0 40 40 2536861 1167423 1248968 1409739 0
36 6362991 -5 40 117158566 18.41 7 15 30 23 -5 40 4074444 1402980 63287 822035 245
------
This tool is based on `FASTX-toolkit`__ by Assaf Gordon.
.. __: http://hannonlab.cshl.edu/fastx_toolkit/
</help>
</tool>
</tool>
<!-- FASTQ-Statistics is part of the FASTX-toolkit, by A.Gordon (gordon@cshl.edu) -->
tools/fastx_toolkit/fastx_renamer.xml
+7 -3
View File
@@ -1,5 +1,5 @@
<tool id="cshl_fastx_renamer" name="Rename" version="0.0.11" >
<description>sequence identifiers</description>
<tool id="cshl_fastx_renamer" name="Rename sequences" version="0.0.11" >
<description></description>
<command>zcat -f $input | fastx_renamer -n $TYPE -o $output -v </command>
<inputs>
@@ -50,7 +50,11 @@ Renamed to **numeric counter**::
+1
40 40 40 40 40 40 40 40 40 40 38 40 40 40 40 40 14 40 40 40 40 40 36 40 13 14 24 24 9 24 9 40 10 10 15 40
------
This tool is based on `FASTX-toolkit`__ by Assaf Gordon.
.. __: http://hannonlab.cshl.edu/fastx_toolkit/
</help>
</tool>
<!-- FASTQ-to-FASTA is part of the FASTX-toolkit, by A.Gordon (gordon@cshl.edu) -->
tools/fastx_toolkit/fastx_reverse_complement.xml
+6 -1
View File
@@ -1,5 +1,5 @@
<tool id="cshl_fastx_reverse_complement" name="Reverse-Complement">
<description>sequences</description>
<description></description>
<command>zcat -f '$input' | fastx_reverse_complement -v -o $output</command>
<inputs>
<param format="fasta,fastqsolexa" name="input" type="data" label="Library to reverse-complement" />
@@ -47,6 +47,11 @@ Output FASTQ file::
TACCNNCTTTGAATTACAAGGANGAGGCTACAGACA
+CSHL_1_FC42AGWWWXX:8:1:3:740
26 27 17 15 5 5 24 26 29 31 32 33 27 21 27 33 33 33 33 33 33 27 5 27 33 33 33 33 33 33 33 33 34 33 33 33
------
This tool is based on `FASTX-toolkit`__ by Assaf Gordon.
.. __: http://hannonlab.cshl.edu/fastx_toolkit/
</help>
</tool>
tools/fastx_toolkit/fastx_trimmer.xml
+9 -3
View File
@@ -1,9 +1,9 @@
<tool id="cshl_fastx_trimmer" name="Trim">
<description>sequences</description>
<tool id="cshl_fastx_trimmer" name="Trim sequences">
<description></description>
<command>zcat -f '$input' | fastx_trimmer -v -f $first -l $last -o $output</command>
<inputs>
<param format="fasta,fastqsolexa" name="input" type="data" label="Library to clip" />
<param format="fasta,fastasanger" name="input" type="data" label="Library to clip" />
<param name="first" size="4" type="integer" value="1">
<label>First base to keep</label>
@@ -65,6 +65,12 @@ Trimming with First=6 and Last=10, will generate a FASTA file with 5 bases (base
>2-1
AGGCT
------
This tool is based on `FASTX-toolkit`__ by Assaf Gordon.
.. __: http://hannonlab.cshl.edu/fastx_toolkit/
</help>
</tool>
<!-- FASTX-Trimmer is part of the FASTX-toolkit, by A.Gordon (gordon@cshl.edu) -->
tools/metag_tools/short_reads_figure_score.xml
+2 -2
View File
@@ -1,5 +1,5 @@
<tool id="quality_score_distribution" name="Build distribution of base quality">
<description>values</description>
<tool id="quality_score_distribution" name="Build base quality distribution">
<description></description>
<command interpreter="python">short_reads_figure_score.py $input1 $output1 </command>
tools/metag_tools/short_reads_trim_seq.xml
+1 -1
View File
@@ -1,5 +1,5 @@
<tool id="trim_reads" name="Select high quality segments" version="1.0.0">
<description>from short reads</description>
<description></description>
<command interpreter="python">
short_reads_trim_seq.py $trim $length $output1 $input1 $input2 $sequencing_method_choice.input3
tools/metag_tools/split_paired_reads.xml
+2 -2
View File
@@ -1,5 +1,5 @@
<tool id="split_paired_reads" name="Split" version="1.0.0">
<description>paired-end reads into two ends</description>
<tool id="split_paired_reads" name="Split paired end reads" version="1.0.0">
<description></description>
<command interpreter="python">
split_paired_reads.py $input $output1 $output2
</command>
tools/solid_tools/solid_qual_boxplot.xml
+5 -1
View File
@@ -1,4 +1,4 @@
<tool id="solid_qual_boxplot" name="Quality Boxplot" version="1.0.0">
<tool id="solid_qual_boxplot" name="Draw quality score boxplot" version="1.0.0">
<description>for SOLiD data</description>
<command interpreter="bash">qualsolid_boxplot_graph.sh -t '$input.name' -i $input -o $output</command>
@@ -31,6 +31,10 @@ Creates a boxplot graph for the quality scores in the library.
.. image:: ../static/images/solid_qual.png
------
This tool is based on `FASTX-toolkit`__ by Assaf Gordon.
.. __: http://hannonlab.cshl.edu/fastx_toolkit/
</help>
</tool>
tools/solid_tools/solid_qual_stats.xml
+5 -1
View File
@@ -1,4 +1,4 @@
<tool id="solid_qual_stats" name="Quality Statistics" version="1.0.0">
<tool id="solid_qual_stats" name="Compute quality statistics" version="1.0.0">
<description>for SOLiD data</description>
<command interpreter="python">solid_qual_stats.py $input $output1</command>
@@ -60,6 +60,10 @@ Creates quality statistics report for the given SOLiD quality score file.
34 6362991 2 29 140638447 12.10 3 10 25 22 2 29
35 6362991 2 29 138910532 11.83 3 10 25 22 2 29
------
This tool is based on `FASTX-toolkit`__ by Assaf Gordon.
.. __: http://hannonlab.cshl.edu/fastx_toolkit/
</help>
</tool>
tools/sr_mapping/bowtie_wrapper.xml
+6 -6
View File
@@ -1,5 +1,5 @@
<tool id="bowtie_wrapper" name="Bowtie" version="1.0.0">
<description> fast alignment of reads against reference sequence </description>
<tool id="bowtie_wrapper" name="Map with Bowtie" version="1.0.0">
<description></description>
<command interpreter="python">
bowtie_wrapper.py
--threads="8"
@@ -148,7 +148,7 @@
<option value="history">Use one from the history</option>
</param>
<when value="indexed">
<param name="indices" type="select" label="Select a reference genome">
<param name="indices" type="select" label="Select a reference genome" help="if your genome of interest is not listed - contact Galaxy team">
<options from_file="bowtie_indices.loc">
<column name="value" index="1" />
<column name="name" index="0" />
@@ -215,7 +215,7 @@
<option value="paired">Paired-end</option>
</param>
<when value="single">
<param name="input1" type="data" format="fastqsanger" label="FASTQ file" />
<param name="input1" type="data" format="fastqsanger" label="FASTQ file" help="Must have Sanger-scaled quality values with ASCII offset 33"/>
<conditional name="params">
<param name="settings_type" type="select" label="Bowtie settings to use" help="For most mapping needs use Commonly used settings. If you want full control use Full parameter list">
<option value="pre_set">Commonly used</option>
@@ -272,8 +272,8 @@
</conditional> <!-- params -->
</when> <!-- single -->
<when value="paired">
<param name="input1" type="data" format="fastqsanger" label="Forward FASTQ file" />
<param name="input2" type="data" format="fastqsanger" label="Reverse FASTQ file" />
<param name="input1" type="data" format="fastqsanger" label="Forward FASTQ file" help="Must have Sanger-scaled quality values with ASCII offset 33"/>
<param name="input2" type="data" format="fastqsanger" label="Reverse FASTQ file" help="Must have Sanger-scaled quality values with ASCII offset 33"/>
<conditional name="params">
<param name="settings_type" type="select" label="Bowtie settings to use" help="For most mapping needs use Commonly used settings. If you want full control use Full parameter list">
<option value="pre_set">Commonly used</option>
tools/sr_mapping/bwa_wrapper.xml
+6 -6
View File
@@ -1,5 +1,5 @@
<tool id="bwa_wrapper" name="BWA" version="1.0.1">
<description> fast mapping of reads against reference sequence</description>
<tool id="bwa_wrapper" name="Map with BWA" version="1.0.1">
<description></description>
<command interpreter="python">
bwa_wrapper.py
--threads="8"
@@ -76,7 +76,7 @@
<option value="history">Use one from the history</option>
</param>
<when value="indexed">
<param name="indices" type="select" label="Select a reference genome">
<param name="indices" type="select" label="Select a reference genome" help="if your genome of interest is not listed - contact Galaxy team">
<options from_file="sequence_index_color.loc">
<column name="value" index="1" />
<column name="name" index="0" />
@@ -116,11 +116,11 @@
<option value="paired">Paired-end</option>
</param>
<when value="single">
<param name="input1" type="data" format="fastqsanger" label="FASTQ file" />
<param name="input1" type="data" format="fastqsanger" label="FASTQ file" help="Must have Sanger-scaled quality values with ASCII offset 33"/>
</when>
<when value="paired">
<param name="input1" type="data" format="fastqsanger" label="Forward FASTQ file" />
<param name="input2" type="data" format="fastqsanger" label="Reverse FASTQ file" />
<param name="input1" type="data" format="fastqsanger" label="Forward FASTQ file" help="Must have Sanger-scaled quality values with ASCII offset 33"/>
<param name="input2" type="data" format="fastqsanger" label="Reverse FASTQ file" help="Must have Sanger-scaled quality values with ASCII offset 33"/>
</when>
</conditional>
<conditional name="params">