diff --git a/static/images/solid_qual.png b/static/images/solid_qual.png
index 397c536e752..777a3cec7b7 100644
Binary files a/static/images/solid_qual.png and b/static/images/solid_qual.png differ
diff --git a/tool_conf.xml.sample b/tool_conf.xml.sample
index ce0104736fb..f19a6b9d6a0 100644
--- a/tool_conf.xml.sample
+++ b/tool_conf.xml.sample
@@ -70,8 +70,10 @@
     <tool file="maf/maf_to_interval.xml" />
     <tool file="maf/maf_to_fasta.xml" />
     <tool file="fasta_tools/tabular_to_fasta.xml" />
+    <tool file="fastx_toolkit/fastq_to_fasta.xml" />
     <tool file="next_gen_conversion/solid_to_fastq.xml" />
     <tool file="next_gen_conversion/fastq_conversions.xml" />
+    <tool file="fastx_toolkit/fastq_quality_converter.xml" />
   </section>
   <section name="Extract Features" id="features">
     <tool file="filters/ucsc_gene_bed_to_exon_bed.xml" />
@@ -175,8 +177,6 @@
         <tool file="fastx_toolkit/fastq_quality_boxplot.xml" />
         <tool file="fastx_toolkit/fastx_nucleotides_distribution.xml" />
         <!-- <tool file="fastx_toolkit/fasta_clipping_histogram.xml" /> -->
-        <tool file="fastx_toolkit/fastq_to_fasta.xml" />
-        <tool file="fastx_toolkit/fastq_quality_converter.xml" />
         <!-- <tool file="fastx_toolkit/fastx_clipper.xml" /> -->
         <tool file="fastx_toolkit/fastx_trimmer.xml" />
         <tool file="fastx_toolkit/fastx_renamer.xml" />
diff --git a/tools/fastx_toolkit/fastq_quality_boxplot.xml b/tools/fastx_toolkit/fastq_quality_boxplot.xml
index 2ba0f04d517..f2ce7941391 100644
--- a/tools/fastx_toolkit/fastq_quality_boxplot.xml
+++ b/tools/fastx_toolkit/fastq_quality_boxplot.xml
@@ -1,10 +1,10 @@
-<tool id="cshl_fastq_quality_boxplot" name="Quality Score">
-	<description>chart</description>
+<tool id="cshl_fastq_quality_boxplot" name="Draw quality score boxplot">
+	<description></description>
 	
 	<command>fastq_quality_boxplot_graph.sh -t '$input.name' -i $input -o $output</command>
 	
 	<inputs>
-		<param format="txt" name="input" type="data" label="Statistics report file (output of 'FASTQ Statistics' tool)" />
+		<param format="txt" name="input" type="data" label="Statistics report file"  help="output of 'FASTQ Statistics' tool" />
 	</inputs>
 
 	<outputs>
@@ -42,6 +42,14 @@ A low quality library (median drops quickly):
 
 .. image:: ../static/fastx_icons/fastq_quality_boxplot_3.png
 
+------
+
+This tool is based on `FASTX-toolkit`__ by Assaf Gordon.
+
+ .. __: http://hannonlab.cshl.edu/fastx_toolkit/
+
+
+
 </help>
 </tool>
 <!-- FASTQ-Quality-Boxplot is part of the FASTX-toolkit, by A.Gordon (gordon@cshl.edu) -->
diff --git a/tools/fastx_toolkit/fastq_quality_converter.xml b/tools/fastx_toolkit/fastq_quality_converter.xml
index 7d9df15cf44..7c7d6637eeb 100644
--- a/tools/fastx_toolkit/fastq_quality_converter.xml
+++ b/tools/fastx_toolkit/fastq_quality_converter.xml
@@ -85,7 +85,12 @@ FASTQ with ASCII quality scores::
     +CSHL__2_FC042AGWWWXX:8:1:103:1185
     hhhhhca_hhh`^Vh@IVQNHdObVLWCJ@HBDY^B
 
+------
 
+This tool is based on `FASTX-toolkit`__ by Assaf Gordon.
+
+ .. __: http://hannonlab.cshl.edu/fastx_toolkit/
+ 
 </help>
 </tool>
 <!-- FASTQ-Quality-Converter is part of the FASTX-toolkit, by A.Gordon (gordon@cshl.edu) -->
diff --git a/tools/fastx_toolkit/fastq_quality_filter.xml b/tools/fastx_toolkit/fastq_quality_filter.xml
index 06b87550fbb..94b30372b76 100644
--- a/tools/fastx_toolkit/fastq_quality_filter.xml
+++ b/tools/fastx_toolkit/fastq_quality_filter.xml
@@ -1,4 +1,4 @@
-<tool id="cshl_fastq_quality_filter" name="Quality Filter">
+<tool id="cshl_fastq_quality_filter" name="Filter by quality">
 	<description></description>
 
 	<command>zcat -f '$input' | fastq_quality_filter -q $quality -p $percent -v -o $output</command>
@@ -67,7 +67,11 @@ Using **percent = 90** and **cut-off = 30** - This read will be discarded (90% o
 
 Using **percent = 100** and **cut-off = 20** - This read will be discarded (not all cycles have quality equal to / higher than 20).
 
-	    
+------
+
+This tool is based on `FASTX-toolkit`__ by Assaf Gordon.
+
+ .. __: http://hannonlab.cshl.edu/fastx_toolkit/	    
 	</help>
 </tool>
 <!-- FASTQ-Quality-Filter is part of the FASTX-toolkit, by A.Gordon (gordon@cshl.edu) -->
diff --git a/tools/fastx_toolkit/fastq_to_fasta.xml b/tools/fastx_toolkit/fastq_to_fasta.xml
index 530857faa49..fcde683f6df 100644
--- a/tools/fastx_toolkit/fastq_to_fasta.xml
+++ b/tools/fastx_toolkit/fastq_to_fasta.xml
@@ -65,6 +65,11 @@ Will be converted to FASTA (with 'rename sequence names' = YES)::
     >1
     GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT
     
+------
+
+This tool is based on `FASTX-toolkit`__ by Assaf Gordon.
+
+ .. __: http://hannonlab.cshl.edu/fastx_toolkit/    
 </help>
 </tool>
 <!-- FASTQ-to-FASTA is part of the FASTX-toolkit, by A.Gordon (gordon@cshl.edu) -->
diff --git a/tools/fastx_toolkit/fastx_artifacts_filter.xml b/tools/fastx_toolkit/fastx_artifacts_filter.xml
index 2397f9652aa..8abb3dae300 100644
--- a/tools/fastx_toolkit/fastx_artifacts_filter.xml
+++ b/tools/fastx_toolkit/fastx_artifacts_filter.xml
@@ -1,9 +1,9 @@
-<tool id="cshl_fastx_artifacts_filter" name="Artifacts Filter">
+<tool id="cshl_fastx_artifacts_filter" name="Remove sequencing artifacts">
 	<description></description>
 	<command>zcat -f '$input' | fastx_artifacts_filter -v -o "$output"</command>
 
 	<inputs>
-		<param format="fasta,fastqsolexa" name="input" type="data" label="Library to filter" />
+		<param format="fasta,fastqsanger" name="input" type="data" label="Library to filter" />
 
 	</inputs>
 
@@ -74,7 +74,12 @@ This tool filters sequencing artifacts (reads with all but 3 identical bases).
     AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAAAAAAAAAAAAAAAAAAAAAAA
     AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAAAAAAAAAAAAAAA
     AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAAAAAAAAAAA
+    
+------
 
+This tool is based on `FASTX-toolkit`__ by Assaf Gordon.
+
+ .. __: http://hannonlab.cshl.edu/fastx_toolkit/
 </help>
 </tool>
 <!-- FASTX-Artifacts-filter is part of the FASTX-toolkit, by A.Gordon (gordon@cshl.edu) -->
diff --git a/tools/fastx_toolkit/fastx_nucleotides_distribution.xml b/tools/fastx_toolkit/fastx_nucleotides_distribution.xml
index 71fbc8f11e3..5ac05bd5dec 100644
--- a/tools/fastx_toolkit/fastx_nucleotides_distribution.xml
+++ b/tools/fastx_toolkit/fastx_nucleotides_distribution.xml
@@ -1,9 +1,9 @@
-<tool id="cshl_fastx_nucleotides_distribution" name="Nucleotides Distribution">
-	<description>chart</description>
+<tool id="cshl_fastx_nucleotides_distribution" name="Draw nucleotides distribution chart">
+	<description></description>
 	<command>fastx_nucleotide_distribution_graph.sh -t '$input.name' -i $input -o $output</command>
 	
 	<inputs>
-		<param format="txt" name="input" type="data" label="Statistics Text File (output of 'FASTX Statistics' tool)" />
+		<param format="txt" name="input" type="data" label="Statistics Text File" help="output of 'FASTX Statistics' tool" />
 	</inputs>
 	
 	<outputs>
@@ -23,44 +23,28 @@ Creates a stacked-histogram graph for the nucleotide distribution in the Solexa
 
 **Output Examples**
 
- 
- 
 The following chart clearly shows the barcode used at the 5'-end of the library: **GATCT**
 
 .. image:: ./static/fastx_icons/fastq_nucleotides_distribution_1.png
  
- 
- 
- 
-   
-
-
 In the following chart, one can almost 'read' the most abundant sequence by looking at the dominant values: **TGATA TCGTA TTGAT GACTG AA...**
 
 .. image:: ./static/fastx_icons/fastq_nucleotides_distribution_2.png
 
-
- 
- 
-   
- 
- 
-
 The following chart shows a growing number of unknown (N) nucleotides towards later cycles (which might indicate a sequencing problem):
 
 .. image:: ./static/fastx_icons/fastq_nucleotides_distribution_3.png
 
-
- 
- 
-   
- 
- 
-
 But most of the time, the chart will look rather random:
 
 .. image:: ./static/fastx_icons/fastq_nucleotides_distribution_4.png
 
+------
+
+This tool is based on `FASTX-toolkit`__ by Assaf Gordon.
+
+ .. __: http://hannonlab.cshl.edu/fastx_toolkit/
+
 </help>
 </tool>
 <!-- FASTQ-Nucleotides-Distribution is part of the FASTX-toolkit, by A.Gordon (gordon@cshl.edu) -->
diff --git a/tools/fastx_toolkit/fastx_quality_statistics.xml b/tools/fastx_toolkit/fastx_quality_statistics.xml
index 5ac9d9fd07b..d6f791a949d 100644
--- a/tools/fastx_toolkit/fastx_quality_statistics.xml
+++ b/tools/fastx_toolkit/fastx_quality_statistics.xml
@@ -1,4 +1,4 @@
-<tool id="cshl_fastx_quality_statistics" name="Quality Statistics">
+<tool id="cshl_fastx_quality_statistics" name="Compute quality statistics">
 	<description></description>
 	<command>zcat -f $input | fastx_quality_stats -o $output -Q $offset</command>
 
@@ -55,51 +55,20 @@ Creates quality statistics report for the given Solexa/FASTQ library.
 * N_Count = Count of 'N' nucleotides found in this column.  
 
 
+For example::
 
-
-
-
-**Output Example**::
-
-    column	count	min	max	sum	mean	Q1	med	Q3	IQR	lW	rW	A_Count	C_Count	G_Count	T_Count	N_Count
-    1	6362991	-4	40	250734117	39.41	40	40	40	0	40	40	1396976	1329101	678730	2958184	0
-    2	6362991	-5	40	250531036	39.37	40	40	40	0	40	40	1786786	1055766	1738025	1782414	0
-    3	6362991	-5	40	248722469	39.09	40	40	40	0	40	40	2296384	984875	1443989	1637743	0
-    4	6362991	-5	40	247654797	38.92	40	40	40	0	40	40	1683197	1410855	1722633	1546306	0
-    5	6362991	-4	40	248214827	39.01	40	40	40	0	40	40	2536861	1167423	1248968	1409739	0
-    6	6362991	-5	40	248499903	39.05	40	40	40	0	40	40	1598956	1236081	1568608	1959346	0
-    7	6362991	-4	40	247719760	38.93	40	40	40	0	40	40	1692667	1822140	1496741	1351443	0
-    8	6362991	-5	40	245745205	38.62	40	40	40	0	40	40	2230936	1343260	1529928	1258867	0
-    9	6362991	-5	40	245766735	38.62	40	40	40	0	40	40	1702064	1306257	1336511	2018159	0
-    10	6362991	-5	40	245089706	38.52	40	40	40	0	40	40	1519917	1446370	1450995	1945709	0
-    11	6362991	-5	40	242641359	38.13	40	40	40	0	40	40	1717434	1282975	1387804	1974778	0
-    12	6362991	-5	40	242026113	38.04	40	40	40	0	40	40	1662872	1202041	1519721	1978357	0
-    13	6362991	-5	40	238704245	37.51	40	40	40	0	40	40	1549965	1271411	1973291	1566681	1643
-    14	6362991	-5	40	235622401	37.03	40	40	40	0	40	40	2101301	1141451	1603990	1515774	475
-    15	6362991	-5	40	230766669	36.27	40	40	40	0	40	40	2344003	1058571	1440466	1519865	86
-    16	6362991	-5	40	224466237	35.28	38	40	40	2	35	40	2203515	1026017	1474060	1651582	7817
-    17	6362991	-5	40	219990002	34.57	34	40	40	6	25	40	1522515	1125455	2159183	1555765	73
-    18	6362991	-5	40	214104778	33.65	30	40	40	10	15	40	1479795	2068113	1558400	1249337	7346
-    19	6362991	-5	40	212934712	33.46	30	40	40	10	15	40	1432749	1231352	1769799	1920093	8998
-    20	6362991	-5	40	212787944	33.44	29	40	40	11	13	40	1311657	1411663	2126316	1513282	73
-    21	6362991	-5	40	211369187	33.22	28	40	40	12	10	40	1887985	1846300	1300326	1318380	10000
-    22	6362991	-5	40	213371720	33.53	30	40	40	10	15	40	542299	3446249	516615	1848190	9638
-    23	6362991	-5	40	221975899	34.89	36	40	40	4	30	40	347679	1233267	926621	3855355	69
-    24	6362991	-5	40	194378421	30.55	21	40	40	19	-5	40	433560	674358	3262764	1992242	67
-    25	6362991	-5	40	199773985	31.40	23	40	40	17	-2	40	944760	325595	1322800	3769641	195
-    26	6362991	-5	40	179404759	28.20	17	34	40	23	-5	40	3457922	156013	1494664	1254293	99
-    27	6362991	-5	40	163386668	25.68	13	28	40	27	-5	40	1392177	281250	3867895	821491	178
-    28	6362991	-5	40	156230534	24.55	12	25	40	28	-5	40	907189	981249	4174945	299437	171
-    29	6362991	-5	40	163236046	25.65	13	28	40	27	-5	40	1097171	3418678	1567013	280008	121
-    30	6362991	-5	40	151309826	23.78	12	23	40	28	-5	40	3514775	2036194	566277	245613	132
-    31	6362991	-5	40	141392520	22.22	10	21	40	30	-5	40	1569000	4571357	124732	97721	181
-    32	6362991	-5	40	143436943	22.54	10	21	40	30	-5	40	1453607	4519441	38176	351107	660
-    33	6362991	-5	40	114269843	17.96	6	14	30	24	-5	40	3311001	2161254	155505	734297	934
-    34	6362991	-5	40	140638447	22.10	10	20	40	30	-5	40	1501615	1637357	18113	3205237	669
-    35	6362991	-5	40	138910532	21.83	10	20	40	30	-5	40	1532519	3495057	23229	1311834	352
-    36	6362991	-5	40	117158566	18.41	7	15	30	23	-5	40	4074444	1402980	63287	822035	245
+     1  6362991 -4 40 250734117 39.41 40 40 40  0 40 40 1396976 1329101  678730 2958184   0
+     2  6362991 -5 40 250531036 39.37 40 40 40  0 40 40 1786786 1055766 1738025 1782414   0
+     3  6362991 -5 40 248722469 39.09 40 40 40  0 40 40 2296384  984875 1443989 1637743   0
+     4  6362991 -4 40 248214827 39.01 40 40 40  0 40 40 2536861 1167423 1248968 1409739   0
+    36  6362991 -5 40 117158566 18.41  7 15 30 23 -5 40 4074444 1402980   63287  822035 245
     
+------
+
+This tool is based on `FASTX-toolkit`__ by Assaf Gordon.
+
+ .. __: http://hannonlab.cshl.edu/fastx_toolkit/
 
 </help>
-</tool>
+ </tool>
 <!-- FASTQ-Statistics is part of the FASTX-toolkit, by A.Gordon (gordon@cshl.edu) -->
diff --git a/tools/fastx_toolkit/fastx_renamer.xml b/tools/fastx_toolkit/fastx_renamer.xml
index a47bde3a6b7..50497e663bc 100644
--- a/tools/fastx_toolkit/fastx_renamer.xml
+++ b/tools/fastx_toolkit/fastx_renamer.xml
@@ -1,5 +1,5 @@
-<tool id="cshl_fastx_renamer" name="Rename" version="0.0.11" >
-	<description>sequence identifiers</description>
+<tool id="cshl_fastx_renamer" name="Rename sequences" version="0.0.11" >
+	<description></description>
 	<command>zcat -f $input | fastx_renamer -n $TYPE -o $output -v </command>
 
 	<inputs>
@@ -50,7 +50,11 @@ Renamed to **numeric counter**::
     +1
     40 40 40 40 40 40 40 40 40 40 38 40 40 40 40 40 14 40 40 40 40 40 36 40 13 14 24 24 9 24 9 40 10 10 15 40
 
-    
+------
+
+This tool is based on `FASTX-toolkit`__ by Assaf Gordon.
+
+ .. __: http://hannonlab.cshl.edu/fastx_toolkit/   
 </help>
 </tool>
 <!-- FASTQ-to-FASTA is part of the FASTX-toolkit, by A.Gordon (gordon@cshl.edu) -->
diff --git a/tools/fastx_toolkit/fastx_reverse_complement.xml b/tools/fastx_toolkit/fastx_reverse_complement.xml
index a4321eb846d..f638635dc75 100644
--- a/tools/fastx_toolkit/fastx_reverse_complement.xml
+++ b/tools/fastx_toolkit/fastx_reverse_complement.xml
@@ -1,5 +1,5 @@
 <tool id="cshl_fastx_reverse_complement" name="Reverse-Complement">
-	<description>sequences</description>
+	<description></description>
 	<command>zcat -f '$input' | fastx_reverse_complement -v -o $output</command>
 	<inputs>
 		<param format="fasta,fastqsolexa" name="input" type="data" label="Library to reverse-complement" />
@@ -47,6 +47,11 @@ Output FASTQ file::
     TACCNNCTTTGAATTACAAGGANGAGGCTACAGACA
     +CSHL_1_FC42AGWWWXX:8:1:3:740
     26 27 17 15 5 5 24 26 29 31 32 33 27 21 27 33 33 33 33 33 33 27 5 27 33 33 33 33 33 33 33 33 34 33 33 33
+------
 
+This tool is based on `FASTX-toolkit`__ by Assaf Gordon.
+
+ .. __: http://hannonlab.cshl.edu/fastx_toolkit/
+ 
 </help>
 </tool>
diff --git a/tools/fastx_toolkit/fastx_trimmer.xml b/tools/fastx_toolkit/fastx_trimmer.xml
index 96d5e16c9db..3bd68a1806d 100644
--- a/tools/fastx_toolkit/fastx_trimmer.xml
+++ b/tools/fastx_toolkit/fastx_trimmer.xml
@@ -1,9 +1,9 @@
-<tool id="cshl_fastx_trimmer" name="Trim">
-	<description>sequences</description>
+<tool id="cshl_fastx_trimmer" name="Trim sequences">
+	<description></description>
 	<command>zcat -f '$input' | fastx_trimmer -v -f $first -l $last -o $output</command>
 
 	<inputs>
-		<param format="fasta,fastqsolexa" name="input" type="data" label="Library to clip" />
+		<param format="fasta,fastasanger" name="input" type="data" label="Library to clip" />
 
 		<param name="first" size="4" type="integer" value="1">
 			<label>First base to keep</label>
@@ -65,6 +65,12 @@ Trimming with First=6 and Last=10, will generate a FASTA file with 5 bases (base
     >2-1
     AGGCT
     
+    ------
+
+This tool is based on `FASTX-toolkit`__ by Assaf Gordon.
+
+ .. __: http://hannonlab.cshl.edu/fastx_toolkit/
+    
 </help>
 </tool>
 <!-- FASTX-Trimmer is part of the FASTX-toolkit, by A.Gordon (gordon@cshl.edu) -->
diff --git a/tools/metag_tools/short_reads_figure_score.xml b/tools/metag_tools/short_reads_figure_score.xml
index 42f7d4602b3..c7a5baa24e6 100644
--- a/tools/metag_tools/short_reads_figure_score.xml
+++ b/tools/metag_tools/short_reads_figure_score.xml
@@ -1,5 +1,5 @@
-<tool id="quality_score_distribution" name="Build distribution of base quality">
-<description>values</description>
+<tool id="quality_score_distribution" name="Build base quality distribution">
+<description></description>
 
 <command interpreter="python">short_reads_figure_score.py $input1 $output1 </command>
 
diff --git a/tools/metag_tools/short_reads_trim_seq.xml b/tools/metag_tools/short_reads_trim_seq.xml
index 824c022744c..b28337e447c 100644
--- a/tools/metag_tools/short_reads_trim_seq.xml
+++ b/tools/metag_tools/short_reads_trim_seq.xml
@@ -1,5 +1,5 @@
 <tool id="trim_reads" name="Select high quality segments" version="1.0.0">
-<description>from short reads</description>
+<description></description>
 
 <command interpreter="python">
  short_reads_trim_seq.py $trim $length $output1 $input1 $input2 $sequencing_method_choice.input3
diff --git a/tools/metag_tools/split_paired_reads.xml b/tools/metag_tools/split_paired_reads.xml
index 5595e71dad9..58b6408bb43 100644
--- a/tools/metag_tools/split_paired_reads.xml
+++ b/tools/metag_tools/split_paired_reads.xml
@@ -1,5 +1,5 @@
-<tool id="split_paired_reads" name="Split" version="1.0.0">
-  <description>paired-end reads into two ends</description>
+<tool id="split_paired_reads" name="Split paired end reads" version="1.0.0">
+  <description></description>
   <command interpreter="python">
     split_paired_reads.py $input $output1 $output2
   </command>
diff --git a/tools/solid_tools/solid_qual_boxplot.xml b/tools/solid_tools/solid_qual_boxplot.xml
index d6bcd614ff5..c208de6bb62 100644
--- a/tools/solid_tools/solid_qual_boxplot.xml
+++ b/tools/solid_tools/solid_qual_boxplot.xml
@@ -1,4 +1,4 @@
-<tool id="solid_qual_boxplot" name="Quality Boxplot" version="1.0.0">
+<tool id="solid_qual_boxplot" name="Draw quality score boxplot" version="1.0.0">
 	<description>for SOLiD data</description>
 	
 	<command interpreter="bash">qualsolid_boxplot_graph.sh -t '$input.name' -i $input -o $output</command>
@@ -31,6 +31,10 @@ Creates a boxplot graph for the quality scores in the library.
 
 .. image:: ../static/images/solid_qual.png
 
+------
 
+This tool is based on `FASTX-toolkit`__ by Assaf Gordon.
+
+ .. __: http://hannonlab.cshl.edu/fastx_toolkit/
 </help>
 </tool>
diff --git a/tools/solid_tools/solid_qual_stats.xml b/tools/solid_tools/solid_qual_stats.xml
index 50d952055a1..caf8816d9ee 100644
--- a/tools/solid_tools/solid_qual_stats.xml
+++ b/tools/solid_tools/solid_qual_stats.xml
@@ -1,4 +1,4 @@
-<tool id="solid_qual_stats" name="Quality Statistics" version="1.0.0">
+<tool id="solid_qual_stats" name="Compute quality statistics" version="1.0.0">
     <description>for SOLiD data</description>
     <command interpreter="python">solid_qual_stats.py $input $output1</command>
 
@@ -60,6 +60,10 @@ Creates quality statistics report for the given SOLiD quality score file.
     34  6362991 2  29  140638447   12.10   3  10  25  22  2  29
     35  6362991 2  29  138910532   11.83   3  10  25  22  2  29
     
+------
 
+This tool is based on `FASTX-toolkit`__ by Assaf Gordon.
+
+ .. __: http://hannonlab.cshl.edu/fastx_toolkit/
 </help>
 </tool>
diff --git a/tools/sr_mapping/bowtie_wrapper.xml b/tools/sr_mapping/bowtie_wrapper.xml
index 8d9761678f0..165c606c14b 100644
--- a/tools/sr_mapping/bowtie_wrapper.xml
+++ b/tools/sr_mapping/bowtie_wrapper.xml
@@ -1,5 +1,5 @@
-<tool id="bowtie_wrapper" name="Bowtie" version="1.0.0">
-  <description> fast alignment of reads against reference sequence </description>
+<tool id="bowtie_wrapper" name="Map with Bowtie" version="1.0.0">
+  <description></description>
   <command interpreter="python">
     bowtie_wrapper.py 
     --threads="8"
@@ -148,7 +148,7 @@
         <option value="history">Use one from the history</option>
       </param>
       <when value="indexed">
-    	<param name="indices" type="select" label="Select a reference genome">
+    	<param name="indices" type="select" label="Select a reference genome" help="if your genome of interest is not listed - contact Galaxy team">
   	      <options from_file="bowtie_indices.loc">
   	        <column name="value" index="1" />
   	        <column name="name" index="0" />
@@ -215,7 +215,7 @@
         <option value="paired">Paired-end</option>
       </param>
       <when value="single">
-        <param name="input1" type="data" format="fastqsanger" label="FASTQ file" />
+        <param name="input1" type="data" format="fastqsanger" label="FASTQ file" help="Must have Sanger-scaled quality values with ASCII offset 33"/>
         <conditional name="params">
           <param name="settings_type" type="select" label="Bowtie settings to use" help="For most mapping needs use Commonly used settings. If you want full control use Full parameter list">
 		    <option value="pre_set">Commonly used</option>
@@ -272,8 +272,8 @@
         </conditional> <!-- params -->
       </when> <!-- single -->
       <when value="paired">
-        <param name="input1" type="data" format="fastqsanger" label="Forward FASTQ file" />
-        <param name="input2" type="data" format="fastqsanger" label="Reverse FASTQ file" />
+        <param name="input1" type="data" format="fastqsanger" label="Forward FASTQ file" help="Must have Sanger-scaled quality values with ASCII offset 33"/>
+        <param name="input2" type="data" format="fastqsanger" label="Reverse FASTQ file" help="Must have Sanger-scaled quality values with ASCII offset 33"/>
         <conditional name="params">
           <param name="settings_type" type="select" label="Bowtie settings to use" help="For most mapping needs use Commonly used settings. If you want full control use Full parameter list">
 		    <option value="pre_set">Commonly used</option>
diff --git a/tools/sr_mapping/bwa_wrapper.xml b/tools/sr_mapping/bwa_wrapper.xml
index 021f367145a..42754a4e597 100644
--- a/tools/sr_mapping/bwa_wrapper.xml
+++ b/tools/sr_mapping/bwa_wrapper.xml
@@ -1,5 +1,5 @@
-<tool id="bwa_wrapper" name="BWA" version="1.0.1">
-  <description> fast mapping of reads against reference sequence</description>
+<tool id="bwa_wrapper" name="Map with BWA" version="1.0.1">
+  <description></description>
   <command interpreter="python">
     bwa_wrapper.py 
     --threads="8"
@@ -76,7 +76,7 @@
 	        <option value="history">Use one from the history</option>
 	      </param>
 	      <when value="indexed">
- 	    	<param name="indices" type="select" label="Select a reference genome">
+ 	    	<param name="indices" type="select" label="Select a reference genome" help="if your genome of interest is not listed - contact Galaxy team">
  	  	      <options from_file="sequence_index_color.loc">
   	  	        <column name="value" index="1" />
 	  	        <column name="name" index="0" />
@@ -116,11 +116,11 @@
         <option value="paired">Paired-end</option>
       </param>
       <when value="single">
-        <param name="input1" type="data" format="fastqsanger" label="FASTQ file" />
+        <param name="input1" type="data" format="fastqsanger" label="FASTQ file" help="Must have Sanger-scaled quality values with ASCII offset 33"/>
       </when>
       <when value="paired">
-        <param name="input1" type="data" format="fastqsanger" label="Forward FASTQ file" />
-        <param name="input2" type="data" format="fastqsanger" label="Reverse FASTQ file" />
+        <param name="input1" type="data" format="fastqsanger" label="Forward FASTQ file" help="Must have Sanger-scaled quality values with ASCII offset 33"/>
+        <param name="input2" type="data" format="fastqsanger" label="Reverse FASTQ file" help="Must have Sanger-scaled quality values with ASCII offset 33"/>
       </when>
     </conditional>	
     <conditional name="params">