A bit of cleanup, added FASTQ to FASTA converted to tool_conf.xml.sample.

lib/galaxy/datatypes/sequence.py

@@ -103,10 +103,14 @@ class Fastq( Sequence ):
     def set_peek( self, dataset ):
         Sequence.set_peek( self, dataset )
         sequences = 0
+        scores = 0
         for line in file( dataset.file_name ):
-            if line and line.startswith( "@" ):
-                sequences += 1
-        dataset.blurb = '%d sequences' % sequences
+            if line:
+                if line.startswith( "@" ):
+                    sequences += 1
+                elif line.startswith( '+' ):
+                    scores += 1
+        dataset.blurb = '%d sequences, %d quality scores' % ( sequences, scores )
 
 try:
     import pkg_resources; pkg_resources.require( "bx-python" )

tool_conf.xml.sample

@@ -59,6 +59,7 @@
     <tool file="filters/axt_to_lav.xml" />
     <tool file="filters/bed2gff.xml" />
     <tool file="fasta_tools/fasta_to_tabular.xml" />
+    <tool file="metag_tools/convert_fastq2fasta.xml" />
     <tool file="filters/gff2bed.xml" />
     <tool file="filters/lav_to_bed.xml" />
     <tool file="maf/maf_to_bed.xml" />
@@ -117,6 +118,7 @@
     <tool file="visualization/GMAJ.xml" />
     <tool file="visualization/LAJ.xml" />
     <tool file="visualization/build_ucsc_custom_track.xml" />
+    <tool file="visualization/build_gbrowse_custom_track.xml" />
   </section>
   <section name="Regional Variation" id="regVar">
     <tool file="regVariation/windowSplitter.xml" />

tools/metag_tools/convert_fastq2fasta.xml

@@ -1,8 +1,6 @@
-<tool id="convert_fastq2fasta" name="Convert fastq" version="1.0.0">
-    <description></description>
-    <command interpreter="python">
-    convert_fastq2fasta.py $input1 $output1 $output2 
-    </command>
+<tool id="convert_fastq2fasta" name="FASTQ-to-FASTA" version="1.0.0">
+    <description>converts FASTQ file to FASTA format</description>
+    <command interpreter="python">convert_fastq2fasta.py $input1 $output1 $output2</command>
     <inputs>
         <param name="input1" type="data" format="fastq" label="Fastq file"/>
     </inputs>
@@ -15,13 +13,13 @@
     
 **What it does**
 
-This tool converts Solexa fastq files and returns two files: reads and quality scores, both in fasta-like format.   
+This tool converts Solexa FASTQ data to FASTA format by generating 2 files, reads and quality scores.   
 
 -----
 
 **Example1**
 
-- Solexa fastq format::
+- Converting the following Solexa fastq data::
 
     @seq1  
     GACAGCTTGGTTTTTAGTGAGTTGTTCCTTTCTTT  
@@ -32,7 +30,7 @@ This tool converts Solexa fastq files and returns two files: reads and quality s
     +seq2  
     hhhhhhhhhhhhhhYhhahhhhWhAhFhSIJGChO
 
-- Extract the sequences::
+- will extract the following sequences::
 
     &gt;seq1
     GACAGCTTGGTTTTTAGTGAGTTGTTCCTTTCTTT
@@ -49,7 +47,7 @@ This tool converts Solexa fastq files and returns two files: reads and quality s
 
 **Example2**
 
-- Solexa fastq format::
+- Converting the following Solexa fastq data::
 
     @seq1
     GAATTGATCAGGACATAGGACAACTGTAGGCACCAT
@@ -60,7 +58,7 @@ This tool converts Solexa fastq files and returns two files: reads and quality s
     +seq2
     40 15 40 17 6 36 40 40 40 25 40 9 35 33 40 14 14 18 15 17 19 28 31 4 24 18 27 14 15 18 2 8 12 8 11 9
 
-- Extract the sequences::
+- will extract the following sequences::
 
     &gt;seq1
     GAATTGATCAGGACATAGGACAACTGTAGGCACCAT