From 051dc9ca94619bff2ecb489cb5f211423f7c5ec2 Mon Sep 17 00:00:00 2001
From: Greg Von Kuster <greg@bx.psu.edu>
Date: Tue, 27 May 2008 19:59:33 +0000
Subject: [PATCH] A bit of cleanup, added FASTQ to FASTA converted to
 tool_conf.xml.sample.

---
 lib/galaxy/datatypes/sequence.py          | 10 +++++++---
 tool_conf.xml.sample                      |  2 ++
 tools/metag_tools/convert_fastq2fasta.xml | 18 ++++++++----------
 3 files changed, 17 insertions(+), 13 deletions(-)

diff --git a/lib/galaxy/datatypes/sequence.py b/lib/galaxy/datatypes/sequence.py
index c7c40f1b65e..3e662e7c52c 100644
--- a/lib/galaxy/datatypes/sequence.py
+++ b/lib/galaxy/datatypes/sequence.py
@@ -103,10 +103,14 @@ class Fastq( Sequence ):
     def set_peek( self, dataset ):
         Sequence.set_peek( self, dataset )
         sequences = 0
+        scores = 0
         for line in file( dataset.file_name ):
-            if line and line.startswith( "@" ):
-                sequences += 1
-        dataset.blurb = '%d sequences' % sequences
+            if line:
+                if line.startswith( "@" ):
+                    sequences += 1
+                elif line.startswith( '+' ):
+                    scores += 1
+        dataset.blurb = '%d sequences, %d quality scores' % ( sequences, scores )
 
 try:
     import pkg_resources; pkg_resources.require( "bx-python" )
diff --git a/tool_conf.xml.sample b/tool_conf.xml.sample
index 8af983a9618..6f1496f35ac 100644
--- a/tool_conf.xml.sample
+++ b/tool_conf.xml.sample
@@ -59,6 +59,7 @@
     <tool file="filters/axt_to_lav.xml" />
     <tool file="filters/bed2gff.xml" />
     <tool file="fasta_tools/fasta_to_tabular.xml" />
+    <tool file="metag_tools/convert_fastq2fasta.xml" />
     <tool file="filters/gff2bed.xml" />
     <tool file="filters/lav_to_bed.xml" />
     <tool file="maf/maf_to_bed.xml" />
@@ -117,6 +118,7 @@
     <tool file="visualization/GMAJ.xml" />
     <tool file="visualization/LAJ.xml" />
     <tool file="visualization/build_ucsc_custom_track.xml" />
+    <tool file="visualization/build_gbrowse_custom_track.xml" />
   </section>
   <section name="Regional Variation" id="regVar">
     <tool file="regVariation/windowSplitter.xml" />
diff --git a/tools/metag_tools/convert_fastq2fasta.xml b/tools/metag_tools/convert_fastq2fasta.xml
index 5d3d84d269e..0a9185bc886 100644
--- a/tools/metag_tools/convert_fastq2fasta.xml
+++ b/tools/metag_tools/convert_fastq2fasta.xml
@@ -1,8 +1,6 @@
-<tool id="convert_fastq2fasta" name="Convert fastq" version="1.0.0">
-    <description></description>
-    <command interpreter="python">
-    convert_fastq2fasta.py $input1 $output1 $output2 
-    </command>
+<tool id="convert_fastq2fasta" name="FASTQ-to-FASTA" version="1.0.0">
+    <description>converts FASTQ file to FASTA format</description>
+    <command interpreter="python">convert_fastq2fasta.py $input1 $output1 $output2</command>
     <inputs>
         <param name="input1" type="data" format="fastq" label="Fastq file"/>
     </inputs>
@@ -15,13 +13,13 @@
     
 **What it does**
 
-This tool converts Solexa fastq files and returns two files: reads and quality scores, both in fasta-like format.   
+This tool converts Solexa FASTQ data to FASTA format by generating 2 files, reads and quality scores.   
 
 -----
 
 **Example1**
 
-- Solexa fastq format::
+- Converting the following Solexa fastq data::
 
     @seq1  
     GACAGCTTGGTTTTTAGTGAGTTGTTCCTTTCTTT  
@@ -32,7 +30,7 @@ This tool converts Solexa fastq files and returns two files: reads and quality s
     +seq2  
     hhhhhhhhhhhhhhYhhahhhhWhAhFhSIJGChO
 
-- Extract the sequences::
+- will extract the following sequences::
 
     &gt;seq1
     GACAGCTTGGTTTTTAGTGAGTTGTTCCTTTCTTT
@@ -49,7 +47,7 @@ This tool converts Solexa fastq files and returns two files: reads and quality s
 
 **Example2**
 
-- Solexa fastq format::
+- Converting the following Solexa fastq data::
 
     @seq1
     GAATTGATCAGGACATAGGACAACTGTAGGCACCAT
@@ -60,7 +58,7 @@ This tool converts Solexa fastq files and returns two files: reads and quality s
     +seq2
     40 15 40 17 6 36 40 40 40 25 40 9 35 33 40 14 14 18 15 17 19 28 31 4 24 18 27 14 15 18 2 8 12 8 11 9
 
-- Extract the sequences::
+- will extract the following sequences::
 
     &gt;seq1
     GAATTGATCAGGACATAGGACAACTGTAGGCACCAT