mirror of
https://github.com/galaxyproject/galaxy.git
synced 2026-10-16 15:45:04 +08:00
68 lines
3.1 KiB
XML
68 lines
3.1 KiB
XML
<tool id="Extract blastz alignments1" name="Extract blastz alignments">
|
|
<description>between query genome and another genome</description>
|
|
<command interpreter="perl">extractAxt_wrapper.pl -i $input -o $out_file1 --species $species -g $dbkey $input_chromCol $input_startCol $input_endCol $input_strandCol</command>
|
|
<inputs>
|
|
<param format="interval" name="input" type="data" label="Between regions of Query"/>
|
|
<param name="species" type="select" label="and one of these genomes">
|
|
<options from_file="/depot/data2/galaxy/alignseq.loc" >
|
|
<filter type="data_meta" data_ref="input" key="build" />
|
|
<filter type="column" name="build_col" value="0" />
|
|
<filter type="column" name="name_col" value="1" />
|
|
<filter type="column" name="value_col" value="2" />
|
|
</options>
|
|
</param>
|
|
</inputs>
|
|
<outputs>
|
|
<data format="axt" name="out_file1" />
|
|
</outputs>
|
|
<tests>
|
|
<test>
|
|
<param name="input" value="1.bed" dbkey="hg17" ftype="bed" />
|
|
<param name="species" value="musMus6"/>
|
|
<output name="out_file1" file="fsa_extract_blastz_alignments.dat" />
|
|
</test>
|
|
</tests>
|
|
<help>
|
|
|
|
.. class:: warningmark
|
|
|
|
**IMPORTANT**: AXT formatted alignments will be phased out from Galaxy in the coming weeks. They will be replaced with pairwise MAF alignments, which are already available. To try pairwise MAF alignments use "Extract Pairwise MAF blocks" tool in *Fetch Sequences and Alignments* section.
|
|
|
|
--------
|
|
|
|
|
|
.. class:: infomark
|
|
|
|
**TIP:** The last field of the axt header is the same as the column 4 (name) of the corresponding BED file. *This is very useful* for establishing correspondence between alignments and the original BED file.
|
|
|
|
-----
|
|
|
|
**Syntax**
|
|
|
|
This tool uses coordinates specified in the query to extract alignments, which is pre-computed blastZ output. Alignments are in the axt format as shown below.
|
|
|
|
- **blastz alignments** Blastz alignment program is available from Webb Miller's lab at Penn State University (http://www.bx.psu.edu/miller_lab/).
|
|
- **AXT format** The alignments are produced from Blastz. The lav format Blastz output, which does not include the sequence, was converted to AXT format with lavToAxt. Each alignment block in an AXT file contains three lines: a summary line and 2 sequence lines. Blocks are separated from one another by blank lines.
|
|
|
|
-----
|
|
|
|
**Example**
|
|
|
|
- Input file::
|
|
|
|
chr7 127486022 127486166 NM_000230 0 +
|
|
chr7 127486011 127486166 D49487 0 +
|
|
|
|
- Extract the hg17 and mm5 assemblies blastZ alignments of the above file::
|
|
|
|
0 chr7 127475282 127475310 chr6 28912408 28912436 + 53096 NM_000230
|
|
GTAGGAATCGCAGCGCCAGCGGTTGCAAG
|
|
GGAGGGATCCCTGCTCCAGCAGCTGCAAG
|
|
|
|
1 chr7 127486012 127486166 chr6 28921129 28921283 + 61453 D49487
|
|
TGGGAAGGAAAATGCATTGGGGAACCCTGTGCGGATTCTTGTGGCTTTGGCCCTATCTTTTCTATGTCCAAGCTGTGCCCATCCAAAAAGTCCAAGATGACACCAAAACCCTCATCAAGACAATTGTCACCAGGATCAATGACATTTCACACACG
|
|
CAGGGAGGAAAATGTGCTGGAGACCCCTGTGTCGGTTCCTGTGGCTTTGGTCCTATCTGTCTTATGTTCAAGCAGTGCCTATCCAGAAAGTCCAGGATGACACCAAAACCCTCATCAAGACCATTGTCACCAGGATCAATGACATTTCACACACG
|
|
|
|
</help>
|
|
</tool>
|