mirror of
https://github.com/galaxyproject/galaxy.git
synced 2026-09-19 10:40:23 +08:00
666 lines
20 KiB
HTML
666 lines
20 KiB
HTML
<!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.01 Transitional//EN"
|
|
"http://www.w3.org/TR/html4/loose.dtd">
|
|
<html>
|
|
<head>
|
|
<title>Galaxy Data Formats</title>
|
|
<meta http-equiv="Content-Type" content="text/html; charset=utf-8">
|
|
<meta http-equiv="Content-Style-Type" content="text/css">
|
|
<style type="text/css">
|
|
hr { margin-top: 3ex; margin-bottom: 1ex; border: 1px inset }
|
|
</style>
|
|
</head>
|
|
<body>
|
|
<h2>Galaxy Data Formats</h2>
|
|
<p>
|
|
<br>
|
|
|
|
<h3>Dataset missing?</h3>
|
|
<p>
|
|
If you have a dataset in your history that is not appearing in the
|
|
drop-down selector for a tool, the most common reason is that it has
|
|
the wrong format. Each Galaxy dataset has an associated file format
|
|
recorded in its metadata, and tools will only list datasets from your
|
|
history that have a format compatible with that particular tool. Of
|
|
course some of these datasets might not actually contain relevant
|
|
data, or even the correct columns needed by the tool, but filtering
|
|
by format at least makes the list to select from a bit shorter.
|
|
<p>
|
|
Some of the formats are defined hierarchically, going from very
|
|
general ones like <a href="#tab">Tabular</a> (which includes any text
|
|
file with tab-separated columns), to more restrictive sub-formats
|
|
like <a href="#interval">Interval</a> (where three of the columns
|
|
must be the chromosome, start position, and end position), and on
|
|
to even more specific ones such as <a href="#bed">BED</a> that have
|
|
additional requirements. So for example if a tool's required input
|
|
format is Tabular, then all of your history items whose format is
|
|
recorded as Tabular will be listed, along with those in all
|
|
sub-formats that also qualify as Tabular (Interval, BED, GFF, etc.).
|
|
<p>
|
|
There are two usual methods for changing a dataset's format in
|
|
Galaxy: if the file contents are already in the required format but
|
|
the metadata is wrong (perhaps because the Auto-detect feature of the
|
|
Upload File tool guessed it incorrectly), you can fix the metadata
|
|
manually by clicking on the pencil icon beside that dataset in your
|
|
history. Or, if the file contents really are in a different format,
|
|
Galaxy provides a number of format conversion tools (e.g. in the
|
|
Text Manipulation and Convert Formats categories). For instance,
|
|
if the tool you want to run requires Tabular but your columns are
|
|
delimited by spaces or commas, you can use the "Convert delimiters
|
|
to TAB" tool under Text Manipulation to reformat your data. However
|
|
if your files are in a completely unsupported format, then you need
|
|
to convert them yourself before uploading.
|
|
<p>
|
|
<hr>
|
|
|
|
<h3>Format Descriptions</h3>
|
|
<ul>
|
|
<li><a href="#ab1">AB1</a>
|
|
<li><a href="#axt">AXT</a>
|
|
<li><a href="#bam">BAM</a>
|
|
<li><a href="#bed">BED</a>
|
|
<li><a href="#bedgraph">BedGraph</a>
|
|
<li><a href="#binseq">Binseq.zip</a>
|
|
<li><a href="#fasta">FASTA</a>
|
|
<li><a href="#fastqsolexa">FastqSolexa</a>
|
|
<li><a href="#fped">FPED</a>
|
|
<li><a href="#gd_indivs">gd_indivs</a>
|
|
<li><a href="#gd_ped">gd_ped</a>
|
|
<li><a href="#gd_sap">gd_sap</a>
|
|
<li><a href="#gd_snp">gd_snp</a>
|
|
<li><a href="#gff">GFF</a>
|
|
<li><a href="#gff3">GFF3</a>
|
|
<li><a href="#gtf">GTF</a>
|
|
<li><a href="#html">HTML</a>
|
|
<li><a href="#interval">Interval</a>
|
|
<li><a href="#lav">LAV</a>
|
|
<li><a href="#lped">LPED</a>
|
|
<li><a href="#maf">MAF</a>
|
|
<li><a href="#mastervar">MasterVar</a>
|
|
<li><a href="#pbed">PBED</a>
|
|
<li><a href="#pgSnp">pgSnp</a>
|
|
<li><a href="#psl">PSL</a>
|
|
<li><a href="#scf">SCF</a>
|
|
<li><a href="#sff">SFF</a>
|
|
<li><a href="#table">Table</a>
|
|
<li><a href="#tab">Tabular</a>
|
|
<li><a href="#txtseqzip">Txtseq.zip</a>
|
|
<li><a href="#vcf">VCF</a>
|
|
<li><a href="#wig">Wiggle custom track</a>
|
|
<li><a href="#text">Other text type</a>
|
|
</ul>
|
|
<p>
|
|
|
|
<div><a name="ab1"></a></div>
|
|
<hr>
|
|
<strong>AB1</strong>
|
|
<p>
|
|
This is one of the ABIF family of binary sequence formats from
|
|
Applied Biosystems Inc.
|
|
<!-- Their PDF
|
|
<a href="http://www.appliedbiosystems.com/support/software_community/ABIF_File_Format.pdf"
|
|
>format specification</a> is unfortunately password-protected. -->
|
|
Files should have a '<code>.ab1</code>' file extension. You must
|
|
manually select this file format when uploading the file.
|
|
<p>
|
|
|
|
<div><a name="axt"></a></div>
|
|
<hr>
|
|
<strong>AXT</strong>
|
|
<p>
|
|
Used for pairwise alignment output from BLASTZ, after post-processing.
|
|
Each alignment block contains three lines: a summary line and two
|
|
sequence lines. Blocks are separated from one another by blank lines.
|
|
The summary line contains chromosomal position and size information
|
|
about the alignment, and consists of nine required fields.
|
|
<a href="http://main.genome-browser.bx.psu.edu/goldenPath/help/axt.html"
|
|
>More information</a>
|
|
<!-- (not available on Main)
|
|
<dl><dt>Can be converted to:
|
|
<dd><ul>
|
|
<li>FASTA<br>
|
|
Convert Formats → AXT to FASTA
|
|
<li>LAV<br>
|
|
Convert Formats → AXT to LAV
|
|
</ul></dl>
|
|
-->
|
|
<p>
|
|
|
|
<div><a name="bam"></a></div>
|
|
<hr>
|
|
<strong>BAM</strong>
|
|
<p>
|
|
A binary alignment file compressed in the BGZF format with a
|
|
'<code>.bam</code>' file extension.
|
|
<!-- You must manually select this file format when uploading the file. -->
|
|
<a href="http://samtools.sourceforge.net/SAM1.pdf">SAM</a>
|
|
is the human-readable text version of this format.
|
|
<dl><dt>Can be converted to:
|
|
<dd><ul>
|
|
<li>SAM<br>
|
|
NGS: SAM Tools → BAM-to-SAM
|
|
<li>Pileup<br>
|
|
NGS: SAM Tools → Generate pileup
|
|
<li>Interval<br>
|
|
First convert to Pileup as above, then use
|
|
NGS: SAM Tools → Pileup-to-Interval
|
|
</ul></dl>
|
|
<p>
|
|
|
|
<div><a name="bed"></a></div>
|
|
<hr>
|
|
<strong>BED</strong>
|
|
<p>
|
|
<ul>
|
|
<li> also qualifies as Tabular
|
|
<li> also qualifies as Interval
|
|
</ul>
|
|
This tab-separated format describes a genomic interval, but has
|
|
strict field specifications for use in genome browsers. BED files
|
|
can have from 3 to 12 columns, but the order of the columns matters,
|
|
and only the end ones can be omitted. Some groups of columns must
|
|
be all present or all absent. As in Interval format (but unlike
|
|
GFF and its relatives), the interval endpoints use a 0-based,
|
|
half-open numbering system.
|
|
<a href="http://main.genome-browser.bx.psu.edu/goldenPath/help/hgTracksHelp.html#BED"
|
|
>Field specifications</a>
|
|
<p>
|
|
Example:
|
|
<pre>
|
|
chr22 1000 5000 cloneA 960 + 1000 5000 0 2 567,488, 0,3512
|
|
chr22 2000 6000 cloneB 900 - 2000 6000 0 2 433,399, 0,3601
|
|
</pre>
|
|
<dl><dt>Can be converted to:
|
|
<dd><ul>
|
|
<li>GFF<br>
|
|
Convert Formats → BED-to-GFF
|
|
</ul></dl>
|
|
<p>
|
|
|
|
<div><a name="bedgraph"></a></div>
|
|
<hr>
|
|
<strong>BedGraph</strong>
|
|
<p>
|
|
<ul>
|
|
<li> also qualifies as Tabular
|
|
<li> also qualifies as Interval
|
|
<li> also qualifies as BED
|
|
</ul>
|
|
<a href="http://main.genome-browser.bx.psu.edu/goldenPath/help/bedgraph.html"
|
|
>BedGraph</a> is a BED file with the name column being a float value
|
|
that is displayed as a wiggle score in tracks. Unlike in Wiggle
|
|
format, the exact value of this score can be retrieved after being
|
|
loaded as a track.
|
|
<p>
|
|
|
|
<div><a name="binseq"></a></div>
|
|
<hr>
|
|
<strong>Binseq.zip</strong>
|
|
<p>
|
|
A zipped archive consisting of binary sequence files in either AB1
|
|
or SCF format. All files in this archive must have the same file
|
|
extension which is one of '<code>.ab1</code>' or '<code>.scf</code>'.
|
|
You must manually select this file format when uploading the file.
|
|
<p>
|
|
|
|
<div><a name="fasta"></a></div>
|
|
<hr>
|
|
<strong>FASTA</strong>
|
|
<p>
|
|
A sequence in
|
|
<a href="http://www.ncbi.nlm.nih.gov/blast/fasta.shtml">FASTA</a>
|
|
format consists of a single-line description, followed by lines of
|
|
sequence data. The first character of the description line is a
|
|
greater-than ('<code>></code>') symbol. All lines should be
|
|
shorter than 80 characters.
|
|
<pre>
|
|
>sequence1
|
|
atgcgtttgcgtgc
|
|
gtcggtttcgttgc
|
|
>sequence2
|
|
tttcgtgcgtatag
|
|
tggcgcggtga
|
|
</pre>
|
|
<dl><dt>Can be converted to:
|
|
<dd><ul>
|
|
<li>Tabular<br>
|
|
Convert Formats → FASTA-to-Tabular
|
|
</ul></dl>
|
|
<p>
|
|
|
|
<div><a name="fastqsolexa"></a></div>
|
|
<hr>
|
|
<strong>FastqSolexa</strong>
|
|
<p>
|
|
<a href="http://maq.sourceforge.net/fastq.shtml">FastqSolexa</a>
|
|
is the Illumina (Solexa) variant of the FASTQ format, which stores
|
|
sequences and quality scores in a single file.
|
|
<pre>
|
|
@seq1
|
|
GACAGCTTGGTTTTTAGTGAGTTGTTCCTTTCTTT
|
|
+seq1
|
|
hhhhhhhhhhhhhhhhhhhhhhhhhhPW@hhhhhh
|
|
@seq2
|
|
GCAATGACGGCAGCAATAAACTCAACAGGTGCTGG
|
|
+seq2
|
|
hhhhhhhhhhhhhhYhhahhhhWhAhFhSIJGChO
|
|
</pre>
|
|
Or
|
|
<pre>
|
|
@seq1
|
|
GAATTGATCAGGACATAGGACAACTGTAGGCACCAT
|
|
+seq1
|
|
40 40 40 40 35 40 40 40 25 40 40 26 40 9 33 11 40 35 17 40 40 33 40 7 9 15 3 22 15 30 11 17 9 4 9 4
|
|
@seq2
|
|
GAGTTCTCGTCGCCTGTAGGCACCATCAATCGTATG
|
|
+seq2
|
|
40 15 40 17 6 36 40 40 40 25 40 9 35 33 40 14 14 18 15 17 19 28 31 4 24 18 27 14 15 18 2 8 12 8 11 9
|
|
</pre>
|
|
<dl><dt>Can be converted to:
|
|
<dd><ul>
|
|
<li>FASTA<br>
|
|
NGS: QC and manipulation → Generic FASTQ manipulation → FASTQ to FASTA
|
|
<li>Tabular<br>
|
|
NGS: QC and manipulation → Generic FASTQ manipulation → FASTQ to Tabular
|
|
</ul></dl>
|
|
<p>
|
|
|
|
<div><a name="fped"></a></div>
|
|
<hr>
|
|
<strong>FPED</strong>
|
|
<p>
|
|
Also known as the FBAT format, for use with the
|
|
<a href="http://biosun1.harvard.edu/~fbat/fbat.htm">FBAT</a> program.
|
|
It consists of a pedigree file and a phenotype file.
|
|
<p>
|
|
|
|
<div><a name="gd_indivs"></a></div>
|
|
<hr>
|
|
<strong>ind</strong>
|
|
<p>
|
|
This format is a tabular file with the first column being the column number
|
|
(1 based)
|
|
from the gd_snp file where the individual/group starts. The second column is
|
|
the label from the metadata for the individual/group. The third is an alias
|
|
or blank.
|
|
<p>
|
|
|
|
<div><a name="gd_sap"></a></div>
|
|
<hr>
|
|
<strong>gd_sap</strong>
|
|
<p>
|
|
This is a tabular file describing single amino-acid polymorphisms (SAPs).
|
|
You must manually select this file format when uploading the file.
|
|
<!--
|
|
<a href="http://www.bx.psu.edu/miller_lab/docs/formats/gd_sap_format.html"
|
|
>Field specifications</a>
|
|
-->
|
|
<p>
|
|
|
|
<div><a name="gd_snp"></a></div>
|
|
<hr>
|
|
<strong>gd_snp</strong>
|
|
<p>
|
|
This is a tabular file describing SNPs in individuals or populations.
|
|
It contains the zero-based position of the SNP but not the range
|
|
required by BED or interval so can not be used in Genomic Operations without
|
|
adding an column for the end position.
|
|
You must manually select this file format when uploading the file.
|
|
<a href="http://www.bx.psu.edu/miller_lab/docs/formats/gd_snp_format.html"
|
|
>Field specifications</a>
|
|
<p>
|
|
|
|
<div><a name="gff"></a></div>
|
|
<hr>
|
|
<strong>GFF</strong>
|
|
<p>
|
|
<ul>
|
|
<li> also qualifies as Tabular
|
|
</ul>
|
|
GFF is a tab-separated format somewhat similar to BED, but it has
|
|
different columns and is more flexible. There are
|
|
<a href="http://main.genome-browser.bx.psu.edu/FAQ/FAQformat#format3"
|
|
>nine required fields</a>.
|
|
Note that unlike Interval and BED, GFF and its relatives (GFF3, GTF)
|
|
use 1-based inclusive coordinates to specify genomic intervals.
|
|
<dl><dt>Can be converted to:
|
|
<dd><ul>
|
|
<li>BED<br>
|
|
Convert Formats → GFF-to-BED
|
|
</ul></dl>
|
|
<p>
|
|
|
|
<div><a name="gff3"></a></div>
|
|
<hr>
|
|
<strong>GFF3</strong>
|
|
<p>
|
|
<ul>
|
|
<li> also qualifies as Tabular
|
|
</ul>
|
|
The <a href="http://www.sequenceontology.org/gff3.shtml">GFF3</a>
|
|
format addresses the most common extensions to GFF, while attempting
|
|
to preserve compatibility with previous formats.
|
|
Note that unlike Interval and BED, GFF and its relatives (GFF3, GTF)
|
|
use 1-based inclusive coordinates to specify genomic intervals.
|
|
<p>
|
|
|
|
<div><a name="gtf"></a></div>
|
|
<hr>
|
|
<strong>GTF</strong>
|
|
<p>
|
|
<ul>
|
|
<li> also qualifies as Tabular
|
|
</ul>
|
|
<a href="http://main.genome-browser.bx.psu.edu/FAQ/FAQformat#format4"
|
|
>GTF</a> is a format for describing genes and other features associated
|
|
with DNA, RNA, and protein sequences. It is a refinement to GFF that
|
|
tightens the specification.
|
|
Note that unlike Interval and BED, GFF and its relatives (GFF3, GTF)
|
|
use 1-based inclusive coordinates to specify genomic intervals.
|
|
<!-- (not available on Main)
|
|
<dl><dt>Can be converted to:
|
|
<dd><ul>
|
|
<li>BedGraph<br>
|
|
Convert Formats → GTF-to-BEDGraph
|
|
</ul></dl>
|
|
-->
|
|
<p>
|
|
|
|
<div><a name="html"></a></div>
|
|
<hr>
|
|
<strong>HTML</strong>
|
|
<p>
|
|
This format is an HTML web page. Click the eye icon next to the
|
|
dataset to view it in your browser.
|
|
<p>
|
|
|
|
<div><a name="interval"></a></div>
|
|
<hr>
|
|
<strong>Interval</strong>
|
|
<p>
|
|
<ul>
|
|
<li> also qualifies as Tabular
|
|
</ul>
|
|
This Galaxy format represents genomic intervals. It is tab-separated,
|
|
but has the added requirement that three of the columns must be the
|
|
chromosome name, start position, and end position, where the positions
|
|
use a 0-based, half-open numbering system (see below). An optional
|
|
strand column can also be specified, and an initial header row can
|
|
be used to label the columns, which do not have to be in any special
|
|
order. Arbitrary additional columns can also be present.
|
|
<p>
|
|
Required fields:
|
|
<ul>
|
|
<li>CHROM - The name of the chromosome (e.g. chr3, chrY, chr2_random)
|
|
or contig (e.g. ctgY1).
|
|
<li>START - The starting position of the feature in the chromosome or
|
|
contig. The first base in a chromosome is numbered 0.
|
|
<li>END - The ending position of the feature in the chromosome or
|
|
contig. This base is not included in the feature. For example,
|
|
the first 100 bases of a chromosome are described as START=0,
|
|
END=100, and span the bases numbered 0-99.
|
|
</ul>
|
|
Optional:
|
|
<ul>
|
|
<li>STRAND - Defines the strand, either '<code>+</code>' or
|
|
'<code>-</code>'.
|
|
<li>Header row
|
|
</ul>
|
|
Example:
|
|
<pre>
|
|
#CHROM START END STRAND NAME COMMENT
|
|
chr1 10 100 + exon myExon
|
|
chrX 1000 10050 - gene myGene
|
|
</pre>
|
|
<dl><dt>Can be converted to:
|
|
<dd><ul>
|
|
<li>BED<br>
|
|
The exact changes needed and tools to run will vary with what fields
|
|
are in the Interval file and what type of BED you are converting to.
|
|
In general you will likely use Text Manipulation → Compute, Cut,
|
|
or Merge Columns.
|
|
</ul></dl>
|
|
<p>
|
|
|
|
<div><a name="lav"></a></div>
|
|
<hr>
|
|
<strong>LAV</strong>
|
|
<p>
|
|
<a href="http://www.bx.psu.edu/miller_lab/dist/lav_format.html">LAV</a>
|
|
is the raw pairwise alignment format that is output by BLASTZ. The
|
|
first line begins with <code>#:lav</code>.
|
|
<!-- (not available on Main)
|
|
<dl><dt>Can be converted to:
|
|
<dd><ul>
|
|
<li>BED<br>
|
|
Convert Formats → LAV to BED
|
|
</ul></dl>
|
|
-->
|
|
<p>
|
|
|
|
<div><a name="lped"></a></div>
|
|
<hr>
|
|
<strong>LPED</strong>
|
|
<p>
|
|
This is the linkage pedigree format, which consists of separate MAP and PED
|
|
files. Together these files describe SNPs; the map file contains the position
|
|
and an identifier for the SNP, while the pedigree file has the alleles. To
|
|
upload this format into Galaxy, do not use Auto-detect for the file format;
|
|
instead select <code>lped</code>. You will then be given two sections for
|
|
uploading files, one for the pedigree file and one for the map file. For more
|
|
information, see
|
|
<a href="http://www.broadinstitute.org/science/programs/medical-and-population-genetics/haploview/input-file-formats-0"
|
|
>linkage pedigree</a>,
|
|
<a href="http://pngu.mgh.harvard.edu/~purcell/plink/data.shtml#map">MAP</a>,
|
|
and/or <a href="http://pngu.mgh.harvard.edu/~purcell/plink/data.shtml#ped">PED</a>.
|
|
<dl><dt>Can be converted to:
|
|
<dd><ul>
|
|
<li>PBED<br>Automatic
|
|
<li>FPED<br>Automatic
|
|
</ul></dl>
|
|
<p>
|
|
|
|
<div><a name="maf"></a></div>
|
|
<hr>
|
|
<strong>MAF</strong>
|
|
<p>
|
|
<a href="http://main.genome-browser.bx.psu.edu/FAQ/FAQformat#format5"
|
|
>MAF</a> is the multi-sequence alignment format that is output by TBA
|
|
and Multiz. The first line begins with '<code>##maf</code>'. This
|
|
word is followed by whitespace-separated "variable<code>=</code>value"
|
|
pairs. There should be no whitespace surrounding the '<code>=</code>'.
|
|
<dl><dt>Can be converted to:
|
|
<dd><ul>
|
|
<li>BED<br>
|
|
Convert Formats → MAF to BED
|
|
<li>Interval<br>
|
|
Convert Formats → MAF to Interval
|
|
<li>FASTA<br>
|
|
Convert Formats → MAF to FASTA
|
|
</ul></dl>
|
|
<p>
|
|
|
|
<div><a name="mastervar"></a></div>
|
|
<hr>
|
|
<strong>MasterVar</strong>
|
|
<p>
|
|
MasterVar is a tab delimited text format with specified fields developed
|
|
by the Complete Genomics life sciences company.
|
|
<a href="http://media.completegenomics.com/documents/DataFileFormats_Standard_Pipeline_2.2.pdf"
|
|
>Field specifications</a>.
|
|
<dl><dt>Can be converted to:
|
|
<dd><ul>
|
|
<li>pgSnp<br>
|
|
Convert Formats → MasterVar to pgSnp
|
|
<li>gd_snp<br>
|
|
Convert Formats → MasterVar to gd_snp
|
|
</ul></dl>
|
|
<p>
|
|
|
|
<div><a name="pbed"></a></div>
|
|
<hr>
|
|
<strong>PBED</strong>
|
|
<p>
|
|
This is the binary version of the LPED format.
|
|
<dl><dt>Can be converted to:
|
|
<dd><ul>
|
|
<li>LPED<br>Automatic
|
|
</ul></dl>
|
|
<p>
|
|
|
|
<div><a name="pgSnp"></a></div>
|
|
<hr>
|
|
<strong>pgSnp</strong>
|
|
<p>
|
|
This is the personal genome SNP format used by UCSC. It is a BED-like
|
|
format with columns chosen for the specialized display in the browser
|
|
for personal genomes.
|
|
<a href="http://genome.ucsc.edu/FAQ/FAQformat.html#format10"
|
|
>Field specifications</a>.
|
|
Galaxy treats it the same as an interval file.
|
|
<p>
|
|
|
|
<div><a name="psl"></a></div>
|
|
<hr>
|
|
<strong>PSL</strong>
|
|
<p>
|
|
<a href="http://main.genome-browser.bx.psu.edu/FAQ/FAQformat#format2">PSL</a>
|
|
format is used for alignments returned by
|
|
<a href="http://genome.ucsc.edu/cgi-bin/hgBlat?command=start">BLAT</a>.
|
|
It does not include any sequence.
|
|
<p>
|
|
|
|
<div><a name="scf"></a></div>
|
|
<hr>
|
|
<strong>SCF</strong>
|
|
<p>
|
|
This is a binary sequence format originally designed for the Staden
|
|
sequence handling software package. Files should have a
|
|
'<code>.scf</code>' file extension. You must manually select this
|
|
file format when uploading the file.
|
|
<a href="http://staden.sourceforge.net/manual/formats_unix_2.html"
|
|
>More information</a>
|
|
<p>
|
|
|
|
<div><a name="sff"></a></div>
|
|
<hr>
|
|
<strong>SFF</strong>
|
|
<p>
|
|
This is a binary sequence format used by the Roche 454 GS FLX
|
|
sequencing machine, and is documented on p. 528 of their
|
|
<a href="http://sequence.otago.ac.nz/download/GS_FLX_Software_Manual.pdf"
|
|
>software manual</a>. Files should have a '<code>.sff</code>' file
|
|
extension.
|
|
<!-- You must manually select this file format when uploading the file. -->
|
|
<dl><dt>Can be converted to:
|
|
<dd><ul>
|
|
<li>FASTA<br>
|
|
Convert Formats → SFF converter
|
|
<li>FASTQ<br>
|
|
Convert Formats → SFF converter
|
|
</ul></dl>
|
|
<p>
|
|
|
|
<div><a name="table"></a></div>
|
|
<hr>
|
|
<strong>Table</strong>
|
|
<p>
|
|
Text data separated into columns by something other than tabs.
|
|
<p>
|
|
|
|
<div><a name="tab"></a></div>
|
|
<hr>
|
|
<strong>Tabular (tab-delimited)</strong>
|
|
<p>
|
|
One or more columns of text data separated by tabs.
|
|
<dl><dt>Can be converted to:
|
|
<dd><ul>
|
|
<li>FASTA<br>
|
|
Convert Formats → Tabular-to-FASTA<br>
|
|
The Tabular file must have a title and sequence column.
|
|
<li>FASTQ<br>
|
|
NGS: QC and manipulation → Generic FASTQ manipulation → Tabular to FASTQ
|
|
<li>Interval<br>
|
|
If the Tabular file has a chromosome column (or is all on one
|
|
chromosome) and has a position column, you can create an Interval
|
|
file (e.g. for SNPs). If it is all on one chromosome, use
|
|
Text Manipulation → Add column to add a CHROM column.
|
|
If the given position is 1-based, use
|
|
Text Manipulation → Compute with the position column minus 1 to
|
|
get the START, and use the original given column for the END.
|
|
If the given position is 0-based, use it as the START, and compute
|
|
that plus 1 to get the END.
|
|
</ul></dl>
|
|
<p>
|
|
|
|
<div><a name="txtseqzip"></a></div>
|
|
<hr>
|
|
<strong>Txtseq.zip</strong>
|
|
<p>
|
|
A zipped archive consisting of flat text sequence files. All files
|
|
in this archive must have the same file extension of
|
|
'<code>.txt</code>'. You must manually select this file format when
|
|
uploading the file.
|
|
<p>
|
|
|
|
<div><a name="vcf"></a></div>
|
|
<hr>
|
|
<strong>VCF</strong>
|
|
<p>
|
|
Variant Call Format (VCF) is a tab delimited text file with specified
|
|
fields. It was developed by the 1000 Genomes Project.
|
|
<a href="http://www.1000genomes.org/wiki/Analysis/Variant%20Call%20Format/vcf-variant-call-format-version-41"
|
|
>Field specifications</a>.
|
|
<dl><dt>Can be converted to:
|
|
<dd><ul>
|
|
<li>pgSnp<br>
|
|
Convert Formats → VCF to pgSnp
|
|
</ul></dl>
|
|
<p>
|
|
|
|
<div><a name="wig"></a></div>
|
|
<hr>
|
|
<strong>Wiggle custom track</strong>
|
|
<p>
|
|
Wiggle tracks are typically used to display per-nucleotide scores
|
|
in a genome browser. The Wiggle format for custom tracks is
|
|
line-oriented, and the wiggle data is preceded by a track definition
|
|
line that specifies which of three different types is being used.
|
|
<a href="http://main.genome-browser.bx.psu.edu/goldenPath/help/wiggle.html"
|
|
>More information</a>
|
|
<dl><dt>Can be converted to:
|
|
<dd><ul>
|
|
<li>Interval<br>
|
|
Get Genomic Scores → Wiggle-to-Interval
|
|
<li>As a second step this could be converted to 3- or 4-column BED,
|
|
by removing extra columns using
|
|
Text Manipulation → Cut columns from a table.
|
|
</ul></dl>
|
|
<p>
|
|
|
|
<div><a name="gd_ped"></a></div>
|
|
<hr>
|
|
<strong>gd_ped</strong>
|
|
<p>
|
|
Similar to the linkage pedigree format (lped).
|
|
<p>
|
|
|
|
<div><a name="text"></a></div>
|
|
<hr>
|
|
<strong>Other text type</strong>
|
|
<p>
|
|
Any text file.
|
|
<dl><dt>Can be converted to:
|
|
<dd><ul>
|
|
<li>Tabular<br>
|
|
If the text has fields separated by spaces, commas, or some other
|
|
delimiter, it can be converted to Tabular by using
|
|
Text Manipulation → Convert delimiters to TAB.
|
|
</ul></dl>
|
|
<p>
|
|
|
|
<!-- blank lines so internal links will jump farther to end -->
|
|
<br><br><br><br><br><br><br><br><br><br><br><br>
|
|
<br><br><br><br><br><br><br><br><br><br><br><br>
|
|
</body>
|
|
</html>
|