opensource/galaxy
3
0
Fork 0
mirror of https://github.com/galaxyproject/galaxy.git synced 2026-10-24 12:13:33 +08:00
Code Issues Packages Projects Releases Wiki Activity

update xml file.

Browse Source
This commit is contained in:
Wen-Yu Chung
2008-03-24 19:41:56 +00:00
parent 3dc7562f7d
commit d77480272f
1 changed files with 28 additions and 9 deletions
Download Patch File Download Diff File Expand all files Collapse all files
tools/metag_tools/short_reads_trim_seq.xml
+28 -9
View File
@@ -78,39 +78,58 @@ Accept the following two file formats:
- fasta: for **454** and **SOLiD** data
- tabular: for **Solexa** data. Only take the maximal value from each 4 quality scores.
If *minimal trimmed length to report* is set to a number larger than zero, the tool ouputs any substrings that are longer than this threshold.
If *minimal length of trimmed reads to report* is set to a number larger than zero, the tool ouputs any substrings that are longer than this threshold.
If there are more than one substring, the tool outputs all of them in separated fasta format.
-----
**Example 1.**
454 and SOLiD data::
For 454 and SOLiD files
- the sequence file is fasta format as following::
>seq1
CCGGTATCCG
>seq1
- and the score file is also a fasta-like format::
>quality score for seq1
33 19 34 25 28 28 28 32 15 34
454 and SOLiD Output (trimmed by quality score 20 and returned the longest substring)::
- if use **20** as *minimal quality score*, and
- use **0** as *minimal length of trimmed reads to report*
- the output will return the longest sub-sequence::
>seq1
GGTATC
Solexa data::
-----
**Example 2.**
For Solexa files
- the sequence file is fasta format as following::
5 300 902 419 TTCTTACCTATTAGTGGTTGAACATC
- and the score file is also a fasta-like format::
Solexa quality score (only showed the maximum value)::
40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 15 40
Solexa Output (trimmed by quality score 20 and returned the longest substring)::
Note: only showed the maximum score here
- if use **20** as *minimal quality score*, and
- use **0** as *minimal length of trimmed reads to report*
- the output will return the longest sub-sequence::
>15774
TTCTTACCTATTAGTGGTTGAACA
The fasta title will be replaced by a unique number in Solexa output.
Note: The fasta title will be replaced by a unique number in Solexa output.
</help>
</tool>