opensource/galaxy
3
0
Fork 0
mirror of https://github.com/galaxyproject/galaxy.git synced 2026-09-24 16:30:27 +08:00
Code Issues Packages Projects Releases Wiki Activity

Updates to fastqc tool to wrap the user supplied job name in quotes and sanitize to letters/digits only

Browse Source 
Some downstream problems from ( characters reported today but probably needs deeper sanitizing
This commit is contained in:
Ross Lazarus
2012-06-08 08:26:09 +10:00
parent f8f06c3706
commit 9fbf7007c7
1 changed files with 7 additions and 2 deletions
Download Patch File Download Diff File Expand all files Collapse all files
tools/rgenetics/rgFastQC.xml
+7 -2
View File
@@ -1,4 +1,4 @@
<tool name="Fastqc: Fastqc QC" id="fastqc" version="0.4">
<tool name="Fastqc: Fastqc QC" id="fastqc" version="0.5">
<description>using FastQC from Babraham</description>
<command interpreter="python">
rgFastQC.py -i $input_file -d $html_file.files_path -o $html_file -n "$out_prefix" -f $input_file.ext -j $input_file.name -e ${GALAXY_DATA_INDEX_DIR}/shared/jars/FastQC/fastqc
@@ -11,7 +11,12 @@
</requirements>
<inputs>
<param format="fastqsanger,fastq,bam,sam" name="input_file" type="data" label="Short read data from your current history" />
<param name="out_prefix" value="FastQC" type="text" label="Title for the output file - to remind you what the job was for" size="80" />
<param name="out_prefix" value="FastQC" type="text" label="Title for the output file - to remind you what the job was for" size="80"
help="Letters and numbers only please - other characters will be removed">
<sanitizer invalid_char="">
<valid initial="string.letters,string.digits"/>
</sanitizer>
</param>
<param name="contaminants" type="data" format="tabular" optional="true" label="Contaminant list"
help="tab delimited file with 2 columns: name and sequence. For example: Illumina Small RNA RT Primer CAAGCAGAAGACGGCATACGA"/>
</inputs>