sorry, hit the wrong button (want to click cancel but click ok instead).

add two tools and functional test data for short reads.
update tool_conf.xml.sample.

tool_conf.xml.sample

@@ -270,6 +270,5 @@
     <tool file="metag_tools/megablast_xml_parser.xml" />
     <tool file="metag_tools/blat_coverage_report.xml" />
     <tool file="metag_tools/blat_mapping.xml" />
-    <tool file="metag_tools/convert_SOLiD_color2nuc.xml" />
   </section>
 </toolbox>

tools/metag_tools/blat_mapping.py

@@ -0,0 +1,98 @@
+#! /usr/bin/python
+
+import os, sys
+
+assert sys.version_info[:2] >= (2.4)
+
+def reverse_complement(s):
+
+    complement_dna = {"A":"T", "T":"A", "C":"G", "G":"C", "a":"t", "t":"a", "c":"g", "g":"c", "N":"N", "n":"n" , ".":"."}
+    reversed_s = []
+    for i in s:
+        reversed_s.append(complement_dna[i])
+    reversed_s.reverse()
+    
+    return "".join(reversed_s)
+
+    
+def __main__():
+    
+    nuc_index = {'a':0,'t':1,'c':2,'g':3,'n':4}
+    coverage = {}        # key = (chrom, index)
+
+    invalid_lines = 0
+    invalid_chrom = 0
+    
+    infile = sys.argv[1]
+    outfile = sys.argv[2]
+
+    for i, line in enumerate(open(infile)):
+
+        line = line.rstrip('\r\n')
+        fields = line.split()
+        
+        if line.startswith('#'): continue
+        if not line: continue
+        
+        if (len(fields) < 21):                # standard number of pslx columns
+            invalid_lines += 1
+            continue 
+        if (not fields[0].isdigit()):
+            invalid_lines += 1
+            continue
+        
+        chrom = fields[13]
+        
+        try:
+            assert chrom.startswith('chr') is True
+        except:
+            invalid_chrom += 1
+            continue
+            
+        try:
+            block_count = int(fields[17])
+        except:
+            invalid_lines += 1
+            continue
+        
+        block_size = fields[18].split(',')
+        chrom_start = fields[20].split(',')
+    
+        
+        for j in range(block_count):
+            
+            try:
+                this_block_size = int(block_size[j])
+                this_chrom_start = int(chrom_start[j])
+            except:
+                continue
+            
+            # brut force coverage                
+            for k in range(this_block_size):
+                cur_index = this_chrom_start+k
+                if coverage.has_key((chrom,cur_index)):
+                    coverage[(chrom, cur_index)] += 1
+                else:
+                    coverage[(chrom, cur_index)] = 1
+                
+    # generate a index file
+    outputfh = open(outfile, 'w')
+    keys = coverage.keys()
+    keys.sort()
+    previous_chrom = ''
+    for i in keys:
+        (chrom, location) = i
+        sum = coverage[(i)]
+        if (chrom != previous_chrom):
+            print >> outputfh, 'variableStep chrom=%s' %(chrom)
+            previous_chrom = chrom
+        print >> outputfh, location, sum
+    outputfh.close()
+    
+    if invalid_lines:
+        print >> sys.stdout, "Skip %d invalid lines. These lines could be headers or have fewer columns than standard output." %(invalid_lines)
+    
+    if invalid_chrom:
+        print >> sys.stdout, "Skip %d invalid lines with errors in chromosome id. The chromosome id must begin with \'chr\' to be correctly mapped to ucsc genome browser."
+        
+if __name__ == '__main__': __main__()

tools/metag_tools/blat_mapping.xml

@@ -0,0 +1,42 @@
+<tool id="blat2wig" name="Show Coverage of the Reads">
+	<description>in wiggle format</description>
+	<command interpreter="python">blat_mapping.py $input1 $output1</command>
+	<inputs>	
+		<param name="input1" type="data" format="tabular" label="Alignment Result"/>
+	</inputs>
+	<outputs>
+		<data name="output1" format="wig"/>
+	</outputs> 
+	<tests>
+		<test>
+			<param name="input1" value="blat_mapping_test1.txt" ftype="tabular" />
+			<output name="output1" file="blat_mapping_test1.out" />
+		</test>
+	</tests>
+	<help>
+
+.. class:: warningmark
+
+**TIP**. To generate acceptable files, please use alignment program **BLAT** with option **-out=pslx**. 
+
+.. class:: warningmark
+
+**TIP**. Please edit the database information by click on the pencil symbol in your history panel. Select the corresponding genome build.
+
+-----
+	
+**What it does**
+ 
+ This tool takes **BLAT pslx** output and returns a wig-like file showing the number of reads (coverage) mapped at each chromosome location. Use **Graph/Display Data --> Build custom track** tool to show the coverage mapping in UCSC Genome Browser.
+
+-----
+
+**Example**
+
+ Showing reads coverage on human chromosome 22 (partial result) in UCSC Genome Browser Custom Track (black lines) with SNPs:
+ 
+ .. image:: ../static/images/blat_mapping_example.png
+ 	:width: 600
+ 	
+	</help>
+</tool>

tools/metag_tools/convert_SOLiD_color2nuc.py

@@ -0,0 +1,92 @@
+#! /usr/bin/python
+"""
+convert SOLiD calor-base data to nucleotide sequence
+example: T011213122200221123032111221021210131332222101
+         TTGTCATGAGAAAGACAGCCGACACTCAAGTCAACGTATCTCTGGT
+"""
+
+import sys, os
+
+assert sys.version_info[:2] >= (2.4)
+
+def stop_err(msg):
+    
+    sys.stderr.write(msg)
+    sys.stderr.write('\n')
+    sys.exit()
+    
+def color2base(color_seq):
+
+    first_nuc = ['A','C','G','T']
+    code_matrix = {}
+    code_matrix['0'] = ['A','C','G','T']
+    code_matrix['1'] = ['C','A','T','G']
+    code_matrix['2'] = ['G','T','A','C']
+    code_matrix['3'] = ['T','G','C','A']
+
+    overlap_nuc = ''
+    nuc_seq = ''
+    
+    seq_prefix = prefix = color_seq[0].upper()
+    color_seq = color_seq[1:]
+                
+    try:
+        assert (seq_prefix in first_nuc) is True
+    except:
+        stop_err('The leading nucleotide is invalid. Must be one of the four nucleotides: A, T, C, G.\nThe file contains a %s' %seq_prefix )
+
+    for code in color_seq:
+        
+        try:
+            assert (code in ['0','1','2','3']) is True
+        except:
+            stop_err('Expect digits (0, 1, 2, 3) in the color-cading data. File contains numbers other than the set.\nThe file contains a %s' %code)
+        
+        second_nuc = code_matrix[code]
+        overlap_nuc = second_nuc[first_nuc.index(prefix)]
+        nuc_seq += overlap_nuc
+        prefix = overlap_nuc
+
+    return seq_prefix, nuc_seq
+
+def __main__():
+
+    infilename = sys.argv[1]
+    keep_prefix = sys.argv[2].lower()
+    outfilename = sys.argv[3]
+
+    outfile = open(outfilename,'w')
+    prefix = ''
+    color_seq = ''
+    for i, line in enumerate(file(infilename)):
+        line = line.rstrip('\r\n')
+        if not line: continue
+        if line.startswith("#"): continue
+        if line.startswith(">"):
+            
+            if color_seq:
+                prefix, nuc_seq = color2base(color_seq)
+                
+                if keep_prefix == 'yes':
+                    nuc_seq = prefix + nuc_seq
+                
+                print >> outfile, title
+                print >> outfile, nuc_seq
+                
+            title = line
+            color_seq = ''
+        else:
+            color_seq += line
+            
+    if color_seq:
+        prefix, nuc_seq = color2base(color_seq)
+                
+        if keep_prefix == 'yes':
+            nuc_seq = prefix + nuc_seq
+
+        print >> outfile, title
+        print >> outfile, nuc_seq
+            
+    outfile.close()
+    
+if __name__=='__main__': __main__()

tools/metag_tools/convert_SOLiD_color2nuc.xml

@@ -0,0 +1,72 @@
+<tool id="color2nuc" name="Convert Color Space" version="1.0.0">
+<description> to Nucleotides </description>
+<command interpreter="python">convert_SOLiD_color2nuc.py $input1 $input2 $output1 </command>
+
+<inputs>
+    <param name="input1" type="data" format="txt" label="SOLiD Color Coding File" />
+    <param name="input2" type="select" label="Keep Prefix Nucleotide">
+    	<option value="yes">Yes</option>
+    	<option value="no">No</option>
+    </param>
+</inputs>
+<outputs>
+  	<data name="output1" format="fasta" />
+</outputs>
+<!-- 
+<tests>
+	<test>
+		<param name="input1" value="convert_SOLiD_color2nuc_test1.txt" ftype="txt" />
+		<param name="input2" value="no" />
+		<output name="output1" file="convert_SOLiD_color2nuc_test1.out" />
+	</test>
+</tests>
+-->
+<help>
+
+.. class:: warningmark
+
+**TIP**. The tool was designed for color space files generated from AB SOLiD sequencer. The file format must be fasta-like: the title starts with a ">" sign, and each color-space sequence starts with a leading nucleotide.
+ 
+-----
+
+**What it does**
+
+ This tool convert a color-space sequence to nucleotides. The leading character must be one of the nucleotides (A, C, G, T). 
+ 
+-----
+
+**Example**
+
+- If the color-space file looks like this::
+
+	&gt;seq1
+	A013
+	&gt;seq2
+	T011213122200221123032111221021210131332222101
+	
+- If you would like to **keep** the leading nucleotide::
+
+	&gt;seq1
+	AACG
+	&gt;seq2
+	TTGTCATGAGAAAGACAGCCGACACTCAAGTCAACGTATCTCTGGT
+	
+- If you **do not want to keep** the leading nucleotide (the length of nucleotide sequence will be one less than the color-space sequence)::
+ 
+ 	&gt;seq1
+ 	ACG
+ 	&gt;seq2
+	TGTCATGAGAAAGACAGCCGACACTCAAGTCAACGTATCTCTGGT 
+
+-----
+
+**SOLiD Color Coding Alignment matrix**
+
+ Each di-nucleotide is represented by a single digit: 0 to 3. The matrix is symmetric, thus the leading nucleotide is necessary to determine the sequence (otherwise there are four possibilities).
+
+ 
+ .. image:: ../static/images/dualcolorcode.png
+
+
+</help>
+</tool>