Added solid_to_fastq and fastq_conversions converters to Convert Formats section

2026-09-24 16:30:27 +08:00 · 2009-07-31 11:48:37 -04:00
parent 5ff35872f0
commit 5d4b1151d0
5 changed files with 330 additions and 0 deletions
@@ -77,6 +77,8 @@
    <tool file="maf/maf_to_bed.xml" />
    <tool file="maf/maf_to_fasta.xml" />
    <tool file="fasta_tools/tabular_to_fasta.xml" />
+    <tool file="next_gen_conversion/solid_to_fastq.xml" />
+    <tool file="next_gen_conversion/fastq_conversions.xml" />
  </section>
  <section name="Extract Features" id="features">
    <tool file="filters/ucsc_gene_bed_to_exon_bed.xml" />
@@ -0,0 +1,41 @@
+#! /usr/bin/python
+
+"""
+Performs various conversions around Sanger FASTQ data
+
+usage: %prog [options]
+   -c, --command=c: Command to run
+   -i, --input=i: Input file to be converted
+   -o, --outputFastqsanger=o: FASTQ Sanger converted output file for sol2std
+   -s, --outputFastqsolexa=s: FASTQ Solexa converted output file 
+   -f, --outputFasta=f: FASTA converted output file
+
+usage: %prog command input_file output_file
+"""
+
+import os, sys, tempfile
+from galaxy import eggs
+import pkg_resources; pkg_resources.require( "bx-python" )
+from bx.cookbook import doc_optparse
+
+def stop_err( msg ):
+    sys.stderr.write( "%s\n" % msg )
+    sys.exit()
+ 
+def __main__():
+    #Parse Command Line
+    options, args = doc_optparse.parse( __doc__ )
+
+    cmd = "fq_all2std.pl %s %s > %s"
+    if options.command == 'sol2std':
+        cmd = cmd % (options.command, options.input, options.outputFastqsanger)
+    elif options.command == 'std2sol':
+        cmd = cmd % (options.command, options.input, options.outputFastqsolexa)
+    elif options.command == 'fq2fa':
+        cmd = cmd % (options.command, options.input, options.outputFasta)
+    try:
+        os.system(cmd)
+    except Exception, eq:
+        stop_err("Error converting data format.\n" + str(eq))        
+
+if __name__=="__main__": __main__()
@@ -0,0 +1,133 @@
+<tool id="fastq_conversions" name="FASTQ Conversions" version="1.0.0">
+  <description>converts between FASTQ data and other data formats</description>
+  <command interpreter="python">
+    fastq_conversions.py 
+    --command=$conversionType.type
+    --input=$input
+    #if $conversionType.type == "sol2std":
+     --outputFastqsanger=$outputFastqsanger
+    #else:
+     --outputFastqsanger="None"
+    #end if
+    #if $conversionType.type == "std2sol":
+     --outputFastqsolexa=$outputFastqsolexa
+    #else:
+     --outputFastqsolexa="None"
+    #end if
+    #if $conversionType.type == "fq2fa":
+     --outputFasta=$outputFasta
+    #else:
+     --outputFasta="None"
+    #end if
+  </command>
+  <inputs>
+    <conditional name="conversionType">
+      <param name="type" type="select" label="What type of conversion do you want to do?">
+        <option value="sol2std">Solexa/Illumina FASTQ to standard Sanger FASTQ</option>
+        <option value="std2sol">Standard Sanger FASTQ to Solexa/Illumina FASTQ</option>
+        <option value="fq2fa">Various FASTQ to FASTA</option>
+      </param>
+      <when value="sol2std">
+        <param name="input" type="data" format="fastqsolexa" label="File to convert" />
+      </when>
+      <when value="std2sol">
+        <param name="input" type="data" format="fastqsanger" label="File to convert" />
+      </when>
+      <when value="fq2fa">
+        <param name="input" type="data" format="fastqsolexa, fastqsanger" label="File to convert" />
+      </when>
+    </conditional>
+  </inputs>
+  <outputs>
+    <data name="outputFastqsanger" format="fastqsanger">
+      <filter>conversionType['type'] == 'sol2std'</filter>
+    </data>
+    <data name="outputFastqsolexa" format="fastqsolexa">
+      <filter>conversionType['type'] == 'std2sol'</filter>
+    </data>
+    <data name="outputFasta" format="fasta">
+      <filter>conversionType['type'] == 'fq2fa'</filter>
+    </data>
+  </outputs>
+  <tests>
+    <test>
+      <param name="type" value="sol2std" />
+      <param name="input" value="bwa_phiX_sanger.fastq" ftype="fastqsolexa" />
+      <output name="outputFastqsanger" file="fastq_conv_out1.fastqsanger" />
+    </test>
+    <test>
+      <param name="type" value="std2sol" />
+      <param name="input" value="1.fastqsanger" ftype="fastqsanger" />
+      <output name="outputFastqsolexa" file="fastq_conv_out2.fastqsolexa" />
+    </test>
+    <test>
+      <param name="type" value="fq2fa" />
+      <param name="input" value="1.fastqsanger" ftype="fastqsanger" />
+      <output name="outputFasta" file="fastq_conv_out4.fasta" />
+    </test>
+  </tests>
+  <help>
+**What it does**
+
+This tool offers several conversions options relating to the FASTQ format. 
+
+-----
+
+**Examples**
+
+- Converting the Solexa/Illumina FASTQ data::
+
+	@081017-and-081020:1:1:1715:1759
+	GGACTCAGATAGTAATCCACGCTCCTTTAAAATATC
+	+
+	II#IIIIIII$5+.(9IIIIIII$%*$G$A31I&amp;&amp;B
+
+- will produce the following Sanger FASTQ data::
+
+	@081017-and-081020:1:1:1715:1759
+	GGACTCAGATAGTAATCCACGCTCCTTTAAAATATC
+	+
+	++!+++++++!!!!!"+++++++!!!!)!%!!+!!%!
+	
+- Converting standard Sanger FASTQ::
+    
+    @1831_573_1004/1
+	AATACTTTCGGCGCCCTAAACCAGCTCACTGGGG
+	+
+	>&lt;C&amp;&amp;9952+C>5&lt;.?&lt;79,=42&lt;292:&lt;(9/-7
+	@1831_573_1050/1
+	TTTATGGGTATGGCCGCTCACAGGCCAGCGGCCT
+	+
+	;@@17?@=>7??@A8?==@4A?A4)&amp;+.'&amp;+'1,
+
+- will produce the following Solexa/Illumina FASTQ data::
+
+	@1831_573_1004/1
+	AATACTTTCGGCGCCCTAAACCAGCTCACTGGGG
+	+
+	][bEEXXTQJb]T[M^[VXK\SQ[QXQY[GXNLV
+	@1831_573_1050/1
+	TTTATGGGTATGGCCGCTCACAGGCCAGCGGCCT
+	+
+	Z__PV^_\]V^^_`W^\\_S`^`SHEJMFEJFPK
+
+- Converting the Sanger FASTQ data::
+
+    @1831_573_1004/1
+	AATACTTTCGGCGCCCTAAACCAGCTCACTGGGG
+	+
+	>&lt;C&amp;&amp;9952+C>5&lt;.?&lt;79,=42&lt;292:&lt;(9/-7
+	@1831_573_1050/1
+	TTTATGGGTATGGCCGCTCACAGGCCAGCGGCCT
+	+
+	;@@17?@=>7??@A8?==@4A?A4)&amp;+.'&amp;+'1,
+	
+- will produce the following FASTA data::
+
+	>1831_573_1004/1
+	AATACTTTCGGCGCCCTAAACCAGCTCACTGGGG
+	>1831_573_1050/1
+	TTTATGGGTATGGCCGCTCACAGGCCAGCGGCCT
+
+  </help>
+</tool>
@@ -0,0 +1,53 @@
+#! /usr/bin/python
+
+"""
+Converts SOLiD data to Sanger FASTQ format.
+
+usage: %prog [options]
+   -i, --input1=i: Forward reads file
+   -q, --input2=q: Forward qual file
+   -I, --input3=I: Reverse reads file
+   -Q, --input4=Q: Reverse qual file
+   -o, --output1=o: Forward output
+   -r, --output2=r: Reverse output
+
+usage: %prog forward_reads_file forwards_qual_file reverse_reads_file(or_None) reverse_qual_file(or_None) output_file ouptut_id output_dir
+"""
+
+import os, sys, tempfile
+from galaxy import eggs
+import pkg_resources; pkg_resources.require( "bx-python" )
+from bx.cookbook import doc_optparse
+
+def stop_err( msg ):
+    sys.stderr.write( "%s\n" % msg )
+    sys.exit()
+ 
+def __main__():
+    #Parse Command Line
+    options, args = doc_optparse.parse( __doc__ )
+    # if paired-end data (have reverse input files)
+    if options.input3 != "None" and options.input4 != "None":
+        tmpf = tempfile.NamedTemporaryFile()    #forward reads
+        tmpr = tempfile.NamedTemporaryFile()    #reverse reads
+
+        cmd1 = "bwa_solid2fastq_modified.pl 'yes' %s %s %s %s %s %s %s 2>&1" %(tmpf.name,tmpr.name,None,options.input1,options.input2,options.input3,options.input4)
+        try:
+            os.system(cmd1)
+            os.system('gunzip -c %s >> %s' %(tmpf.name,options.output1))
+            os.system('gunzip -c %s >> %s' %(tmpr.name,options.output2))
+
+        except Exception, eq:
+            stop_err("Error converting data to fastq format.\n" + str(eq))
+    # if single-end data
+    else:
+        tmpf = tempfile.NamedTemporaryFile()   
+        cmd1 = "bwa_solid2fastq_modified.pl 'no' %s %s %s %s %s %s %s 2>&1" % (tmpf.name, None, None, options.input1, options.input2, None, None)
+        try:
+            os.system(cmd1)
+            os.system('gunzip -c %s >> %s' % (tmpf.name, options.output1))
+            tmpf.close()
+        except Exception, eq:
+            stop_err("Error converting data to fastq format.\n" + str(eq))        
+
+if __name__=="__main__": __main__()
@@ -0,0 +1,101 @@
+<tool id="solid_to_fastq" name="SOLiD-to-FASTQ" version="1.0.0">
+  <description>converts SOLiD data to FASTQ data</description>
+  <command interpreter="python">
+    solid_to_fastq.py 
+    --input1=$input1 
+    --input2=$input2
+    #if $paired.pairedSingle == "single":
+     --input3="None"
+     --input4="None"
+    #else:
+     --input3=$input3
+     --input4=$input4
+    #end if
+    --output1=$output1
+    #if $paired.pairedSingle == "single":
+     --output2="None"
+    #else:
+     --output2=$output2
+    #end if
+  </command>
+  <inputs>
+    <conditional name="paired">
+      <param name="pairedSingle" type="select" label="Is this library mate-paired?">
+        <option value="single">Single</option>
+        <option value="paired">Paired</option>
+      </param>
+      <when value="single">
+        <param name="input1" type="data" format="csfasta" label="F3 read file" />
+        <param name="input2" type="data" format="qualsolid" label="F3 qual file" />
+      </when>
+      <when value="paired">
+        <param name="input1" type="data" format="csfasta" label="F3 read file" />
+        <param name="input2" type="data" format="qualsolid" label="F3 qual file" />
+        <param name="input3" type="data" format="csfasta" label="R3 read file" />
+        <param name="input4" type="data" format="qualsolid" label="R3 qual file" />      
+      </when>
+    </conditional>
+  </inputs>
+  <outputs>
+    <!-- Variable number of outputs. Either one (for single-end) or two (for paired-end) -->
+    <data name="output1" format="tabular"/>
+    <data name="output2" format="tabular">
+      <filter>paired['pairedSingle'] == 'paired'</filter>
+    </data>    
+  </outputs>
+  <tests>
+    <test>
+      <param name="pairedSingle" value="single" />
+      <param name="input1" value="s2fq_phiX.csfasta" ftype="csfasta" />
+      <param name="input2" value="s2fq_phiX.qualsolid" ftype="qualsolid" />
+      <output name="output1" file="s2fq_out1.tabular" />
+    </test>
+    <!-- testing framework does not deal with multiple outputs yet
+    <test>
+      <param name="pairedSingle" value="paired" />
+      <param name="input1" value="s2fq_paired_F3.csfasta" ftype="csfasta" />
+      <param name="input2" value="s2fq_paired_F3_QV.qualsolid" ftype="qualsolid" />
+      <param name="input3" value="s2fq_paired_R3.csfasta" ftype="csfasta" />
+      <param name="input4" value="s2fq_paired_R3_QV.qualsolid" ftype="qualsolid" />
+      <output name="output1" file="s2fq_out2.tabular" />
+      <output name="output2" file="s2fq_out3.tabular" />
+    </test>
+    -->
+  </tests>
+  <help>
+
+**What it does**
+
+This tool takes reads and quality files and converts them to FASTQ data ( Sanger variant ). Note that it also converts sequences to base pairs.
+
+-----
+
+**Example**
+
+- Converting the following sequences::
+
+    >seq1
+    T00030133312212111300011021310132222
+    >seq2
+    T03330322230322112131010221102122113
+
+- and quality scores::
+
+    >seq1
+    4 29 34 34 32 32 24 24 20 17 10 34 29 20 34 13 30 34 22 24 11 28 19 17 34 17 24 17 25 34 7 24 14 12 22 
+    >seq2
+    8 26 31 31 16 22 30 31 28 29 22 30 30 31 32 23 30 28 28 31 19 32 30 32 19 8 32 10 13 6 32 10 6 16 11 
+
+- will produce the following Sanger FASTQ data::
+
+    @seq1
+    AATACTTTCGGCGCCCTAAACCAGCTCACTGGGG
+    +
+    >CCAA9952+C>5C.?C79,=42C292:C(9/-7
+    @seq2
+    TTTATGGGTATGGCCGCTCACAGGCCAGCGGCCT
+    +
+    ;@@17?@=>7??@A8?==@4A?A4)A+.'A+'1,
+
+    </help>
+</tool>