Files
galaxy/static/formatHelp.html
T
2012-11-20 11:42:13 -05:00

666 lines
20 KiB
HTML

<!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.01 Transitional//EN"
"http://www.w3.org/TR/html4/loose.dtd">
<html>
<head>
<title>Galaxy Data Formats</title>
<meta http-equiv="Content-Type" content="text/html; charset=utf-8">
<meta http-equiv="Content-Style-Type" content="text/css">
<style type="text/css">
hr { margin-top: 3ex; margin-bottom: 1ex; border: 1px inset }
</style>
</head>
<body>
<h2>Galaxy Data Formats</h2>
<p>
<br>
<h3>Dataset missing?</h3>
<p>
If you have a dataset in your history that is not appearing in the
drop-down selector for a tool, the most common reason is that it has
the wrong format. Each Galaxy dataset has an associated file format
recorded in its metadata, and tools will only list datasets from your
history that have a format compatible with that particular tool. Of
course some of these datasets might not actually contain relevant
data, or even the correct columns needed by the tool, but filtering
by format at least makes the list to select from a bit shorter.
<p>
Some of the formats are defined hierarchically, going from very
general ones like <a href="#tab">Tabular</a> (which includes any text
file with tab-separated columns), to more restrictive sub-formats
like <a href="#interval">Interval</a> (where three of the columns
must be the chromosome, start position, and end position), and on
to even more specific ones such as <a href="#bed">BED</a> that have
additional requirements. So for example if a tool's required input
format is Tabular, then all of your history items whose format is
recorded as Tabular will be listed, along with those in all
sub-formats that also qualify as Tabular (Interval, BED, GFF, etc.).
<p>
There are two usual methods for changing a dataset's format in
Galaxy: if the file contents are already in the required format but
the metadata is wrong (perhaps because the Auto-detect feature of the
Upload File tool guessed it incorrectly), you can fix the metadata
manually by clicking on the pencil icon beside that dataset in your
history. Or, if the file contents really are in a different format,
Galaxy provides a number of format conversion tools (e.g. in the
Text Manipulation and Convert Formats categories). For instance,
if the tool you want to run requires Tabular but your columns are
delimited by spaces or commas, you can use the "Convert delimiters
to TAB" tool under Text Manipulation to reformat your data. However
if your files are in a completely unsupported format, then you need
to convert them yourself before uploading.
<p>
<hr>
<h3>Format Descriptions</h3>
<ul>
<li><a href="#ab1">AB1</a>
<li><a href="#axt">AXT</a>
<li><a href="#bam">BAM</a>
<li><a href="#bed">BED</a>
<li><a href="#bedgraph">BedGraph</a>
<li><a href="#binseq">Binseq.zip</a>
<li><a href="#fasta">FASTA</a>
<li><a href="#fastqsolexa">FastqSolexa</a>
<li><a href="#fped">FPED</a>
<li><a href="#gd_indivs">gd_indivs</a>
<li><a href="#gd_ped">gd_ped</a>
<li><a href="#gd_sap">gd_sap</a>
<li><a href="#gd_snp">gd_snp</a>
<li><a href="#gff">GFF</a>
<li><a href="#gff3">GFF3</a>
<li><a href="#gtf">GTF</a>
<li><a href="#html">HTML</a>
<li><a href="#interval">Interval</a>
<li><a href="#lav">LAV</a>
<li><a href="#lped">LPED</a>
<li><a href="#maf">MAF</a>
<li><a href="#mastervar">MasterVar</a>
<li><a href="#pbed">PBED</a>
<li><a href="#pgSnp">pgSnp</a>
<li><a href="#psl">PSL</a>
<li><a href="#scf">SCF</a>
<li><a href="#sff">SFF</a>
<li><a href="#table">Table</a>
<li><a href="#tab">Tabular</a>
<li><a href="#txtseqzip">Txtseq.zip</a>
<li><a href="#vcf">VCF</a>
<li><a href="#wig">Wiggle custom track</a>
<li><a href="#text">Other text type</a>
</ul>
<p>
<div><a name="ab1"></a></div>
<hr>
<strong>AB1</strong>
<p>
This is one of the ABIF family of binary sequence formats from
Applied Biosystems Inc.
<!-- Their PDF
<a href="http://www.appliedbiosystems.com/support/software_community/ABIF_File_Format.pdf"
>format specification</a> is unfortunately password-protected. -->
Files should have a '<code>.ab1</code>' file extension. You must
manually select this file format when uploading the file.
<p>
<div><a name="axt"></a></div>
<hr>
<strong>AXT</strong>
<p>
Used for pairwise alignment output from BLASTZ, after post-processing.
Each alignment block contains three lines: a summary line and two
sequence lines. Blocks are separated from one another by blank lines.
The summary line contains chromosomal position and size information
about the alignment, and consists of nine required fields.
<a href="http://main.genome-browser.bx.psu.edu/goldenPath/help/axt.html"
>More information</a>
<!-- (not available on Main)
<dl><dt>Can be converted to:
<dd><ul>
<li>FASTA<br>
Convert Formats &rarr; AXT to FASTA
<li>LAV<br>
Convert Formats &rarr; AXT to LAV
</ul></dl>
-->
<p>
<div><a name="bam"></a></div>
<hr>
<strong>BAM</strong>
<p>
A binary alignment file compressed in the BGZF format with a
'<code>.bam</code>' file extension.
<!-- You must manually select this file format when uploading the file. -->
<a href="http://samtools.sourceforge.net/SAM1.pdf">SAM</a>
is the human-readable text version of this format.
<dl><dt>Can be converted to:
<dd><ul>
<li>SAM<br>
NGS: SAM Tools &rarr; BAM-to-SAM
<li>Pileup<br>
NGS: SAM Tools &rarr; Generate pileup
<li>Interval<br>
First convert to Pileup as above, then use
NGS: SAM Tools &rarr; Pileup-to-Interval
</ul></dl>
<p>
<div><a name="bed"></a></div>
<hr>
<strong>BED</strong>
<p>
<ul>
<li> also qualifies as Tabular
<li> also qualifies as Interval
</ul>
This tab-separated format describes a genomic interval, but has
strict field specifications for use in genome browsers. BED files
can have from 3 to 12 columns, but the order of the columns matters,
and only the end ones can be omitted. Some groups of columns must
be all present or all absent. As in Interval format (but unlike
GFF and its relatives), the interval endpoints use a 0-based,
half-open numbering system.
<a href="http://main.genome-browser.bx.psu.edu/goldenPath/help/hgTracksHelp.html#BED"
>Field specifications</a>
<p>
Example:
<pre>
chr22 1000 5000 cloneA 960 + 1000 5000 0 2 567,488, 0,3512
chr22 2000 6000 cloneB 900 - 2000 6000 0 2 433,399, 0,3601
</pre>
<dl><dt>Can be converted to:
<dd><ul>
<li>GFF<br>
Convert Formats &rarr; BED-to-GFF
</ul></dl>
<p>
<div><a name="bedgraph"></a></div>
<hr>
<strong>BedGraph</strong>
<p>
<ul>
<li> also qualifies as Tabular
<li> also qualifies as Interval
<li> also qualifies as BED
</ul>
<a href="http://main.genome-browser.bx.psu.edu/goldenPath/help/bedgraph.html"
>BedGraph</a> is a BED file with the name column being a float value
that is displayed as a wiggle score in tracks. Unlike in Wiggle
format, the exact value of this score can be retrieved after being
loaded as a track.
<p>
<div><a name="binseq"></a></div>
<hr>
<strong>Binseq.zip</strong>
<p>
A zipped archive consisting of binary sequence files in either AB1
or SCF format. All files in this archive must have the same file
extension which is one of '<code>.ab1</code>' or '<code>.scf</code>'.
You must manually select this file format when uploading the file.
<p>
<div><a name="fasta"></a></div>
<hr>
<strong>FASTA</strong>
<p>
A sequence in
<a href="http://www.ncbi.nlm.nih.gov/blast/fasta.shtml">FASTA</a>
format consists of a single-line description, followed by lines of
sequence data. The first character of the description line is a
greater-than ('<code>&gt;</code>') symbol. All lines should be
shorter than 80 characters.
<pre>
>sequence1
atgcgtttgcgtgc
gtcggtttcgttgc
>sequence2
tttcgtgcgtatag
tggcgcggtga
</pre>
<dl><dt>Can be converted to:
<dd><ul>
<li>Tabular<br>
Convert Formats &rarr; FASTA-to-Tabular
</ul></dl>
<p>
<div><a name="fastqsolexa"></a></div>
<hr>
<strong>FastqSolexa</strong>
<p>
<a href="http://maq.sourceforge.net/fastq.shtml">FastqSolexa</a>
is the Illumina (Solexa) variant of the FASTQ format, which stores
sequences and quality scores in a single file.
<pre>
@seq1
GACAGCTTGGTTTTTAGTGAGTTGTTCCTTTCTTT
+seq1
hhhhhhhhhhhhhhhhhhhhhhhhhhPW@hhhhhh
@seq2
GCAATGACGGCAGCAATAAACTCAACAGGTGCTGG
+seq2
hhhhhhhhhhhhhhYhhahhhhWhAhFhSIJGChO
</pre>
Or
<pre>
@seq1
GAATTGATCAGGACATAGGACAACTGTAGGCACCAT
+seq1
40 40 40 40 35 40 40 40 25 40 40 26 40 9 33 11 40 35 17 40 40 33 40 7 9 15 3 22 15 30 11 17 9 4 9 4
@seq2
GAGTTCTCGTCGCCTGTAGGCACCATCAATCGTATG
+seq2
40 15 40 17 6 36 40 40 40 25 40 9 35 33 40 14 14 18 15 17 19 28 31 4 24 18 27 14 15 18 2 8 12 8 11 9
</pre>
<dl><dt>Can be converted to:
<dd><ul>
<li>FASTA<br>
NGS: QC and manipulation &rarr; Generic FASTQ manipulation &rarr; FASTQ to FASTA
<li>Tabular<br>
NGS: QC and manipulation &rarr; Generic FASTQ manipulation &rarr; FASTQ to Tabular
</ul></dl>
<p>
<div><a name="fped"></a></div>
<hr>
<strong>FPED</strong>
<p>
Also known as the FBAT format, for use with the
<a href="http://biosun1.harvard.edu/~fbat/fbat.htm">FBAT</a> program.
It consists of a pedigree file and a phenotype file.
<p>
<div><a name="gd_indivs"></a></div>
<hr>
<strong>ind</strong>
<p>
This format is a tabular file with the first column being the column number
(1 based)
from the gd_snp file where the individual/group starts. The second column is
the label from the metadata for the individual/group. The third is an alias
or blank.
<p>
<div><a name="gd_sap"></a></div>
<hr>
<strong>gd_sap</strong>
<p>
This is a tabular file describing single amino-acid polymorphisms (SAPs).
You must manually select this file format when uploading the file.
<!--
<a href="http://www.bx.psu.edu/miller_lab/docs/formats/gd_sap_format.html"
>Field specifications</a>
-->
<p>
<div><a name="gd_snp"></a></div>
<hr>
<strong>gd_snp</strong>
<p>
This is a tabular file describing SNPs in individuals or populations.
It contains the zero-based position of the SNP but not the range
required by BED or interval so can not be used in Genomic Operations without
adding an column for the end position.
You must manually select this file format when uploading the file.
<a href="http://www.bx.psu.edu/miller_lab/docs/formats/gd_snp_format.html"
>Field specifications</a>
<p>
<div><a name="gff"></a></div>
<hr>
<strong>GFF</strong>
<p>
<ul>
<li> also qualifies as Tabular
</ul>
GFF is a tab-separated format somewhat similar to BED, but it has
different columns and is more flexible. There are
<a href="http://main.genome-browser.bx.psu.edu/FAQ/FAQformat#format3"
>nine required fields</a>.
Note that unlike Interval and BED, GFF and its relatives (GFF3, GTF)
use 1-based inclusive coordinates to specify genomic intervals.
<dl><dt>Can be converted to:
<dd><ul>
<li>BED<br>
Convert Formats &rarr; GFF-to-BED
</ul></dl>
<p>
<div><a name="gff3"></a></div>
<hr>
<strong>GFF3</strong>
<p>
<ul>
<li> also qualifies as Tabular
</ul>
The <a href="http://www.sequenceontology.org/gff3.shtml">GFF3</a>
format addresses the most common extensions to GFF, while attempting
to preserve compatibility with previous formats.
Note that unlike Interval and BED, GFF and its relatives (GFF3, GTF)
use 1-based inclusive coordinates to specify genomic intervals.
<p>
<div><a name="gtf"></a></div>
<hr>
<strong>GTF</strong>
<p>
<ul>
<li> also qualifies as Tabular
</ul>
<a href="http://main.genome-browser.bx.psu.edu/FAQ/FAQformat#format4"
>GTF</a> is a format for describing genes and other features associated
with DNA, RNA, and protein sequences. It is a refinement to GFF that
tightens the specification.
Note that unlike Interval and BED, GFF and its relatives (GFF3, GTF)
use 1-based inclusive coordinates to specify genomic intervals.
<!-- (not available on Main)
<dl><dt>Can be converted to:
<dd><ul>
<li>BedGraph<br>
Convert Formats &rarr; GTF-to-BEDGraph
</ul></dl>
-->
<p>
<div><a name="html"></a></div>
<hr>
<strong>HTML</strong>
<p>
This format is an HTML web page. Click the eye icon next to the
dataset to view it in your browser.
<p>
<div><a name="interval"></a></div>
<hr>
<strong>Interval</strong>
<p>
<ul>
<li> also qualifies as Tabular
</ul>
This Galaxy format represents genomic intervals. It is tab-separated,
but has the added requirement that three of the columns must be the
chromosome name, start position, and end position, where the positions
use a 0-based, half-open numbering system (see below). An optional
strand column can also be specified, and an initial header row can
be used to label the columns, which do not have to be in any special
order. Arbitrary additional columns can also be present.
<p>
Required fields:
<ul>
<li>CHROM - The name of the chromosome (e.g. chr3, chrY, chr2_random)
or contig (e.g. ctgY1).
<li>START - The starting position of the feature in the chromosome or
contig. The first base in a chromosome is numbered 0.
<li>END - The ending position of the feature in the chromosome or
contig. This base is not included in the feature. For example,
the first 100 bases of a chromosome are described as START=0,
END=100, and span the bases numbered 0-99.
</ul>
Optional:
<ul>
<li>STRAND - Defines the strand, either '<code>+</code>' or
'<code>-</code>'.
<li>Header row
</ul>
Example:
<pre>
#CHROM START END STRAND NAME COMMENT
chr1 10 100 + exon myExon
chrX 1000 10050 - gene myGene
</pre>
<dl><dt>Can be converted to:
<dd><ul>
<li>BED<br>
The exact changes needed and tools to run will vary with what fields
are in the Interval file and what type of BED you are converting to.
In general you will likely use Text Manipulation &rarr; Compute, Cut,
or Merge Columns.
</ul></dl>
<p>
<div><a name="lav"></a></div>
<hr>
<strong>LAV</strong>
<p>
<a href="http://www.bx.psu.edu/miller_lab/dist/lav_format.html">LAV</a>
is the raw pairwise alignment format that is output by BLASTZ. The
first line begins with <code>#:lav</code>.
<!-- (not available on Main)
<dl><dt>Can be converted to:
<dd><ul>
<li>BED<br>
Convert Formats &rarr; LAV to BED
</ul></dl>
-->
<p>
<div><a name="lped"></a></div>
<hr>
<strong>LPED</strong>
<p>
This is the linkage pedigree format, which consists of separate MAP and PED
files. Together these files describe SNPs; the map file contains the position
and an identifier for the SNP, while the pedigree file has the alleles. To
upload this format into Galaxy, do not use Auto-detect for the file format;
instead select <code>lped</code>. You will then be given two sections for
uploading files, one for the pedigree file and one for the map file. For more
information, see
<a href="http://www.broadinstitute.org/science/programs/medical-and-population-genetics/haploview/input-file-formats-0"
>linkage pedigree</a>,
<a href="http://pngu.mgh.harvard.edu/~purcell/plink/data.shtml#map">MAP</a>,
and/or <a href="http://pngu.mgh.harvard.edu/~purcell/plink/data.shtml#ped">PED</a>.
<dl><dt>Can be converted to:
<dd><ul>
<li>PBED<br>Automatic
<li>FPED<br>Automatic
</ul></dl>
<p>
<div><a name="maf"></a></div>
<hr>
<strong>MAF</strong>
<p>
<a href="http://main.genome-browser.bx.psu.edu/FAQ/FAQformat#format5"
>MAF</a> is the multi-sequence alignment format that is output by TBA
and Multiz. The first line begins with '<code>##maf</code>'. This
word is followed by whitespace-separated "variable<code>=</code>value"
pairs. There should be no whitespace surrounding the '<code>=</code>'.
<dl><dt>Can be converted to:
<dd><ul>
<li>BED<br>
Convert Formats &rarr; MAF to BED
<li>Interval<br>
Convert Formats &rarr; MAF to Interval
<li>FASTA<br>
Convert Formats &rarr; MAF to FASTA
</ul></dl>
<p>
<div><a name="mastervar"></a></div>
<hr>
<strong>MasterVar</strong>
<p>
MasterVar is a tab delimited text format with specified fields developed
by the Complete Genomics life sciences company.
<a href="http://media.completegenomics.com/documents/DataFileFormats_Standard_Pipeline_2.2.pdf"
>Field specifications</a>.
<dl><dt>Can be converted to:
<dd><ul>
<li>pgSnp<br>
Convert Formats &rarr; MasterVar to pgSnp
<li>gd_snp<br>
Convert Formats &rarr; MasterVar to gd_snp
</ul></dl>
<p>
<div><a name="pbed"></a></div>
<hr>
<strong>PBED</strong>
<p>
This is the binary version of the LPED format.
<dl><dt>Can be converted to:
<dd><ul>
<li>LPED<br>Automatic
</ul></dl>
<p>
<div><a name="pgSnp"></a></div>
<hr>
<strong>pgSnp</strong>
<p>
This is the personal genome SNP format used by UCSC. It is a BED-like
format with columns chosen for the specialized display in the browser
for personal genomes.
<a href="http://genome.ucsc.edu/FAQ/FAQformat.html#format10"
>Field specifications</a>.
Galaxy treats it the same as an interval file.
<p>
<div><a name="psl"></a></div>
<hr>
<strong>PSL</strong>
<p>
<a href="http://main.genome-browser.bx.psu.edu/FAQ/FAQformat#format2">PSL</a>
format is used for alignments returned by
<a href="http://genome.ucsc.edu/cgi-bin/hgBlat?command=start">BLAT</a>.
It does not include any sequence.
<p>
<div><a name="scf"></a></div>
<hr>
<strong>SCF</strong>
<p>
This is a binary sequence format originally designed for the Staden
sequence handling software package. Files should have a
'<code>.scf</code>' file extension. You must manually select this
file format when uploading the file.
<a href="http://staden.sourceforge.net/manual/formats_unix_2.html"
>More information</a>
<p>
<div><a name="sff"></a></div>
<hr>
<strong>SFF</strong>
<p>
This is a binary sequence format used by the Roche 454 GS FLX
sequencing machine, and is documented on p.&nbsp;528 of their
<a href="http://sequence.otago.ac.nz/download/GS_FLX_Software_Manual.pdf"
>software manual</a>. Files should have a '<code>.sff</code>' file
extension.
<!-- You must manually select this file format when uploading the file. -->
<dl><dt>Can be converted to:
<dd><ul>
<li>FASTA<br>
Convert Formats &rarr; SFF converter
<li>FASTQ<br>
Convert Formats &rarr; SFF converter
</ul></dl>
<p>
<div><a name="table"></a></div>
<hr>
<strong>Table</strong>
<p>
Text data separated into columns by something other than tabs.
<p>
<div><a name="tab"></a></div>
<hr>
<strong>Tabular (tab-delimited)</strong>
<p>
One or more columns of text data separated by tabs.
<dl><dt>Can be converted to:
<dd><ul>
<li>FASTA<br>
Convert Formats &rarr; Tabular-to-FASTA<br>
The Tabular file must have a title and sequence column.
<li>FASTQ<br>
NGS: QC and manipulation &rarr; Generic FASTQ manipulation &rarr; Tabular to FASTQ
<li>Interval<br>
If the Tabular file has a chromosome column (or is all on one
chromosome) and has a position column, you can create an Interval
file (e.g. for SNPs). If it is all on one chromosome, use
Text Manipulation &rarr; Add column to add a CHROM column.
If the given position is 1-based, use
Text Manipulation &rarr; Compute with the position column minus 1 to
get the START, and use the original given column for the END.
If the given position is 0-based, use it as the START, and compute
that plus 1 to get the END.
</ul></dl>
<p>
<div><a name="txtseqzip"></a></div>
<hr>
<strong>Txtseq.zip</strong>
<p>
A zipped archive consisting of flat text sequence files. All files
in this archive must have the same file extension of
'<code>.txt</code>'. You must manually select this file format when
uploading the file.
<p>
<div><a name="vcf"></a></div>
<hr>
<strong>VCF</strong>
<p>
Variant Call Format (VCF) is a tab delimited text file with specified
fields. It was developed by the 1000 Genomes Project.
<a href="http://www.1000genomes.org/wiki/Analysis/Variant%20Call%20Format/vcf-variant-call-format-version-41"
>Field specifications</a>.
<dl><dt>Can be converted to:
<dd><ul>
<li>pgSnp<br>
Convert Formats &rarr; VCF to pgSnp
</ul></dl>
<p>
<div><a name="wig"></a></div>
<hr>
<strong>Wiggle custom track</strong>
<p>
Wiggle tracks are typically used to display per-nucleotide scores
in a genome browser. The Wiggle format for custom tracks is
line-oriented, and the wiggle data is preceded by a track definition
line that specifies which of three different types is being used.
<a href="http://main.genome-browser.bx.psu.edu/goldenPath/help/wiggle.html"
>More information</a>
<dl><dt>Can be converted to:
<dd><ul>
<li>Interval<br>
Get Genomic Scores &rarr; Wiggle-to-Interval
<li>As a second step this could be converted to 3- or 4-column BED,
by removing extra columns using
Text Manipulation &rarr; Cut columns from a table.
</ul></dl>
<p>
<div><a name="gd_ped"></a></div>
<hr>
<strong>gd_ped</strong>
<p>
Similar to the linkage pedigree format (lped).
<p>
<div><a name="text"></a></div>
<hr>
<strong>Other text type</strong>
<p>
Any text file.
<dl><dt>Can be converted to:
<dd><ul>
<li>Tabular<br>
If the text has fields separated by spaces, commas, or some other
delimiter, it can be converted to Tabular by using
Text Manipulation &rarr; Convert delimiters to TAB.
</ul></dl>
<p>
<!-- blank lines so internal links will jump farther to end -->
<br><br><br><br><br><br><br><br><br><br><br><br>
<br><br><br><br><br><br><br><br><br><br><br><br>
</body>
</html>