mirror of
https://github.com/galaxyproject/galaxy.git
synced 2026-09-24 16:30:27 +08:00
70 lines
2.8 KiB
XML
70 lines
2.8 KiB
XML
<tool id="Extract genomic DNA 1" name="Extract genomic DNA">
|
|
<description>using coordinates from assembled genomes</description>
|
|
<command interpreter="perl">fasta-subseq-wrapper.pl -i $input -o $out_file1 -p $input_chromCol $input_startCol $input_endCol $input_strandCol -g $dbkey -f $out_format</command>
|
|
<inputs>
|
|
<param format="interval" name="input" type="data" label="Fetch sequences corresponding to Query"/>
|
|
<param name="out_format" type="select" label="Output Type">
|
|
<option value="0">FASTA</option>
|
|
<option value="1">Interval</option>
|
|
</param>
|
|
</inputs>
|
|
<outputs>
|
|
<data format="fasta" name="out_file1" />
|
|
</outputs>
|
|
<code file="fasta-subseq-wrapper_code.py" />
|
|
<tests>
|
|
<test>
|
|
<param name="input" value="1.bed" dbkey="hg17" ftype="bed" />
|
|
<param name="out_format" value="0"/>
|
|
<output name="out_file1" file="fsa_extract_genomic_dna.dat" />
|
|
</test>
|
|
</tests>
|
|
<help>
|
|
|
|
.. class:: warningmark
|
|
|
|
Make sure that the genome build is specified for the interval dataset you are extracting sequences for (click the pencil icon if it is not specified). However, if the build is specified and the tool still gives you an error, your genome of interest may only be partially assembled (ie, in scaffolds). To extract sequences from such partially assembled genomes use *Extract Genomic DNA from unassmebled genomes* tool.
|
|
|
|
.. class:: infomark
|
|
|
|
Why do we have two sequence extractors?
|
|
|
|
* **Extract genomic DNA using coordinates from ASSEMBLED genomes** (this tool) - will work for most cases when your intervals are located on assembled chromosomes (i.e., chr1, chrX, etc.)
|
|
* **Extract genomic DNA using coordinates from UNassembled genomes** - is designed to work on partially assembled or unassembled genomes when your intervals are located in contigs or scaffolds rather than assembled chromosomes (i.e., super_1 etc.)
|
|
|
|
These two tools will be merged in the future.
|
|
|
|
-----
|
|
|
|
**What it does**
|
|
|
|
This tool uses coordinate, strand, and build information to fetch genomic DNAs in FASTA format.
|
|
|
|
-----
|
|
|
|
**Example**
|
|
|
|
Input dataset::
|
|
|
|
chr7 127475281 127475310 NM_000230 0 +
|
|
chr7 127485994 127486166 NM_000230 0 +
|
|
chr7 127486011 127486166 D49487 0 +
|
|
|
|
Fetch genomic DNAs of the above data::
|
|
|
|
>hg17_chr7_127475281_127475310_+
|
|
GTAGGAATCGCAGCGCCAGCGGTTGCAAG
|
|
>hg17_chr7_127485994_127486166_+
|
|
GCCCAAGAAGCCCATCCTGGGAAGGAAAATGCATTGGGGAACCCTGTGCG
|
|
GATTCTTGTGGCTTTGGCCCTATCTTTTCTATGTCCAAGCTGTGCCCATC
|
|
CAAAAAGTCCAAGATGACACCAAAACCCTCATCAAGACAATTGTCACCAG
|
|
GATCAATGACATTTCACACACG
|
|
>hg17_chr7_127486011_127486166_+
|
|
TGGGAAGGAAAATGCATTGGGGAACCCTGTGCGGATTCTTGTGGCTTTGG
|
|
CCCTATCTTTTCTATGTCCAAGCTGTGCCCATCCAAAAAGTCCAAGATGA
|
|
CACCAAAACCCTCATCAAGACAATTGTCACCAGGATCAATGACATTTCAC
|
|
ACACG
|
|
|
|
</help>
|
|
</tool>
|