Files
galaxy/tools/sr_mapping/PerM.xml
T
Nicola Soranzo f865e8359f Deprecate size attribute of <param/> and remove it from tools
Also:
- dos2unix test/functional/tools/for_workflows/head.xml
- Single-quote text and data params in `<command/>`
- Remove deprecated `interpreter` attribute of `<command />`
2018-09-10 11:34:37 +01:00

370 lines
19 KiB
XML

<tool id="PerM" name="Map with PerM" version="1.1.2">
<description>for SOLiD and Illumina</description>
<!-- works with PerM version 0.2.6 -->
<requirements>
<requirement type="package">perm</requirement>
</requirements>
<command>
echo -n "PerM "; PerM 2>&amp;1 | grep "Version";
PerM
#if $s.sourceOfRef.refSource == "history"
$s.sourceOfRef.ref
#else
#if $s.space == "color"
"${s.sourceOfRef.index.fields.path}"
#elif $s.space == "base"
"${s.sourceOfRef.index.fields.path}"
#end if
#end if
#if $s.mate.singleOrPairs == "single":
$s.mate.reads
#else:
-1 $s.mate.reads1 -2 $s.mate.reads2
-U $s.mate.upperbound
-L $s.mate.lowerbound
$s.mate.excludeAmbiguousPairs
#end if
#if $s.space == "color":
--readFormat "csfastq"
#else:
--readFormat "fastq"
#end if
#if $int($str($valAlign)) &gt;= 0
-v $valAlign
#end if
#if $align.options == "full":
--seed $align.seed
-$align.alignments
#if $str($align.delimiter) != "None"
--delimiter $align.delimiter
#end if
-T $align.sTrimL
$align.includeReadsWN
$align.statsOnly
$align.ignoreQS
#end if
#if $str($bUnmappedRead) == "true" and $s.space == "color"
-u $unmappedReadOutCS
#elif $str($bUnmappedRead) == "true" and $s.space == "base"
-u $unmappedReadOut
#end if
-o $output
--outputFormat sam
--noSamHeader | tr '\r' '\n' | tr -cd "[:print:]\t\n " | grep "Reads\|Sub0\|Pairs\|single" | sed 's/.*Reads:,//' | sed 's/\/.*dat,_ Sub0/Sub0/'
</command>
<inputs>
<conditional name="s">
<param name="space" label="Is your data color space (SOLiD) or base space (Illumina)?" type="select">
<option value="color">Color space</option>
<option value="base">Base space</option>
</param>
<when value="color">
<conditional name="sourceOfRef">
<param name="refSource" label="Will you provide your own reference file from the history or use a built-in index?" type="select">
<option value="indexed">Built-in index</option>
<option value="history">Fasta file from history</option>
</param>
<when value="indexed">
<param name="index" type="select" label="Select a reference genome (with seed and read length)" help="if your genome of interest is not listed - contact Galaxy team">
<options from_data_table="perm_color_indexes"/>
</param>
</when>
<when value="history">
<param name="ref" format="fasta" type="data" label="Reference" />
</when>
</conditional>
<conditional name="mate">
<param name="singleOrPairs" label="Mate-paired?" type="select">
<option value="single">Single-end</option>
<option value="paired">Mate pairs</option>
</param>
<when value="single">
<param format="fastqcssanger" name="reads" type="data" label="Reads" />
</when>
<when value="paired">
<param name="reads1" format="fastqcssanger" label="Forward FASTQ file" type="data" />
<param name="reads2" format="fastqcssanger" label="Reverse FASTQ file" type="data" />
<param label="Upperbound of pairs separation (-U)" name="upperbound" type="integer" value="100000" />
<param label="Lowerbound of pairs separation (-L)" name="lowerbound" type="integer" value="0" />
<param label="Exclude ambiguous pairs (-e)" name="excludeAmbiguousPairs" type="boolean" checked="false" truevalue="-e" falsevalue="" />
</when>
</conditional>
</when>
<when value="base">
<conditional name="sourceOfRef">
<param name="refSource" label="Will you provide your own reference file from the history or use a built-in index?" type="select">
<option value="indexed">Built-in index</option>
<option value="history">Fasta file from history</option>
</param>
<when value="indexed">
<param name="index" type="select" label="Select a reference genome with seed and read length" help="if your genome of interest is not listed - contact Galaxy team">
<options from_data_table="perm_base_indexes"/>
</param>
</when>
<when value="history">
<param name="ref" format="fasta" type="data" label="Reference" />
</when>
</conditional>
<conditional name="mate">
<param name="singleOrPairs" label="Mate-paired?" type="select">
<option value="single">Single-end</option>
<option value="paired">Mate pairs</option>
</param>
<when value="single">
<param format="fastqsanger" name="reads" type="data" label="Reads" />
</when>
<when value="paired">
<param name="reads1" format="fastqsanger" label="Forward FASTQ file" type="data" />
<param name="reads2" format="fastqsanger" label="Reverse FASTQ file" type="data" />
<param label="Upperbound of pairs separation (-U)" name="upperbound" type="integer" value="100000" />
<param label="Lowerbound of pairs separation (-L)" name="lowerbound" type="integer" value="0" />
<param label="Exclude ambiguous pairs (-e)" name="excludeAmbiguousPairs" type="boolean" checked="false" truevalue="-e" falsevalue="" />
</when>
</conditional>
</when>
</conditional>
<param label="Maximum number of mismatches permitted in one end of full read (-v)" name="valAlign" type="integer" value="2" />
<conditional name="align">
<param help="Use default setting or specify full parameters list" label="PerM settings to use" name="options" type="select">
<option value="preSet">Commonly used</option>
<option value="full">Full parameter list</option>
</param>
<when value="preSet"/>
<when value="full">
<param label="Whether or not to report all valid alignments per read (-A/-B/-E)" name="alignments" type="select">
<option value="A">Report all valid alignments</option>
<option value="B">Report the best alignments in terms of number of mismatches</option>
<option value="E">Report only uniquely mapped reads</option>
</param>
<param label="Choose the seed full sensitive to different number of mismatches (--seed)" name="seed" type="select" >
<option value="F2">2 mismatches</option>
<option value="S11">1 SNP + 1 color error</option>
<option value="F3">3 mismatches</option>
<option value="F4">4 mismatches</option>
</param>
<param label="Choose the delimiter to identify read name (--delimiter)" name="delimiter" type="select">
<option value="None">Tab/Space/Comma</option>
<option value=":">Colon</option>
<option value="_">Underscore</option>
</param>
<param name="sTrimL" type="integer" value="50" label="Use the first n bases of each read for alignment (-T)" />
<param name="includeReadsWN" type="boolean" checked="true" truevalue="--includeReadsWN" falsevalue="" label="Include reads with 'N' or '.' by encoding '.' as 3, 'N' as 'A' (--includeReadsWN)" />
<param name="statsOnly" type="boolean" checked="false" truevalue="--statsOnly" falsevalue="" label="Output mapping stats only. Don't output alignments (--statsOnly)" />
<param name="ignoreQS" type="boolean" checked="false" truevalue="--ignoreQS" falsevalue="" label="Ignore quality scores (--ignoreQS)" />
</when>
</conditional> <!-- options -->
<param name="bUnmappedRead" type="select" label="Output the unmapped reads (-u)">
<option value="true">Yes</option>
<option value="false">No</option>
</param>
</inputs>
<outputs>
<data format="sam" name="output" label="${tool.name} on ${on_string}: mapped reads" />
<data format="fastqsanger" name="unmappedReadOut" label="${tool.name} on ${on_string}: unmapped reads">
<filter>bUnmappedRead == "true" and s["space"] == "base"</filter>
</data>
<data format="fastqcssanger" name="unmappedReadOutCS" label="${tool.name} on ${on_string}: unmapped reads">
<filter>bUnmappedRead == "true" and s["space"] == "color"</filter>
</data>
</outputs>
<tests>
<test>
<!--
PerM command:
PerM /afs/bx.psu.edu/depot/data/genome/phiX/perm_index/phiX_base_F3_50.index -1 test-data/perm_in1.fastqsanger -2 test-data/perm_in2.fastqsanger -U 100000 -L 0 -e +readFormat fastq -v 0 +seed F3 -A -T 50 +includeReadsWN -o perm_out1.sam +outputFormat sam +noSamHeader | tr '\r' '\n' | tr -cd "[:print:]\t\n " | grep "Reads\|Sub0\|Pairs\|single" | sed 's/.*Reads:,//' | sed 's/\/.*dat,_ Sub0/Sub0/'
You need to replace the + with 2 dashes.
-->
<param name="space" value="base" />
<param name="refSource" value="indexed" />
<param name="index" value="phiX_F3_50" />
<param name="singleOrPairs" value="paired" />
<param name="reads1" value="perm_in1.fastqsanger" ftype="fastqsanger" />
<param name="reads2" value="perm_in2.fastqsanger" ftype="fastqsanger" />
<param name="upperbound" value="100000" />
<param name="lowerbound" value="0" />
<param name="excludeAmbiguousPairs" value="true" />
<param name="valAlign" value="0" />
<param name="options" value="full" />
<param name="alignments" value="A" />
<param name="seed" value="F3" />
<param name="delimiter" value="None" />
<param name="sTrimL" value="50" />
<param name="includeReadsWN" value="true" />
<param name="statsOnly" value="false" />
<param name="ignoreQS" value="false" />
<param name="bUnmappedRead" value="false" />
<output name="output" file="perm_out1.sam" ftype="sam" />
</test>
<test>
<!--
PerM command:
PerM test-data/chr_m.fasta test-data/perm_in3.fastqsanger +readFormat fastq -v 2 -u perm_out3.fastqsanger -o perm_out2.sam +outputFormat sam +noSamHeader | tr '\r' '\n' | tr -cd "[:print:]\t\n " | grep "Reads\|Sub0\|Pairs\|single" | sed 's/.*Reads:,//' | sed 's/\/.*dat,_ Sub0/Sub0/'
You need to replace the + with 2 dashes.
-->
<param name="space" value="base" />
<param name="refSource" value="history" />
<param name="ref" value="chr_m.fasta" ftype="fasta" />
<param name="singleOrPairs" value="single" />
<param name="reads" value="perm_in3.fastqsanger" ftype="fastqsanger" />
<param name="valAlign" value="2" />
<param name="options" value="preSet" />
<param name="bUnmappedRead" value="true" />
<output name="output" file="perm_out2.sam" ftype="sam" />
<output name="unmappedReadOut" file="perm_out3.fastqsanger" ftype="fastqsanger" />
</test>
<test>
<!--
PerM command:
PerM test-data/phiX.fasta test-data/perm_in4.fastqcssanger +readFormat csfastq -v 1 -o perm_out4.sam +outputFormat sam +noSamHeader | tr '\r' '\n' | tr -cd "[:print:]\t\n " | grep "Reads\|Sub0\|Pairs\|single" | sed 's/.*Reads:,//' | sed 's/\/.*dat,_ Sub0/Sub0/'
You need to replace the + with 2 dashes.
-->
<param name="space" value="color" />
<param name="refSource" value="history" />
<param name="ref" value="phiX.fasta" ftype="fasta" />
<param name="singleOrPairs" value="single" />
<param name="reads" value="perm_in4.fastqcssanger" ftype="fastqcssanger" />
<param name="valAlign" value="1" />
<param name="options" value="preSet" />
<param name="bUnmappedRead" value="false" />
<output name="output" file="perm_out4.sam" ftype="sam" />
</test>
<test>
<!--
PerM command:
PerM /afs/bx.psu.edu/depot/data/genome/equCab2/perm_index/equCab2_chrM_color_F2_50.index -1 test-data/perm_in5.fastqcssanger -2 test-data/perm_in6.fastqcssanger -U 90000 -L 10000 +readFormat csfastq -v 3 +seed F2-o perm_out5.sam +outputFormat sam +noSamHeader | tr '\r' '\n' | tr -cd "[:print:]\t\n " | grep "Reads\|Sub0\|Pairs\|single" | sed 's/.*Reads:,//' | sed 's/\/.*dat,_ Sub0/Sub0/'
You need to replace the + with 2 dashes.
-->
<param name="space" value="color" />
<param name="refSource" value="indexed" />
<param name="index" value="equCab2_chrM_F2_50" />
<param name="singleOrPairs" value="paired" />
<param name="reads1" value="perm_in5.fastqcssanger" ftype="fastqcssanger" />
<param name="reads2" value="perm_in6.fastqcssanger" ftype="fastqcssanger" />
<param name="upperbound" value="90000" />
<param name="lowerbound" value="10000" />
<param name="excludeAmbiguousPairs" value="false" />
<param name="valAlign" value="3" />
<param name="options" value="preSet" />
<param name="bUnmappedRead" value="false" />
<output name="output" file="perm_out5.sam" ftype="sam" />
</test>
</tests>
<help>
**What it does**
PerM is a short read aligner designed to be ultrafast with long SOLiD reads to the whole genome or transcriptions. PerM can be fully sensitive to alignments with up to four mismatches and highly sensitive to a higher number of mismatches.
**Development team**
PerM is developed by Ting Chen's group, Center of Excellence in Genomic Sciences at the University of Southern California. If you have any questions, please email yanghoch at usc.edu or check the `project page`__.
.. __: http://code.google.com/p/perm/
**Citation**
PerM: Efficient mapping of short sequencing reads with periodic full sensitive spaced seeds. Bioinformatics, 2009, 25 (19): 2514-2521.
**Input**
The input files are read files and a reference. Users can use the pre-indexed reference in Galaxy or upload their own reference.
The uploaded reference file should be in the fasta format. Multiple sequences like transcriptions should be concatenated together separated by a header line that starts with the ">" character.
Reads files must be in either fastqsanger or fastqcssanger format to use in PerM. However, there are several possible starting formats that can be converted to one of those two: fastq (any type), color-space fastq, fasta, csfasta, or csfasta+qualsolid.
An uploaded base-space fastq file MUST be checked/transformed with FASTQGroomer tools in Galaxy to be converted to the fastqsanger format (this is true even if the original file is in Sanger format).
Uploaded fasta and csfasta without quality score files can be transformed to fastqsanger by the FASTQGroomer, with pseudo quality scores added.
An uploaded csfasta + qual pair can also be transformed into fastqcssanger by solid2fastq.
**Outputs**
The output mapping result is in SAM format, and has the following columns::
Column Description
-------- --------------------------------------------------------
1 QNAME Query (pair) NAME
2 FLAG bitwise FLAG
3 RNAME Reference sequence NAME
4 POS 1-based leftmost POSition/coordinate of clipped sequence
5 MAPQ MAPping Quality (Phred-scaled)
6 CIGAR extended CIGAR string
7 MRNM Mate Reference sequence NaMe ('=' if same as RNAME)
8 MPOS 1-based Mate POSition
9 ISIZE Inferred insert SIZE
10 SEQ query SEQuence on the same strand as the reference
11 QUAL query QUALity (ASCII-33 gives the Phred base quality)
12 OPT variable OPTional fields in the format TAG:VTYPE:VALUE
12.1 NM Number of mismatches (SOLiD-specific)
12.2 CS Reads in color space (SOLiD-specific)
12.3 CQ Bases quality in color spacehidden="true" (SOLiD-specific)
The flags are as follows::
Flag Description
------ -------------------------------------
0x0001 the read is paired in sequencing
0x0002 the read is mapped in a proper pair
0x0004 the query sequence itself is unmapped
0x0008 the mate is unmapped
0x0010 strand of the query (1 for reverse)
0x0020 strand of the mate
0x0040 the read is the first read in a pair
0x0080 the read is the second read in a pair
0x0100 the alignment is not primary
Here is some sample output::
Qname FLAG Rname POS MAPQ CIAGR MRNM MPOS ISIZE SEQ QUAL NM CS CQ
491_28_332_F3 16 ref-1 282734 255 35M * 0 0 AGTCAAACTCCGAATGCCAATGACTTATCCTTAGG #%%%%%%%!!%%%!!%%%%%%%%!!%%%%%%%%%% NM:i:3 CS:Z:C0230202330012130103100230121001212 CQ:Z:###################################
491_28_332_F3 16 ref-1 269436 255 35M * 0 0 AGTCAAACTCCGAATGCCAATGACTTATCCTTAGG #%%%%%%%!!%%%!!%%%%%%%%!!%%%%%%%%%% NM:i:3 CS:Z:C0230202330012130103100230121001212 CQ:Z:###################################
The user can check a checkbox for optional output containing the unmmaped reads in fastqsanger or fastqcssanger. The default is to produce it.
**PerM parameter list**
Below is a list of PerM command line options for PerM. Not all of these are relevant to Galaxy's implementation, but are included for completeness.
The command for single-end::
PerM [ref_or_index] [read] [options]
The command for paired-end::
PerM [ref_or_index] -1 [read1] -2 [read1] [options]
The command-line options::
-A Output all alignments within the given mismatch threshold, end-to-end.
-B Output best alignments in terms of mismatches in the given mismatch threshold. [Default]
-E Output only the uniquely mapped reads in the given mismatch threshold.
-m Create the reference index, without reusing the saved index.
-s PATH Save the reference index to accelerate the mapping in the future. If PATH is not specified, the default path will be used.
-v INT Where INT is the number of mismatches allowed in one end. [Default=2]
-T INT Where INT is the length to truncate read length to, so 30 means use only first 30 bases (signals). Leave blank if the full read is meant to be used.
-o PATH Where PATH is for output the mapping of one read set. PerM's output are in .mapping or .sam format, determined by the ext name of PATH. Ex: -o out.sam will output in SAM format; -o out.mapping will output in .mapping format.
-d PATH Where PATH is the directory for multiple read sets.
-u PATH Print the fastq file of those unmapped reads to the file in PATH.
--noSamHeader Print no SAM header so it is convenient to concatenate multiple SAM output files.
--includeReadsWN Encodes N or "." with A or 3, respectively.
--statsOnly Output the mapping statistics in stdout only, without saving alignments to files.
--ignoreQS Ignore the quality scores in fastq or QUAL files.
--seed {F2 | S11 | F3 | F4} Specify the seed pattern, which has a specific full sensitivity. Check the algorithm page (link below) for seed patterns to balance the sensitivity and running time.
--readFormat {fasta | fastq | csfasta | csfastq} Read in reads in the specified format, instead of guessing according to the extension name.
--delimiter CHAR Which is a character used as the delimiter to separate the the read id, and the additional info in the line with ">" in fasta or csfasta.
Paired reads options::
-e Exclude ambiguous paired.
-L INT Mate-paired separate lower bound.
-U INT Mate-paired separate upper bound.
-1 PATH The forward reads file path.
-2 PATH The reversed reads file path.
See the PerM `algorithm page`__ for information on algorithms and seeds.
.. __: http://code.google.com/p/perm/wiki/Algorithms
</help>
</tool>