mirror of
https://github.com/galaxyproject/galaxy.git
synced 2026-09-01 05:31:04 +08:00
James Taylor
62 lines
2.7 KiB
XML
62 lines
2.7 KiB
XML
<tool id="Extract blastz alignments1" name="Extract blastz alignments">
|
|
<description>between query genome and another genome</description>
|
|
<command interpreter="perl">extractAxt_wrapper.pl -i $input -o $out_file1 --species $species -g $dbkey $input_chromCol $input_startCol $input_endCol $input_strandCol</command>
|
|
<code file="extractAxt_wrapper_code.py"/>
|
|
<inputs>
|
|
<page>
|
|
<param format="interval" name="input" type="data" label="Between regions of Query"/>
|
|
</page>
|
|
<page>
|
|
<param name="species" type="select" label="and one of these genomes"
|
|
dynamic_options="get_available_alignments_for_build( input.dbkey )">
|
|
</param>
|
|
</page>
|
|
</inputs>
|
|
<outputs>
|
|
<data format="axt" name="out_file1" />
|
|
</outputs>
|
|
<tests>
|
|
<test>
|
|
<param name="input" value="1.bed"/>
|
|
<param name="species" value="musMus6"/>
|
|
<output name="out_file1" file="fsa_extract_blastz_alignments.dat" />
|
|
</test>
|
|
</tests>
|
|
<help>
|
|
|
|
.. class:: infomark
|
|
|
|
**TIP:** The last field of the axt header is the same as the column 4 (name) of the corresponding BED file. *This is very useful* for establishing correspondence between alignments and the original BED file.
|
|
|
|
-----
|
|
|
|
**Syntax**
|
|
|
|
This tool uses coordinates specified in the query to extract alignments, which is pre-computed blastZ output. Alignments are in the axt format as shown below.
|
|
|
|
- **blastz alignments** Blastz alignment program is available from Webb Miller's lab at Penn State University (http://www.bx.psu.edu/miller_lab/).
|
|
- **AXT format** The alignments are produced from Blastz. The lav format Blastz output, which does not include the sequence, was converted to AXT format with lavToAxt. Each alignment block in an AXT file contains three lines: a summary line and 2 sequence lines. Blocks are separated from one another by blank lines.
|
|
|
|
-----
|
|
|
|
**Example**
|
|
|
|
- Input file::
|
|
|
|
chr7 127486022 127486166 NM_000230 0 +
|
|
chr7 127486011 127486166 D49487 0 +
|
|
|
|
- Extract the hg17 and mm5 assemblies blastZ alignments of the above file::
|
|
|
|
0 chr7 127475282 127475310 chr6 28912408 28912436 + 53096 NM_000230
|
|
GTAGGAATCGCAGCGCCAGCGGTTGCAAG
|
|
GGAGGGATCCCTGCTCCAGCAGCTGCAAG
|
|
|
|
1 chr7 127486012 127486166 chr6 28921129 28921283 + 61453 D49487
|
|
TGGGAAGGAAAATGCATTGGGGAACCCTGTGCGGATTCTTGTGGCTTTGGCCCTATCTTTTCTATGTCCAAGCTGTGCCCATCCAAAAAGTCCAAGATGACACCAAAACCCTCATCAAGACAATTGTCACCAGGATCAATGACATTTCACACACG
|
|
CAGGGAGGAAAATGTGCTGGAGACCCCTGTGTCGGTTCCTGTGGCTTTGGTCCTATCTGTCTTATGTTCAAGCAGTGCCTATCCAGAAAGTCCAGGATGACACCAAAACCCTCATCAAGACCATTGTCACCAGGATCAATGACATTTCACACACG
|
|
|
|
</help>
|
|
|
|
</tool>
|