mirror of
https://github.com/galaxyproject/galaxy.git
synced 2026-10-29 17:42:12 +08:00
106 lines
3.2 KiB
XML
106 lines
3.2 KiB
XML
<tool id="cshl_fastx_clipper" name="Clip" version="1.0.1" >
|
|
<description>adapter sequences</description>
|
|
<command>
|
|
zcat -f $input | fastx_clipper -l $minlength -a $clip_source.clip_sequence -d $keepdelta -o $output -v $KEEP_N $DISCARD_OPTIONS
|
|
</command>
|
|
|
|
<inputs>
|
|
<param format="fasta,fastqsolexa" name="input" type="data" label="Library to clip" />
|
|
|
|
<param name="minlength" size="4" type="integer" value="15">
|
|
<label>Minimum sequence length (after clipping, sequences shorter than this length will be discarded)</label>
|
|
</param>
|
|
|
|
<conditional name="clip_source">
|
|
<param name="clip_source_list" type="select" label="Source">
|
|
<option value="prebuilt" selected="true">Standard (select from the list below)</option>
|
|
<option value="user">Enter custom sequence</option>
|
|
</param>
|
|
|
|
<when value="user">
|
|
<param name="clip_sequence" size="30" label="Enter custom clipping sequence" type="text" value="AATTGGCC" />
|
|
</when>
|
|
|
|
<when value="prebuilt">
|
|
<param name="clip_sequence" type="select" label="Choose Adapter">
|
|
<options from_file="fastx_clipper_sequences.txt">
|
|
<column name="name" index="1"/>
|
|
<column name="value" index="0"/>
|
|
</options>
|
|
</param>
|
|
</when>
|
|
</conditional>
|
|
|
|
<param name="keepdelta" size="2" type="integer" value="0">
|
|
<label>enter non-zero value to keep the adapter sequence and x bases that follow it</label>
|
|
<help>use this for hairpin barcoding. keep at 0 unless you know what you're doing.</help>
|
|
</param>
|
|
|
|
<param name="KEEP_N" type="select" label="Discard sequences with unknown (N) bases">
|
|
<option value="">Yes</option>
|
|
<option value="-n">No</option>
|
|
</param>
|
|
|
|
<param name="DISCARD_OPTIONS" type="select" label="Output options">
|
|
<option value="-c">Output only clipped sequences (i.e. sequences which contained the adapter)</option>
|
|
<option value="-C">Output only non-clipped sequences (i.e. sequences which did not contained the adapter)</option>
|
|
<option value="">Output both clipped and non-clipped sequences</option>
|
|
</param>
|
|
|
|
</inputs>
|
|
<!--
|
|
#functional test with param value starting with - fails.
|
|
<tests>
|
|
<test>
|
|
<param name="input" value="fastx_clipper1.fastq" />
|
|
<param name="maxmismatches" value="2" />
|
|
<param name="minlength" value="15" />
|
|
<param name="clip_source_list" value="user" />
|
|
<param name="clip_sequence" value="CAATTGGTTAATCCCCCTATATA" />
|
|
<param name="keepdelta" value="0" />
|
|
<param name="KEEP_N" value="-n" />
|
|
<param name="DISCARD_OPTIONS" value="-c" />
|
|
<output name="output" file="fastx_clipper1a.out" />
|
|
</test>
|
|
</tests>
|
|
-->
|
|
<outputs>
|
|
<data format="input" name="output" metadata_source="input" />
|
|
</outputs>
|
|
|
|
<help>
|
|
**What it does**
|
|
|
|
This tool clips adapters from the 3'-end of the sequences in a FASTA/FASTQ file.
|
|
|
|
--------
|
|
|
|
|
|
**Clipping Illustration:**
|
|
|
|
.. image:: ./static/fastx_icons/fastx_clipper_illustration.png
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
**Clipping Example:**
|
|
|
|
.. image:: ./static/fastx_icons/fastx_clipper_example.png
|
|
|
|
|
|
|
|
**In the above example:**
|
|
|
|
* Sequence no. 1 was discarded since it wasn't clipped (i.e. didn't contain the adapter sequence). (**Output** parameter).
|
|
* Sequence no. 5 was discarded --- it's length (after clipping) was shorter than 15 nt (**Minimum Sequence Length** parameter).
|
|
|
|
|
|
|
|
|
|
</help>
|
|
</tool>
|