diff --git a/config/job_resource_params_conf.xml.sample b/config/job_resource_params_conf.xml.sample
index 9a201c8f4bb..c9adce5cb97 100644
--- a/config/job_resource_params_conf.xml.sample
+++ b/config/job_resource_params_conf.xml.sample
@@ -1,6 +1,6 @@
 <parameters>
-  <param label="Processors" name="processors" type="integer" size="2" min="1" max="64" value="" help="Number of processing cores, 'ppn' value (1-64). Leave blank to use default value." />
-  <param label="Memory" name="memory" type="integer" size="3" min="1" max="256" value="" help="Memory size in gigabytes, 'pmem' value (1-256). Leave blank to use default value." />
-  <param label="Time" name="time" type="integer" size="3" min="1" max="744" value="" help="Maximum job time in hours, 'walltime' value (1-744). Leave blank to use default value." />
+  <param label="Processors" name="processors" type="integer" min="1" max="64" value="" help="Number of processing cores, 'ppn' value (1-64). Leave blank to use default value." />
+  <param label="Memory" name="memory" type="integer" min="1" max="256" value="" help="Memory size in gigabytes, 'pmem' value (1-256). Leave blank to use default value." />
+  <param label="Time" name="time" type="integer" min="1" max="744" value="" help="Maximum job time in hours, 'walltime' value (1-744). Leave blank to use default value." />
   <param label="Project" name="project" type="text" value="" help="Project to assign resource allocation to. Leave blank to use default value." />
 </parameters>
diff --git a/config/workflow_resource_params_conf.xml.sample b/config/workflow_resource_params_conf.xml.sample
index c04d2909aa5..0495c2443ed 100644
--- a/config/workflow_resource_params_conf.xml.sample
+++ b/config/workflow_resource_params_conf.xml.sample
@@ -1,7 +1,7 @@
 <parameters>
-    <param label="Processors" name="processors" type="integer" size="2" min="1" max="64" value="" help="Number of processing cores, 'ppn' value (1-64). Leave blank to use default value." />
-    <param label="Memory" name="memory" type="integer" size="3" min="1" max="256" value="" help="Memory size in gigabytes, 'pmem' value (1-256). Leave blank to use default value." />
-    <param label="Time" name="time" type="integer" size="3" min="1" max="744" value="" help="Maximum job time in hours, 'walltime' value (1-744). Leave blank to use default value." />
+    <param label="Processors" name="processors" type="integer" min="1" max="64" value="" help="Number of processing cores, 'ppn' value (1-64). Leave blank to use default value." />
+    <param label="Memory" name="memory" type="integer" min="1" max="256" value="" help="Memory size in gigabytes, 'pmem' value (1-256). Leave blank to use default value." />
+    <param label="Time" name="time" type="integer" min="1" max="744" value="" help="Maximum job time in hours, 'walltime' value (1-744). Leave blank to use default value." />
     <param label="Project" name="project" type="text" value="" help="Project to assign resource allocation to. Leave blank to use default value." />
     <param label="Workflow Job Priority" name="priority" type="select" value="med" help="What priority should the jobs in this workflow run at? (Overrides any declared job priority)">
         <option value="low" label="Low"/>
diff --git a/lib/galaxy/tools/parameters/validation.py b/lib/galaxy/tools/parameters/validation.py
index 895bc17b3ce..95d6670bbe0 100644
--- a/lib/galaxy/tools/parameters/validation.py
+++ b/lib/galaxy/tools/parameters/validation.py
@@ -37,7 +37,7 @@ class RegexValidator(Validator):
     >>> from xml.etree.ElementTree import XML
     >>> from galaxy.tools.parameters.basic import ToolParameter
     >>> p = ToolParameter.build(None, XML('''
-    ... <param name="blah" type="text" size="10" value="10">
+    ... <param name="blah" type="text" value="10">
     ...     <validator type="regex" message="Not gonna happen">[Ff]oo</validator>
     ... </param>
     ... '''))
@@ -71,7 +71,7 @@ class ExpressionValidator(Validator):
     >>> from xml.etree.ElementTree import XML
     >>> from galaxy.tools.parameters.basic import ToolParameter
     >>> p = ToolParameter.build(None, XML('''
-    ... <param name="blah" type="text" size="10" value="10">
+    ... <param name="blah" type="text" value="10">
     ...     <validator type="expression" message="Not gonna happen">value.lower() == "foo"</validator>
     ... </param>
     ... '''))
@@ -108,7 +108,7 @@ class InRangeValidator(Validator):
     >>> from xml.etree.ElementTree import XML
     >>> from galaxy.tools.parameters.basic import ToolParameter
     >>> p = ToolParameter.build(None, XML('''
-    ... <param name="blah" type="integer" size="10" value="10">
+    ... <param name="blah" type="integer" value="10">
     ...     <validator type="in_range" message="Not gonna happen" min="10" exclude_min="true" max="20"/>
     ... </param>
     ... '''))
@@ -176,7 +176,7 @@ class LengthValidator(Validator):
     >>> from xml.etree.ElementTree import XML
     >>> from galaxy.tools.parameters.basic import ToolParameter
     >>> p = ToolParameter.build(None, XML('''
-    ... <param name="blah" type="text" size="10" value="foobar">
+    ... <param name="blah" type="text" value="foobar">
     ...     <validator type="length" min="2" max="8"/>
     ... </param>
     ... '''))
diff --git a/lib/galaxy/tools/xsd/galaxy.xsd b/lib/galaxy/tools/xsd/galaxy.xsd
index 614f5497e16..b66869daac0 100644
--- a/lib/galaxy/tools/xsd/galaxy.xsd
+++ b/lib/galaxy/tools/xsd/galaxy.xsd
@@ -1197,7 +1197,7 @@ it may be inconvenient to upload the entiry file and this can be used instead.
       <xs:annotation>
         <xs:documentation xml:lang="en"><![CDATA[
 
-If ``compare`` is set to ``diff``, attempt to decompress both produced output and expected output files if needed before performing the diff. This flag is useful for testing gzipped outputs that are non-deterministic despite having deterministic decompressed contents. This is available in Galaxy 17.05+ and was introduced in [pull request #3550](https://github.com/galaxyproject/galaxy/pull/3550).
+If ``compare`` is set to ``diff``, attempt to decompress both produced output and expected output files if needed before performing the diff. This flag is useful for testing gzipped outputs that are non-deterministic despite having deterministic decompressed contents. This is available in Galaxy since release 17.05 and was introduced in [pull request #3550](https://github.com/galaxyproject/galaxy/pull/3550).
 
 ]]></xs:documentation>
       </xs:annotation>
@@ -2045,21 +2045,21 @@ in the tool form.
 ##### Examples
 
 Sometimes you need labels for data or graph axes, chart titles, etc. This can be
-done using a text field. The following will create a text box 30 characters wide
-with the default value of "V1".
+done using a text field. The following will create a text box with the default
+value of "V1".
 
 ```xml
-<param name="xlab" size="30" type="text" value="V1" label="Label for x axis"/>
+<param name="xlab" type="text" value="V1" label="Label for x axis" />
 ```
 
-The ``size`` parameter can be two dimensional, if it is the textbox will be
-rendered on the tool form as a text area instead of a single line text box.
+The ``area`` boolean attribute can be used to change the ``text`` parameter to a
+two-dimensional text area instead of a single line text box.
 
 ```xml
-<param name="foo" type="text" area="true" size="5x25" />
+<param name="foo" type="text" area="true" />
 ```
 
-As of 17.01, ``text`` parameters can also supply a static list of preset
+Since release 17.01, ``text`` parameters can also supply a static list of preset
 defaults options. The user **may** be presented with the option to select one of
 these but will be allowed to supply an arbitrary text value.
 
@@ -2082,7 +2082,7 @@ These parameters represent whole number and real numbers, respectively.
 ##### Example
 
 ```xml
-<param name="region_size" size="4" type="integer" value="1" label="flanking regions of size" />
+<param name="region_size" type="integer" value="1" label="Size of the flanking regions" />
 ```
 
 $attribute_list:value,min,max:5
@@ -2268,8 +2268,8 @@ periods (e.g. ``.``). Some "reserved" names are ``REDIRECT_URL``,
         <xs:attribute name="area" type="PermissiveBoolean">
           <xs:annotation>
             <xs:documentation xml:lang="en">Boolean indicating if this should be
-rendered as a one line text box (if ``false``) or a multi-line text area (if
-``true``).</xs:documentation>
+rendered as a one line text box (if ``false``, the default) or a multi-line text
+ area (if ``true``).</xs:documentation>
           </xs:annotation>
         </xs:attribute>
         <xs:attribute name="argument" type="xs:string">
@@ -2440,13 +2440,11 @@ template if the parameter is ``false`` or not checked by the user. Only valid if
 ``type`` is ``boolean``.</xs:documentation>
           </xs:annotation>
         </xs:attribute>
-        <xs:attribute name="size" type="xs:string">
+        <xs:attribute name="size" type="xs:string" gxdocs:deprecated="true">
           <!-- TODO: can be integer or integerxinteger -->
           <xs:annotation>
-            <xs:documentation xml:lang="en">Used only if ``type`` attribute
-value is ``text``. To create a multi-line text box add an ``area="true"``
-attribute to the param tag. This can be one dimensional (e.g. ``size="40"``)
-or two dimensional (e.g. ``size="5x25"``).</xs:documentation>
+            <xs:documentation xml:lang="en">*Deprecated*. Used only if ``type`` attribute
+value is ``text``. Completely ignored since release 16.10.</xs:documentation>
           </xs:annotation>
         </xs:attribute>
         <!-- metadata_name appears in some wrappers but I think this is a copy
@@ -2883,7 +2881,7 @@ and demonstrates generating options from a dataset directly.
 
 ```xml
 <param name="taxonomy" type="data" format="mothur.seq.taxonomy" label="taxonomy - Taxonomy" help="please make sure your file has no quotation marks in it"/>
-<param name="taxons" type="select" size="120" optional="true" multiple="true" label="Browse Taxons from Taxonomy">
+<param name="taxons" type="select" optional="true" multiple="true" label="Browse Taxons from Taxonomy">
     <options from_dataset="taxonomy">
         <column name="name" index="1"/>
         <column name="value" index="1"/>
@@ -3422,7 +3420,7 @@ tool demonstrates using filters to sort a list and remove duplicate entries.
 
 ```xml
 <param name="taxonomy" type="data" format="mothur.cons.taxonomy" label="constaxonomy - Constaxonomy file. Provide either a constaxonomy file or a taxonomy file" help="please make sure your file has no quotation marks in it"/>
-<param name="taxons" type="select" size="120" optional="true" multiple="true" label="Browse Taxons from Taxonomy">
+<param name="taxons" type="select" optional="true" multiple="true" label="Browse Taxons from Taxonomy">
     <options from_dataset="taxonomy">
         <column name="name" index="2"/>
         <column name="value" index="2"/>
diff --git a/test/functional/tools/for_workflows/head.xml b/test/functional/tools/for_workflows/head.xml
index 536152d447b..2b2a550885e 100644
--- a/test/functional/tools/for_workflows/head.xml
+++ b/test/functional/tools/for_workflows/head.xml
@@ -1,13 +1,13 @@
-<tool id="head" name="Select first">
-  <description>lines from a dataset</description>
-  <command>head -n $lineNum $input > $out_file1</command>
-  <inputs>
-    <param name="lineNum" size="5" type="integer" value="10" label="Select first" help="lines"/>
-    <param format="txt" name="input" type="data" label="from"/>
-  </inputs>
-  <outputs>
-    <data format="input" name="out_file1" metadata_source="input"/>
-  </outputs>
-  <help>
-  </help>
-</tool>
+<tool id="head" name="Select first">
+  <description>lines from a dataset</description>
+  <command>head -n $lineNum '$input' > '$out_file1'</command>
+  <inputs>
+    <param name="lineNum" type="integer" value="10" label="Select first" help="lines"/>
+    <param name="input" type="data" format="txt" label="from"/>
+  </inputs>
+  <outputs>
+    <data name="out_file1" format="input" metadata_source="input"/>
+  </outputs>
+  <help>
+  </help>
+</tool>
diff --git a/test/unit/tools/test_wrappers.py b/test/unit/tools/test_wrappers.py
index 221897e0eb6..cc2c5b15183 100644
--- a/test/unit/tools/test_wrappers.py
+++ b/test/unit/tools/test_wrappers.py
@@ -85,7 +85,7 @@ def test_raw_object_wrapper():
 
 @with_mock_tool
 def test_input_value_wrapper(tool):
-    parameter = IntegerToolParameter(tool, XML('<param name="blah" type="integer" size="4" value="10" min="0" />'))
+    parameter = IntegerToolParameter(tool, XML('<param name="blah" type="integer" value="10" min="0" />'))
     wrapper = InputValueWrapper(parameter, "5")
     assert str(wrapper) == "5"
 
diff --git a/tools/data_source/genbank.xml b/tools/data_source/genbank.xml
index 65bd9c79f8d..f7171ea4ef3 100644
--- a/tools/data_source/genbank.xml
+++ b/tools/data_source/genbank.xml
@@ -7,9 +7,7 @@
       <option value="protein">proteins database</option>
       <label>Get sequences from the</label>
     </param>
-    <param name="text" size="40" type="text" value="6273291">
-      <label>with accession ID</label>
-    </param>
+    <param name="text" type="text" value="6273291" label="with accession ID" />
   </inputs>
   <outputs>
     <data format="fasta" name="output" />
diff --git a/tools/data_source/upload.xml b/tools/data_source/upload.xml
index 0c0fea4ce93..11a4d91c960 100644
--- a/tools/data_source/upload.xml
+++ b/tools/data_source/upload.xml
@@ -1,9 +1,6 @@
 <?xml version="1.0"?>
-
 <tool name="Upload File" id="upload1" version="1.1.6" workflow_compatible="false" profile="16.04">
-  <description>
-    from your computer  
-  </description>
+  <description>from your computer</description>
   <action module="galaxy.tools.actions.upload" class="UploadToolAction"/>
   <command>
     python '$__tool_directory__/upload.py' $GALAXY_ROOT_DIR $GALAXY_DATATYPES_CONF_FILE $paramfile
@@ -30,9 +27,9 @@
     </param>
     <param name="file_count" type="hidden" value="auto" />
     <upload_dataset name="files" title="Specify Files for Dataset" file_type_name="file_type" metadata_ref="files_metadata">
-        <param name="file_data" type="file" size="30" label="File" ajax-upload="true" help="TIP: Due to browser limitations, uploading files larger than 2GB is guaranteed to fail.  To upload large files, use the URL method (below) or FTP (if enabled by the site administrator).">
+        <param name="file_data" type="file" label="File" ajax-upload="true" help="TIP: Due to browser limitations, uploading files larger than 2GB is guaranteed to fail.  To upload large files, use the URL method (below) or FTP (if enabled by the site administrator).">
       </param>
-      <param name="url_paste" type="text" area="true" size="5x35" label="URL/Text" help="Here you may specify a list of URLs (one per line) or paste the contents of a file."/> 
+      <param name="url_paste" type="text" area="true" label="URL/Text" help="Here you may specify a list of URLs (one per line) or paste the contents of a file."/>
       <param name="ftp_files" type="ftpfile" label="Files uploaded via FTP"/>
       <!-- Swap the following parameter for the select one that follows to
            enable the to_posix_lines option in the Web GUI. See Bitbucket
@@ -45,11 +42,11 @@
       <param name="dbkey" type="hidden" value="" />
 
       <!--
-      <param name="to_posix_lines" type="select" display="checkboxes" multiple="True" label="Convert universal line endings to Posix line endings" help="Turn this option off if you upload a gzip, bz2 or zip archive which contains a binary file." value="Yes"> 
+      <param name="to_posix_lines" type="select" display="checkboxes" multiple="True" label="Convert universal line endings to Posix line endings" help="Turn this option off if you upload a gzip, bz2 or zip archive which contains a binary file." value="Yes">
         <option value="Yes" selected="true">Yes</option>
       </param>
       -->
-      <param name="space_to_tab" type="select" display="checkboxes" multiple="True" label="Convert spaces to tabs" help="Use this option if you are entering intervals by hand."> 
+      <param name="space_to_tab" type="select" display="checkboxes" multiple="True" label="Convert spaces to tabs" help="Use this option if you are entering intervals by hand.">
         <option value="Yes">Yes</option>
       </param>
       <param name="NAME" type="hidden" help="Name for dataset in upload"></param>
@@ -59,10 +56,9 @@
     <!-- <param name="other_dbkey" type="text" label="Or user-defined Genome" /> -->
   </inputs>
   <help>
-  
 **Auto-detect**
 
-The system will attempt to detect Axt, Fasta, Fastqsolexa, Gff, Gff3, Html, Lav, Maf, Tabular, Wiggle, Bed and Interval (Bed with headers) formats. If your file is not detected properly as one of the known formats, it most likely means that it has some format problems (e.g., different number of columns on different rows). You can still coerce the system to set your data to the format you think it should be.  You can also upload compressed files, which will automatically be decompressed. 
+The system will attempt to detect Axt, Fasta, Fastqsolexa, Gff, Gff3, Html, Lav, Maf, Tabular, Wiggle, Bed and Interval (Bed with headers) formats. If your file is not detected properly as one of the known formats, it most likely means that it has some format problems (e.g., different number of columns on different rows). You can still coerce the system to set your data to the format you think it should be.  You can also upload compressed files, which will automatically be decompressed.
 
 -----
 
@@ -130,16 +126,16 @@ A sequence in FASTA format consists of a single-line description, followed by li
 
 FastqSolexa is the Illumina (Solexa) variant of the Fastq format, which stores sequences and quality scores in a single file::
 
-    @seq1  
-    GACAGCTTGGTTTTTAGTGAGTTGTTCCTTTCTTT  
-    +seq1  
-    hhhhhhhhhhhhhhhhhhhhhhhhhhPW@hhhhhh  
-    @seq2  
-    GCAATGACGGCAGCAATAAACTCAACAGGTGCTGG  
-    +seq2  
+    @seq1
+    GACAGCTTGGTTTTTAGTGAGTTGTTCCTTTCTTT
+    +seq1
+    hhhhhhhhhhhhhhhhhhhhhhhhhhPW@hhhhhh
+    @seq2
+    GCAATGACGGCAGCAATAAACTCAACAGGTGCTGG
+    +seq2
     hhhhhhhhhhhhhhYhhahhhhWhAhFhSIJGChO
-    
-Or:: 
+
+Or::
 
     @seq1
     GAATTGATCAGGACATAGGACAACTGTAGGCACCAT
@@ -149,7 +145,7 @@ Or::
     GAGTTCTCGTCGCCTGTAGGCACCATCAATCGTATG
     +seq2
     40 15 40 17 6 36 40 40 40 25 40 9 35 33 40 14 14 18 15 17 19 28 31 4 24 18 27 14 15 18 2 8 12 8 11 9
-    
+
 -----
 
 **Gff**
@@ -229,6 +225,5 @@ The wiggle format is line-oriented.  Wiggle data is preceded by a track definiti
 **Other text type**
 
 Any text file
-
   </help>
 </tool>
diff --git a/tools/extract/liftOver_wrapper.xml b/tools/extract/liftOver_wrapper.xml
index f7abe7950b2..414025a6bde 100644
--- a/tools/extract/liftOver_wrapper.xml
+++ b/tools/extract/liftOver_wrapper.xml
@@ -27,7 +27,7 @@
         <filter type="data_meta" ref="input" key="dbkey" column="0" />
       </options>
     </param>
-    <param name="minMatch" size="10" type="float" value="0.95" label="Minimum ratio of bases that must remap" help="Recommended values: same species = 0.95, different species = 0.10" />
+    <param name="minMatch" type="float" value="0.95" label="Minimum ratio of bases that must remap" help="Recommended values: same species = 0.95, different species = 0.10" />
     <conditional name="multiple">
         <param name="choice" type="select" label="Allow multiple output regions?" help="Recommended values: same species = No, different species = Yes">
             <option value="0" selected="true">No</option>
@@ -39,9 +39,9 @@
             <param name="minChainT" type="hidden" value="0" />
         </when>
         <when value="1">
-            <param name="minSizeQ" size="10" type="integer" value="0" label="Minimum matching region size in dataset" help="Recommended value: set to >= 300 bases for complete transcripts"/>
-            <param name="minChainQ" size="10" type="integer" value="500" label="Minimum chain size in dataset"/>
-            <param name="minChainT" size="10" type="integer" value="500" label="Minimum chain size in target"/>
+            <param name="minSizeQ" type="integer" value="0" label="Minimum matching region size in dataset" help="Recommended value: set to >= 300 bases for complete transcripts"/>
+            <param name="minChainQ" type="integer" value="500" label="Minimum chain size in dataset"/>
+            <param name="minChainT" type="integer" value="500" label="Minimum chain size in target"/>
         </when>
     </conditional>
   </inputs>
diff --git a/tools/filters/CreateInterval.xml b/tools/filters/CreateInterval.xml
index 69437990d6e..73b3927f234 100644
--- a/tools/filters/CreateInterval.xml
+++ b/tools/filters/CreateInterval.xml
@@ -1,18 +1,20 @@
 <tool id="createInterval" name="Create single interval" version="1.0.0">
   <description>as a new dataset</description>
-  <command interpreter="perl">CreateInterval.pl $chrom $start $end "$name" $strand $out_file1</command>
+  <command>
+perl '$__tool_directory__/CreateInterval.pl' '$chrom' $start $end '$name' $strand '$out_file1'
+  </command>
   <inputs>
-    <param name="chrom" size="20" type="text" value="chr7" label="Chromosome"/>
-    <param name="start" size="20" type="integer" value="100" label="Start position"/>
-    <param name="end"   size="20" type="integer" value="1000" label="End position"/>
-    <param name="name" size="20" type="text" value="myInterval" label="Name"/>
+    <param name="chrom" type="text" value="chr7" label="Chromosome"/>
+    <param name="start" type="integer" value="100" label="Start position"/>
+    <param name="end" type="integer" value="1000" label="End position"/>
+    <param name="name" type="text" value="myInterval" label="Name"/>
     <param name="strand" type="select" label="Strand" help="If your interval is strandless set strand to plus" >
       <option value="plus">plus</option>
       <option value="minus">minus</option>
     </param>    
   </inputs>
   <outputs>
-    <data format="bed" name="out_file1" />
+    <data name="out_file1" format="bed" />
   </outputs>
   <tests>
     <test>
@@ -25,7 +27,6 @@
     </test>
   </tests>
   <help>
-
 .. class:: warningmark
 
 **TIP**. Once your interval appears in history, you must tell Galaxy which genome it belongs to by clicking pencil icon or the "?" link in the history item.
@@ -51,6 +52,5 @@ Typing the following values in the form::
 will create a single interval::
 
     chrX  151087187  151370486  NM_000808  0  -
-
-</help>
+  </help>
 </tool>
diff --git a/tools/filters/bed_to_bigbed.xml b/tools/filters/bed_to_bigbed.xml
index d09064e9b44..074cd993556 100644
--- a/tools/filters/bed_to_bigbed.xml
+++ b/tools/filters/bed_to_bigbed.xml
@@ -23,8 +23,8 @@
       </param>
       <when value="preset" />
       <when value="full">
-        <param name="blockSize" size="4" type="integer" value="256" label="Items to bundle in r-tree" help="Default is 256 (blockSize)" />
-        <param name="itemsPerSlot" size="4" type="integer" value="512" label="Data points bundled at lowest level" help="Default is 512 (itemsPerSlot)" />
+        <param name="blockSize" type="integer" value="256" label="Items to bundle in r-tree" help="Default is 256 (blockSize)" />
+        <param name="itemsPerSlot" type="integer" value="512" label="Data points bundled at lowest level" help="Default is 512 (itemsPerSlot)" />
         <param name="unc" type="boolean" truevalue="-unc" falsevalue="" checked="False" label="Do not use compression" help="(unc)"/>
       </when>
     </conditional>
diff --git a/tools/filters/changeCase.xml b/tools/filters/changeCase.xml
index 6912bdd18f8..a2cf26775a9 100644
--- a/tools/filters/changeCase.xml
+++ b/tools/filters/changeCase.xml
@@ -3,10 +3,12 @@
   <stdio>
     <exit_code range="1:" err_level="fatal" />
   </stdio>
-  <command interpreter="perl">changeCase.pl $input "$cols" $delimiter $casing $out_file1</command>
+  <command>
+perl '$__tool_directory__/changeCase.pl' '$input' '$cols' $delimiter $casing '$out_file1'
+  </command>
   <inputs>
-    <param name="input" format="txt" type="data" label="From"/>
-    <param name="cols" size="10" type="text" value="c1,c2" label="Change case of columns"/>
+    <param name="input" type="data" format="txt" label="From"/>
+    <param name="cols" type="text" value="c1,c2" label="Change case of columns"/>
     <param name="delimiter" type="select" label="Delimited by">
       <option value="TAB">Tab</option>
       <option value="SPACE">Whitespace</option>
@@ -22,7 +24,7 @@
     </param>
   </inputs>
   <outputs>
-    <data format="tabular" name="out_file1" />
+    <data name="out_file1" format="tabular" />
   </outputs>
   <tests>
     <test>
@@ -41,7 +43,6 @@
     </test>
   </tests>
   <help>
-
 .. class:: warningmark
 
 **This tool breaks column assignments.** To re-establish column assignments run the tool and click on the pencil icon in the resulting history item.
@@ -72,6 +73,5 @@ will result in::
 
   APPLE is GOOD
   WINDOWS is BAD
-
   </help>
 </tool>
diff --git a/tools/filters/fileGrep.xml b/tools/filters/fileGrep.xml
index 5b248c759d3..b3911be5e65 100644
--- a/tools/filters/fileGrep.xml
+++ b/tools/filters/fileGrep.xml
@@ -1,17 +1,19 @@
 <tool id="fileGrep1" name="Match" version="1.0.0">
   <description>a column from one Query against another Query</description>
-  <command>cut -f $col $input1 | grep -f - $match $input2 > $out_file1</command>
+  <command>
+cut -f '$col' '$input1' | grep -f - $match '$input2' > '$out_file1'
+  </command>
   <inputs>
-    <param name="col" size="2" type="text" value="1" label="Match content of column"/>
-    <param format="tabular" name="input1" type="data" label="From Query1"/>
-    <param format="tabular" name="input2" type="data" label="Against Query2"/>
+    <param name="col" type="text" value="1" label="Match content of column"/>
+    <param name="input1" type="data" format="tabular" label="From Query1"/>
+    <param name="input2" type="data" format="tabular" label="Against Query2"/>
     <param name="match" type="select" label="and return rows that">
       <option value="">Match</option>
       <option value="-v">Do not match</option>
     </param>
   </inputs>
   <outputs>
-    <data format="input" name="out_file1" metadata_source="input2" />
+    <data name="out_file1" format="input" metadata_source="input2" />
   </outputs>
   <help>
 This tool is based on UNIX command grep with option -f. It matches content of one query against another. For example, assume you have two queries - one that contains EST accession numbers and some other information::
@@ -37,6 +39,5 @@ Using this tool you will be able to tell how many ESTs in Query1 are also preset
   chr7 115443239 115443802 AA001842_exon_0_0_chr7_115443240_f 0	
 
 if **Match** option is chosen.
-
-</help>
-</tool>
\ No newline at end of file
+  </help>
+</tool>
diff --git a/tools/filters/fixedValueColumn.xml b/tools/filters/fixedValueColumn.xml
index 953e4a67488..6f5ece19394 100644
--- a/tools/filters/fixedValueColumn.xml
+++ b/tools/filters/fixedValueColumn.xml
@@ -1,16 +1,18 @@
 <tool id="addValue" name="Add column" version="1.0.0">
   <description>to an existing dataset</description>
-  <command interpreter="perl">fixedValueColumn.pl $input $out_file1 "$exp" $iterate</command>
+  <command>
+perl '$__tool_directory__/fixedValueColumn.pl' '$input' '$out_file1' '$exp' $iterate
+  </command>
   <inputs>
-     <param name="exp" size="20" type="text" value="1" label="Add this value"/>
-    <param format="tabular" name="input" type="data" label="to Dataset" help="Dataset missing? See TIP below" />
+    <param name="exp" type="text" value="1" label="Add this value"/>
+    <param name="input" type="data" format="tabular" label="to Dataset" help="Dataset missing? See TIP below" />
     <param name="iterate" type="select" label="Iterate?">
       <option value="no">NO</option>
       <option value="yes">YES</option>
     </param>    
   </inputs>
   <outputs>
-    <data format="input" name="out_file1" metadata_source="input"/>
+    <data name="out_file1" format="input" metadata_source="input"/>
   </outputs>
   <tests>
     <test>
@@ -21,7 +23,6 @@
     </test>
   </tests>
   <help>
-
 .. class:: infomark
 
 **TIP:** If your data is not TAB delimited, use *Text Manipulation-&gt;Convert*
@@ -54,8 +55,5 @@ You can also add line numbers by selecting **Iterate: YES**. In this case if you
     chr1 10  100 geneA 1
     chr2 200 300 geneB 2
     chr2 400 500 geneC 3
-
-
-
-</help>
+  </help>
 </tool>
diff --git a/tools/filters/gff/gff_filter_by_attribute.xml b/tools/filters/gff/gff_filter_by_attribute.xml
index a10424fa867..086ec3a8d65 100644
--- a/tools/filters/gff/gff_filter_by_attribute.xml
+++ b/tools/filters/gff/gff_filter_by_attribute.xml
@@ -1,16 +1,16 @@
 <tool id="gff_filter_by_attribute" name="Filter GFF data by attribute" version="0.2">
   <description>using simple expressions</description>
-  <command interpreter="python">
-    gff_filter_by_attribute.py $input $out_file1 "$cond" '${input.metadata.attribute_types}'
+  <command>
+python '$__tool_directory__/gff_filter_by_attribute.py' '$input' '$out_file1' '$cond' '${input.metadata.attribute_types}'
   </command>
   <inputs>
-    <param format="gff" name="input" type="data" label="Filter" help="Dataset missing? See TIP below."/>
-    <param name="cond" size="40" type="text" value="gene_id=='uc002loc.1'" label="With following condition" help="Double equal signs, ==, must be used as shown above. To filter for an arbitrary string, use the Select tool.">
+    <param name="input" type="data" format="gff" label="Filter" help="Dataset missing? See TIP below." />
+    <param name="cond" type="text" value="gene_id=='uc002loc.1'" label="With following condition" help="Double equal signs, ==, must be used as shown above. To filter for an arbitrary string, use the Select tool.">
       <validator type="empty_field" message="Enter a valid filtering condition, see syntax and examples below."/>
     </param>
   </inputs>
   <outputs>
-    <data format="input" name="out_file1" metadata_source="input"/>
+    <data name="out_file1" format="input" metadata_source="input"/>
   </outputs>
   <tests>
     <test>
@@ -31,7 +31,6 @@
   </tests>
 
   <help>
-
 .. class:: warningmark
 
 Double equal signs, ==, must be used as *"equal to"* (e.g., **c1 == 'chr22'**)
@@ -54,6 +53,5 @@ The filter tool allows you to restrict the dataset using simple conditional stat
 - When using 'equal-to' operator **double equal sign '==' must be used** ( e.g., **attribute_name=='chr1'** )
 - Non-numerical values must be included in single or double quotes ( e.g., **attribute_name=='XX22'** )
 - You can combine multiple conditional statements using **and** or **or** ( e.g., **attribute_name=='XX22' or attribute_name=='XX21'** )
-
-</help>
+  </help>
 </tool>
diff --git a/tools/filters/gff/gff_filter_by_feature_count.xml b/tools/filters/gff/gff_filter_by_feature_count.xml
index 58610364199..dd9fb83823a 100644
--- a/tools/filters/gff/gff_filter_by_feature_count.xml
+++ b/tools/filters/gff/gff_filter_by_feature_count.xml
@@ -1,10 +1,10 @@
 <tool id="gff_filter_by_feature_count" name="Filter GFF data by feature count" version="0.1.1">
   <description>using simple expressions</description>
-  <command interpreter="python">
-    gff_filter_by_feature_count.py $input_file1 $out_file1 "$feature_name" "$cond"
+  <command>
+python '$__tool_directory__/gff_filter_by_feature_count.py' '$input_file1' '$out_file1' '$feature_name' '$cond'
   </command>
   <inputs>
-    <param format="gff" name="input_file1" type="data" label="Filter"/>
+    <param name="input_file1" type="data" format="gff" label="Filter"/>
     <param name="feature_name" type="select" label="Using feature name">
         <options from_dataset="input_file1">
             <column name="name" index="2"/>
@@ -12,12 +12,12 @@
             <filter type="unique_value" name="unique" column="2"/>
         </options>
     </param>
-    <param name="cond" size="40" type="text" value=">0" label="With following condition">
+    <param name="cond" type="text" value=">0" label="With following condition">
       <validator type="empty_field" message="Enter a valid filtering condition, see syntax and examples below."/>
     </param>
   </inputs>
   <outputs>
-    <data format="input" name="out_file1" metadata_source="input_file1"/>
+    <data name="out_file1" format="input" metadata_source="input_file1"/>
   </outputs>
   <tests>
       <!-- Test GTF filtering. -->
@@ -37,8 +37,6 @@
   </tests>
 
   <help>
-
-
 .. class:: infomark
 
 Valid comparison operators are: &gt; &lt; &gt;=, &lt;=, !=, and ==
@@ -48,6 +46,5 @@ Valid comparison operators are: &gt; &lt; &gt;=, &lt;=, !=, and ==
 **Syntax**
 
 The filter tool allows you to restrict the dataset based on transcripts' feature counts.
-
-</help>
+  </help>
 </tool>
diff --git a/tools/filters/grep.xml b/tools/filters/grep.xml
index 21372628ff8..c8a83a0121a 100644
--- a/tools/filters/grep.xml
+++ b/tools/filters/grep.xml
@@ -7,7 +7,7 @@
       <option value="false">Matching</option>
       <option value="true">NOT Matching</option>
     </param>
-    <param name="pattern" size="40" type="text" value="^chr([0-9A-Za-z])+" label="the pattern" help="here you can enter text or regular expression (for syntax check lower part of this frame)">
+    <param name="pattern" type="text" value="^chr([0-9A-Za-z])+" label="the pattern" help="here you can enter text or regular expression (for syntax check lower part of this frame)">
       <sanitizer>
         <valid initial="string.printable">
          <remove value="&apos;"/>
diff --git a/tools/filters/headWrapper.xml b/tools/filters/headWrapper.xml
index 53451c44067..c01a2e63ec2 100644
--- a/tools/filters/headWrapper.xml
+++ b/tools/filters/headWrapper.xml
@@ -1,12 +1,14 @@
 <tool id="Show beginning1" name="Select first" version="1.0.0">
   <description>lines from a dataset</description>
-  <command interpreter="perl">headWrapper.pl $input $lineNum $out_file1</command>
+  <command>
+perl '$__tool_directory__/headWrapper.pl' '$input' $lineNum '$out_file1'
+  </command>
   <inputs>
-    <param name="lineNum" size="5" type="integer" value="10" label="Select first" help="lines"/>
-    <param format="txt" name="input" type="data" label="from"/>
+    <param name="lineNum" type="integer" value="10" label="Select first" help="lines"/>
+    <param name="input" type="data" format="txt" label="from"/>
   </inputs>
   <outputs>
-    <data format="input" name="out_file1" metadata_source="input"/>
+    <data name="out_file1" format="input" metadata_source="input"/>
   </outputs>
   <tests>
     <test>
@@ -16,7 +18,6 @@
     </test>
   </tests>
   <help>
-
 **What it does**
 
 This tool outputs specified number of lines from the **beginning** of a dataset
@@ -37,6 +38,5 @@ will produce::
 
     chr7  56632  56652  D17003_CTCF_R6  310  +
     chr7  56736  56756  D17003_CTCF_R7  354  +
-
   </help>
 </tool>
diff --git a/tools/filters/randomlines.xml b/tools/filters/randomlines.xml
index d686651e069..f0b22599022 100644
--- a/tools/filters/randomlines.xml
+++ b/tools/filters/randomlines.xml
@@ -7,8 +7,8 @@ python '$__tool_directory__/random_lines_two_pass.py' '${input}' '${out_file1}'
 #end if
   </command>
   <inputs>
-    <param name="num_lines" size="5" type="integer" value="1" label="Randomly select" help="lines"/>
-    <param format="txt" name="input" type="data" label="from"/>
+    <param name="num_lines" type="integer" value="1" label="Randomly select" help="lines"/>
+    <param name="input" type="data" format="txt" label="from"/>
     <conditional name="seed_source">
       <param name="seed_source_selector" type="select" label="Set a random seed">
         <option value="no_seed" selected="True">Don't set seed</option>
@@ -17,13 +17,13 @@ python '$__tool_directory__/random_lines_two_pass.py' '${input}' '${out_file1}'
       <when value="no_seed">
         <!-- Do nothing here -->
       </when>
-      <when value="set_seed"> 
+      <when value="set_seed">
         <param name="seed" type="text" label="Random seed" />
       </when>
     </conditional>
   </inputs>
   <outputs>
-    <data format="input" name="out_file1" metadata_source="input"/>
+    <data name="out_file1" format="input" metadata_source="input"/>
   </outputs>
   <tests>
     <test>
@@ -41,7 +41,6 @@ python '$__tool_directory__/random_lines_two_pass.py' '${input}' '${out_file1}'
     </test>
   </tests>
   <help>
-
 **What it does**
 
 This tool selects N random lines from a file, with no repeats, and preserving ordering.
@@ -62,6 +61,5 @@ Selecting 2 random lines might return this::
 
     chr7  56736  56756   D17003_CTCF_R7  354  +
     chr7  56775  56795   D17003_CTCF_R4  207  +
-
     </help>
 </tool>
diff --git a/tools/filters/remove_beginning.xml b/tools/filters/remove_beginning.xml
index a929e483d83..2a1023f710b 100644
--- a/tools/filters/remove_beginning.xml
+++ b/tools/filters/remove_beginning.xml
@@ -1,12 +1,14 @@
 <tool id="Remove beginning1" name="Remove beginning" version="1.0.0">
   <description>of a file</description>
-  <command interpreter="perl">remove_beginning.pl $input $num_lines $out_file1</command>
+  <command>
+perl '$__tool_directory__/remove_beginning.pl' '$input' $num_lines '$out_file1'
+  </command>
   <inputs>
-    <param name="num_lines" size="5" type="integer" value="1" label="Remove first" help="lines"/>
-    <param format="txt" name="input" type="data" label="from"/>
+    <param name="num_lines" type="integer" value="1" label="Remove first" help="lines" />
+    <param name="input" type="data" format="txt" label="from" />
   </inputs>
   <outputs>
-    <data format="input" name="out_file1" metadata_source="input"/>
+    <data name="out_file1" format="input" metadata_source="input" />
   </outputs>
   <tests>
     <test>
@@ -16,7 +18,6 @@
     </test>
   </tests>
   <help>
-
 **What it does**
 
 This tool removes a specified number of lines from the beginning of a dataset.
@@ -37,6 +38,5 @@ After removing the first 3 lines the dataset will look like this::
 
     chr7  56772  56792   D17003_CTCF_R7  372  +
     chr7  56775  56795   D17003_CTCF_R4  207  +
-
-</help>
+  </help>
 </tool>
diff --git a/tools/filters/tailWrapper.xml b/tools/filters/tailWrapper.xml
index 0865145dc88..166018ec1d2 100644
--- a/tools/filters/tailWrapper.xml
+++ b/tools/filters/tailWrapper.xml
@@ -3,11 +3,11 @@
   <command detect_errors="exit_code">
 perl '$__tool_directory__/tailWrapper.pl' '$input' $lineNum '$out_file1'</command>
   <inputs>
-    <param name="lineNum" size="5" type="integer" value="10" label="Select last" help="lines"/>
-    <param format="txt" name="input" type="data" label="from"/>
+    <param name="lineNum" type="integer" value="10" label="Select last" help="lines"/>
+    <param name="input" type="data" format="txt" label="from"/>
   </inputs>
   <outputs>
-    <data format="input" name="out_file1" metadata_source="input"/>
+    <data name="out_file1" format_source="input" metadata_source="input"/>
   </outputs>
   <tests>
     <test>
@@ -17,7 +17,6 @@ perl '$__tool_directory__/tailWrapper.pl' '$input' $lineNum '$out_file1'</comman
     </test>
   </tests>
   <help>
-
 **What it does**
 
 This tool outputs specified number of lines from the **end** of a dataset
@@ -38,6 +37,5 @@ This tool outputs specified number of lines from the **end** of a dataset
 
     chr7    57341   57361   D17003_CTCF_R7  375     +
     chr7    57457   57477   D17003_CTCF_R3  188     +
-
   </help>
 </tool>
diff --git a/tools/filters/wig_to_bigwig.xml b/tools/filters/wig_to_bigwig.xml
index 7db6785af6a..5e99e922722 100644
--- a/tools/filters/wig_to_bigwig.xml
+++ b/tools/filters/wig_to_bigwig.xml
@@ -31,8 +31,8 @@
       </param>
       <when value="preset" />
       <when value="full">
-        <param name="blockSize" size="4" type="integer" value="256" label="Items to bundle in r-tree" help="Default is 256 (blockSize)" />
-        <param name="itemsPerSlot" size="4" type="integer" value="1024" label="Data points bundled at lowest level" help="Default is 1024 (itemsPerSlot)" />
+        <param name="blockSize" type="integer" value="256" label="Items to bundle in r-tree" help="Default is 256 (blockSize)" />
+        <param name="itemsPerSlot" type="integer" value="1024" label="Data points bundled at lowest level" help="Default is 1024 (itemsPerSlot)" />
         <param name="clip" type="boolean" truevalue="-clip" falsevalue="" checked="True" label="Clip chromosome positions" help="Issue warning messages rather than dying if wig file contains items off end of chromosome. (clip)"/>
         <param name="unc" type="boolean" truevalue="-unc" falsevalue="" checked="False" label="Do not use compression" help="(unc)"/>
       </when>
diff --git a/tools/maf/vcf_to_maf_customtrack.xml b/tools/maf/vcf_to_maf_customtrack.xml
index 3fbe06513cf..c10618ac41e 100644
--- a/tools/maf/vcf_to_maf_customtrack.xml
+++ b/tools/maf/vcf_to_maf_customtrack.xml
@@ -20,7 +20,7 @@ ${vcf_source_type.vcf_source} -n '$track_name'
 -g
   </command>
   <inputs>
-    <param name="track_name" type="text" label="Custom Track Name" value="Galaxy Custom Track" size="30" />
+    <param name="track_name" type="text" value="Galaxy Custom Track" label="Custom Track Name" />
     <conditional name="vcf_source_type">
       <param name="vcf_source" type="select" label="VCF Source Source Type">
         <option value="-p" selected="true">Per Population (file)</option>
diff --git a/tools/metag_tools/blat_wrapper.xml b/tools/metag_tools/blat_wrapper.xml
index f018f1a7b39..1171c524a61 100644
--- a/tools/metag_tools/blat_wrapper.xml
+++ b/tools/metag_tools/blat_wrapper.xml
@@ -19,9 +19,9 @@
  		</when>
 	</conditional>	
 		<param name="input_query" type="data" format="fasta" label="Sequence file"/>
-		<param name="iden" type="float" size="15" value="90.0" label="Minimal identity (-minIdentity)" />
-		<param name="tile_size" type="integer" size="15" value="11" label="Minimal size of exact match (-tileSize)" help="Must be between 6 and 18."/>
-		<param name="one_off" type="integer" size="15" value="0" label="Number of mismatch in the word (-oneOff)" help="Must be between 0 and 2." />
+		<param name="iden" type="float" value="90.0" label="Minimal identity (-minIdentity)" />
+		<param name="tile_size" type="integer" value="11" label="Minimal size of exact match (-tileSize)" help="Must be between 6 and 18."/>
+		<param name="one_off" type="integer" value="0" label="Number of mismatch in the word (-oneOff)" help="Must be between 0 and 2." />
 	</inputs>
 	<outputs>
 		<data name="output1" format="tabular"/>
diff --git a/tools/metag_tools/shrimp_color_wrapper.xml b/tools/metag_tools/shrimp_color_wrapper.xml
index 55e72415659..c2b4379bf9d 100644
--- a/tools/metag_tools/shrimp_color_wrapper.xml
+++ b/tools/metag_tools/shrimp_color_wrapper.xml
@@ -19,23 +19,23 @@ python '$__tool_directory__/shrimp_color_wrapper.py' '$input_target' '$input_que
             </param>
             <when value="skip" />
             <when value="full">
-                <param name="spaced_seed"                   type="text"     size="30"   value="1111001111"    label="Spaced Seed" />
-                <param name="seed_matches_per_window"       type="integer"  size="5"    value="2"               label="Seed Matches per Window" />
-                <param name="seed_hit_taboo_length"         type="integer"  size="5"    value="4"               label="Seed Hit Taboo Length" />
-                <param name="seed_generation_taboo_length"  type="integer"  size="5"    value="0"               label="Seed Generation Taboo Length" />
-                <param name="seed_window_length"            type="float"    size="10"   value="115.0"           label="Seed Window Length"          help="in percentage"/>
-                <param name="max_hits_per_read"             type="integer"  size="10"   value="100"             label="Maximum Hits per Read" />
-                <param name="max_read_length"               type="integer"  size="10"   value="1000"            label="Maximum Read Length" />
-                <param name="kmer"                          type="integer"  size="10"   value="-1"              label="Kmer Std. Deviation Limit"   help="-1 as None"/>
-                <param name="sw_match_value"                type="integer"  size="10"   value="100"             label="S-W Match Value" />
-                <param name="sw_mismatch_value"             type="integer"  size="10"   value="-150"            label="S-W Mismatch Value" />
-                <param name="sw_gap_open_ref"               type="integer"  size="10"   value="-400"            label="S-W Gap Open Penalty (Reference)" />
-                <param name="sw_gap_open_query"             type="integer"  size="10"   value="-400"            label="S-W Gap Open Penalty (Query)" />
-                <param name="sw_gap_ext_ref"                type="integer"  size="10"   value="-70"             label="S-W Gap Extend Penalty (Reference)" />
-                <param name="sw_gap_ext_query"              type="integer"  size="10"   value="-70"             label="S-W Gap Extend Penalty (Query)" />
-                <param name="sw_crossover_penalty"          type="integer"  size="10"   value="-140"            label="S-W Crossover Penalty" />
-                <param name="sw_full_hit_threshold"         type="float"    size="10"   value="68.0"            label="S-W Full Hit Threshold"      help="in percentage"/>
-                <param name="sw_vector_hit_threshold"       type="float"    size="10"   value="60.0"            label="S-W Vector Hit Threshold"    help="in percentage"/>
+                <param name="spaced_seed" type="text" value="1111001111" label="Spaced Seed" />
+                <param name="seed_matches_per_window" type="integer" value="2" label="Seed Matches per Window" />
+                <param name="seed_hit_taboo_length" type="integer" value="4" label="Seed Hit Taboo Length" />
+                <param name="seed_generation_taboo_length" type="integer" value="0" label="Seed Generation Taboo Length" />
+                <param name="seed_window_length" type="float" value="115.0" label="Seed Window Length" help="in percentage"/>
+                <param name="max_hits_per_read" type="integer" value="100" label="Maximum Hits per Read" />
+                <param name="max_read_length" type="integer" value="1000" label="Maximum Read Length" />
+                <param name="kmer" type="integer" value="-1" label="Kmer Std. Deviation Limit" help="-1 as None"/>
+                <param name="sw_match_value" type="integer" value="100" label="S-W Match Value" />
+                <param name="sw_mismatch_value" type="integer" value="-150" label="S-W Mismatch Value" />
+                <param name="sw_gap_open_ref"type="integer" value="-400" label="S-W Gap Open Penalty (Reference)" />
+                <param name="sw_gap_open_query" type="integer" value="-400" label="S-W Gap Open Penalty (Query)" />
+                <param name="sw_gap_ext_ref" type="integer" value="-70" label="S-W Gap Extend Penalty (Reference)" />
+                <param name="sw_gap_ext_query" type="integer" value="-70" label="S-W Gap Extend Penalty (Query)" />
+                <param name="sw_crossover_penalty" type="integer" value="-140" label="S-W Crossover Penalty" />
+                <param name="sw_full_hit_threshold" type="float" value="68.0" label="S-W Full Hit Threshold" help="in percentage"/>
+                <param name="sw_vector_hit_threshold" type="float" value="60.0" label="S-W Vector Hit Threshold" help="in percentage"/>
             </when>
         </conditional>
     </inputs>
diff --git a/tools/metag_tools/shrimp_wrapper.xml b/tools/metag_tools/shrimp_wrapper.xml
index f88180c5dc7..d4c974cf41a 100644
--- a/tools/metag_tools/shrimp_wrapper.xml
+++ b/tools/metag_tools/shrimp_wrapper.xml
@@ -25,7 +25,7 @@ python '$__tool_directory__/shrimp_wrapper.py' '$input_target' '$output1' '$outp
                 <param name="input_query" type="data" format="fastqsolexa" label="Align sequencing reads" help="No dataset? Read tip below"/>
             </when>
             <when value="paired">
-                <param name="insertion_size" type="integer" size="5" value="600" label="Insertion length between two ends" help="bp" />
+                <param name="insertion_size" type="integer" value="600" label="Insertion length between two ends" help="bp" />
                 <param name="input1" type="data" format="fastqsolexa" label="Align sequencing reads, one end" />
                 <param name="input2" type="data" format="fastqsolexa" label="and the other end" />
             </when>
@@ -38,21 +38,21 @@ python '$__tool_directory__/shrimp_wrapper.py' '$input_target' '$output1' '$outp
             </param>
             <when value="skip" />
             <when value="full">
-                <param name="spaced_seed"                   type="text"     size="30"   value="111111011111"    label="Spaced Seed" />
-                <param name="seed_matches_per_window"       type="integer"  size="5"    value="2"               label="Seed Matches per Window" />
-                <param name="seed_hit_taboo_length"         type="integer"  size="5"    value="4"               label="Seed Hit Taboo Length" />
-                <param name="seed_generation_taboo_length"  type="integer"  size="5"    value="0"               label="Seed Generation Taboo Length" />
-                <param name="seed_window_length"            type="float"    size="10"   value="115.0"           label="Seed Window Length"          help="in percentage"/>
-                <param name="max_hits_per_read"             type="integer"  size="10"   value="100"             label="Maximum Hits per Read" />
-                <param name="max_read_length"               type="integer"  size="10"   value="1000"            label="Maximum Read Length" />
-                <param name="kmer"                          type="integer"  size="10"   value="-1"              label="Kmer Std. Deviation Limit"   help="-1 as None"/>
-                <param name="sw_match_value"                type="integer"  size="10"   value="100"             label="S-W Match Value" />
-                <param name="sw_mismatch_value"             type="integer"  size="10"   value="-150"            label="S-W Mismatch Value" />
-                <param name="sw_gap_open_ref"               type="integer"  size="10"   value="-400"            label="S-W Gap Open Penalty (Reference)" />
-                <param name="sw_gap_open_query"             type="integer"  size="10"   value="-400"            label="S-W Gap Open Penalty (Query)" />
-                <param name="sw_gap_ext_ref"                type="integer"  size="10"   value="-70"             label="S-W Gap Extend Penalty (Reference)" />
-                <param name="sw_gap_ext_query"              type="integer"  size="10"   value="-70"             label="S-W Gap Extend Penalty (Query)" />
-                <param name="sw_hit_threshold"              type="float"    size="10"   value="68.0"            label="S-W Hit Threshold"           help="in percentage"/>
+                <param name="spaced_seed" type="text" value="111111011111" label="Spaced Seed" />
+                <param name="seed_matches_per_window" type="integer" value="2" label="Seed Matches per Window" />
+                <param name="seed_hit_taboo_length" type="integer" value="4" label="Seed Hit Taboo Length" />
+                <param name="seed_generation_taboo_length" type="integer" value="0" label="Seed Generation Taboo Length" />
+                <param name="seed_window_length" type="float" value="115.0" label="Seed Window Length" help="in percentage" />
+                <param name="max_hits_per_read" type="integer" value="100" label="Maximum Hits per Read" />
+                <param name="max_read_length" type="integer" value="1000" label="Maximum Read Length" />
+                <param name="kmer" type="integer" value="-1" label="Kmer Std. Deviation Limit" help="-1 as None"/>
+                <param name="sw_match_value" type="integer" value="100" label="S-W Match Value" />
+                <param name="sw_mismatch_value" type="integer" value="-150" label="S-W Mismatch Value" />
+                <param name="sw_gap_open_ref" type="integer" value="-400" label="S-W Gap Open Penalty (Reference)" />
+                <param name="sw_gap_open_query" type="integer" value="-400" label="S-W Gap Open Penalty (Query)" />
+                <param name="sw_gap_ext_ref" type="integer" value="-70" label="S-W Gap Extend Penalty (Reference)" />
+                <param name="sw_gap_ext_query" type="integer" value="-70" label="S-W Gap Extend Penalty (Query)" />
+                <param name="sw_hit_threshold" type="float" value="68.0" label="S-W Hit Threshold" help="in percentage" />
             </when>
         </conditional>
     </inputs>
diff --git a/tools/plotting/bar_chart.xml b/tools/plotting/bar_chart.xml
index 7d2855d0445..b9447a49a35 100644
--- a/tools/plotting/bar_chart.xml
+++ b/tools/plotting/bar_chart.xml
@@ -1,9 +1,13 @@
 <tool id="barchart_gnuplot" name="Bar chart" version="1.0.0">
   <description>for multiple columns</description>
-  <command interpreter="python">
-    #if $xtic.userSpecified == "Yes" #bar_chart.py $input $xtic.xticColumn $colList "$title" "$ylabel" $ymin $ymax $out_file1 "$pdf_size"
-    #else                            #bar_chart.py $input 0 $colList "$title" "$ylabel" $ymin $ymax $out_file1 "$pdf_size"
-    #end if
+  <command>
+python '$__tool_directory__/bar_chart.py' '$input'
+#if $xtic.userSpecified == "Yes"
+    $xtic.xticColumn
+#else
+    0
+#end if
+$colList '$title' '$ylabel' $ymin $ymax '$out_file1' '$pdf_size'
   </command>
   <inputs>
     <param name="input" type="data" format="tabular" label="Dataset" help="Dataset missing? See TIP below"/>
@@ -18,11 +22,11 @@
         <when value="No">
         </when>
     </conditional>
-    <param name="colList" label="Numerical columns" type="data_column" numerical="True" multiple="True" data_ref="input" help="Multi-select list - hold the appropriate key while clicking to select multiple columns" />
-    <param name="title" type="text" size="30" value="Bar Chart" label="Plot title"/>
-    <param name="ylabel" type="text" size="30" value="V1" label="Label for Y axis"/>
-    <param name="ymin" type="integer" size="4" value="0" label="Minimal value on Y axis" help="set to 0 for autoscaling"/>
-    <param name="ymax" type="integer" size="4" value="0" label="Maximal value on Y axis" help="set to 0 for autoscaling"/>
+    <param name="colList" type="data_column" numerical="true" multiple="true" data_ref="input" label="Numerical columns" help="Multi-select list - hold the appropriate key while clicking to select multiple columns" />
+    <param name="title" type="text" value="Bar Chart" label="Plot title"/>
+    <param name="ylabel" type="text" value="V1" label="Label for Y axis"/>
+    <param name="ymin" type="integer" value="0" label="Minimal value on Y axis" help="set to 0 for autoscaling"/>
+    <param name="ymax" type="integer" value="0" label="Maximal value on Y axis" help="set to 0 for autoscaling"/>
     <param name="pdf_size" type="select" label="Choose chart size (pixels)">
         <option value="800,600">Normal: 800 by 600</option>
         <option value="640,480">Small: 640 by 480</option>
@@ -33,7 +37,7 @@
     </param>
   </inputs>
   <outputs>
-    <data format="png" name="out_file1" />
+    <data name="out_file1" format="png" />
   </outputs>
   <requirements>
     <requirement type="package">gnuplot-py</requirement>
@@ -53,5 +57,5 @@ Graphing columns 2 and 3 while using column 1 for X Tick Labels will produce the
 .. image:: ${static_path}/images/bar_chart.png
    :height: 324
    :width: 540
-</help>
+  </help>
 </tool>
diff --git a/tools/plotting/boxplot.xml b/tools/plotting/boxplot.xml
index 415e02e2f8c..9c59980ec23 100644
--- a/tools/plotting/boxplot.xml
+++ b/tools/plotting/boxplot.xml
@@ -6,10 +6,10 @@
   </requirements>
   <inputs>
     <param name="input_file" type="data" format="tabular" label="Quality Statistics File"/>
-    <param name="title" type="text" value="Box plot in Galaxy" label="Title for plot" size="50"/>
+    <param name="title" type="text" value="Box plot in Galaxy" label="Title for plot" />
     <param name="graph_size" type="text" value="2048,768" label="Dimensions of Graph"/>
-    <param name="xlabel" type="text" value="X Axis Label" label="X axis label" size="50"/>
-    <param name="ylabel" type="text" value="Score Value" label="Y axis label" size="50"/>
+    <param name="xlabel" type="text" value="X Axis Label" label="X axis label" />
+    <param name="ylabel" type="text" value="Score Value" label="Y axis label" />
     <param name="xcol" type="data_column" data_ref="input_file" label="Column for X axis position" default_value="1" help="A unique number; c1 if plotting output of FASTQ summary"/>
     <param name="q1col" type="data_column" data_ref="input_file" label="Column for Q1" default_value="7" help="c7 if plotting output of FASTQ summary"/>
     <param name="medcol" type="data_column" data_ref="input_file" label="Column for Median" default_value="8" help="c8 if plotting output of FASTQ summary"/>
diff --git a/tools/solid_tools/maq_cs_wrapper.xml b/tools/solid_tools/maq_cs_wrapper.xml
index 8fe3fb7e68e..a3d3ec04cbf 100644
--- a/tools/solid_tools/maq_cs_wrapper.xml
+++ b/tools/solid_tools/maq_cs_wrapper.xml
@@ -1,56 +1,53 @@
 <tool id="maq_cs_wrapper" name="MAQ for SOLiD" version="1.0.0">
     <description> </description>
-    <command interpreter="python">
-    maq_cs_wrapper.py 
-    $output1 
-    $output2 
-    $ref 
-    $library_type.f3_reads 
-    $library_type.f3_qual 
-    $library_type.is_paired
-    #if $library_type.is_paired == "yes":  
-     $library_type.r3_reads 
-     $library_type.r3_qual 
-    #else:
-     "None"
-     "None"
-    #end if
-    $min_mapqual
-    $max_mismatch
-    $output3
-    
+    <command>
+python '$__tool_directory__/maq_cs_wrapper.py'
+'$output1'
+'$output2'
+'$ref'
+'$library_type.f3_reads'
+'$library_type.f3_qual'
+$library_type.is_paired
+#if $library_type.is_paired == "yes":
+    '$library_type.r3_reads'
+    '$library_type.r3_qual'
+#else:
+    "None"
+    "None"
+#end if
+$min_mapqual
+$max_mismatch
+'$output3'
     </command>
 
     <inputs>
-        <param name="ref" type="data" format="fasta" label="Target Genome"/> 
+        <param name="ref" type="data" format="fasta" label="Target Genome"/>
         <conditional name="library_type">
           <param name="is_paired" type="select" label="Is the library mate-paired?" multiple="false">
              <option value="no">No</option>
              <option value="yes">Yes</option>
          </param>
          <when value="no">
-           <param name="f3_reads" type="data" format="csfasta" label="F3 reads file"/> 
-           <param format="qualsolid" name="f3_qual" type="data" label="F3 quality file" help="If your dataset doesn't show up in the menu, click the pencil icon next to your dataset and set the datatype to 'qualsolid'" /> 
+           <param name="f3_reads" type="data" format="csfasta" label="F3 reads file"/>
+           <param name="f3_qual" type="data" format="qualsolid" label="F3 quality file" help="If your dataset doesn't show up in the menu, click the pencil icon next to your dataset and set the datatype to 'qualsolid'" />
           </when>
           <when value="yes">
-           <param name="f3_reads" type="data" format="csfasta" label="F3 reads file"/> 
-           <param format="qualsolid" name="f3_qual" type="data" label="F3 quality file" help="If your dataset doesn't show up in the menu, click the pencil icon next to your dataset and set the datatype to 'qualsolid'" /> 
-           <param name="r3_reads" type="data" format="csfasta" label="R3 reads file"/> 
-           <param format="qualsolid" name="r3_qual" type="data" label="R3 quality file" help="If your dataset doesn't show up in the menu, click the pencil icon next to your dataset and set the datatype to 'qualsolid'" /> 
+           <param name="f3_reads" type="data" format="csfasta" label="F3 reads file"/>
+           <param name="f3_qual" type="data" format="qualsolid" label="F3 quality file" help="If your dataset doesn't show up in the menu, click the pencil icon next to your dataset and set the datatype to 'qualsolid'" />
+           <param name="r3_reads" type="data" format="csfasta" label="R3 reads file"/>
+           <param name="r3_qual" type="data" format="qualsolid" label="R3 quality file" help="If your dataset doesn't show up in the menu, click the pencil icon next to your dataset and set the datatype to 'qualsolid'" />
           </when>
       </conditional>
-      <param name="min_mapqual" type="integer" size="3" value="0" label="Minimum mapping quality allowed for a read to be used" help="Reads below the specified mapping quality will not be considered in coverage and SNP analysis."/> 
-      <param name="max_mismatch" type="integer" size="3" value="7" label="Maximum number of mismatches allowed for a read to be used" help="Reads above the specified threshold will not be considered in coverage and SNP analysis."/> 
+      <param name="min_mapqual" type="integer" value="0" label="Minimum mapping quality allowed for a read to be used" help="Reads below the specified mapping quality will not be considered in coverage and SNP analysis."/>
+      <param name="max_mismatch" type="integer" value="7" label="Maximum number of mismatches allowed for a read to be used" help="Reads above the specified threshold will not be considered in coverage and SNP analysis."/>
     </inputs>
     <outputs>
-        <data format="tabular" name="output1" metadata_source="ref" />
-        <data format="tabular" name="output2" metadata_source="ref" />
-        <data format="customtrack" name="output3" metadata_source="ref" />
+        <data name="output1" format="tabular" metadata_source="ref" />
+        <data name="output2" format="tabular" metadata_source="ref" />
+        <data name="output3" format="customtrack" metadata_source="ref" />
     </outputs>
-    
     <!--  "ToolTestCase does not deal with multiple outputs properly yet."
     <tests>
-        
         <test>
             <param name="ref" value="phiX_mod.fasta" />
             <param name="is_paired" value="no" />
@@ -61,24 +58,22 @@
             <output name="output1" file="phiX_solid_maq.map" />
             <output name="output2" file="phiX_solid_maq.pileup" />
             <output name="output3" file="phiX_solid_maq.ctrack" />
-            
         </test>
     </tests>
     -->
 <help>
-
 .. class:: infomark
 
 **What it does**
 
-This tool maps SOLiD color-space reads against the target genome using MAQ. It produces three output datasets: 
+This tool maps SOLiD color-space reads against the target genome using MAQ. It produces three output datasets:
 
 
-**ALIGNMENT INFO** : contains the read alignment information, 
+**ALIGNMENT INFO** : contains the read alignment information,
 
 **PILEUP** : contains the coverage and SNP statistics for every nucleotide of the target genome,
 
-**CUSTOM TRACK** : contains the coverage and SNP statistics as custom tracks displayable in the UCSC browser. 
+**CUSTOM TRACK** : contains the coverage and SNP statistics as custom tracks displayable in the UCSC browser.
 
 -----
 
@@ -113,8 +108,6 @@ This tool maps SOLiD color-space reads against the target genome using MAQ. It p
 * column 7  = number of Ts
 * column 8  = number of Gs
 * column 9  = number of Cs
-
-</help>
-<code file="maq_cs_wrapper_code.py"/>
-
+  </help>
+  <code file="maq_cs_wrapper_code.py"/>
 </tool>
diff --git a/tools/sr_mapping/PerM.xml b/tools/sr_mapping/PerM.xml
index d0b84ea11fe..1df2dcd570d 100644
--- a/tools/sr_mapping/PerM.xml
+++ b/tools/sr_mapping/PerM.xml
@@ -84,8 +84,8 @@
           <when value="paired">
             <param name="reads1" format="fastqcssanger" label="Forward FASTQ file" type="data" />
             <param name="reads2" format="fastqcssanger" label="Reverse FASTQ file" type="data" />
-            <param label="Upperbound of pairs separation (-U)" name="upperbound" type="integer" size="8" value="100000" />
-            <param label="Lowerbound of pairs separation (-L)" name="lowerbound" type="integer" size="8" value="0" />
+            <param label="Upperbound of pairs separation (-U)" name="upperbound" type="integer" value="100000" />
+            <param label="Lowerbound of pairs separation (-L)" name="lowerbound" type="integer" value="0" />
             <param label="Exclude ambiguous pairs (-e)" name="excludeAmbiguousPairs" type="boolean" checked="false" truevalue="-e" falsevalue="" />
           </when>
         </conditional>
@@ -116,14 +116,14 @@
           <when value="paired">
             <param name="reads1" format="fastqsanger" label="Forward FASTQ file" type="data" />
             <param name="reads2" format="fastqsanger" label="Reverse FASTQ file" type="data" />
-            <param label="Upperbound of pairs separation (-U)" name="upperbound" type="integer" size="8" value="100000" />
-            <param label="Lowerbound of pairs separation (-L)" name="lowerbound" type="integer" size="8" value="0" />
+            <param label="Upperbound of pairs separation (-U)" name="upperbound" type="integer" value="100000" />
+            <param label="Lowerbound of pairs separation (-L)" name="lowerbound" type="integer" value="0" />
             <param label="Exclude ambiguous pairs (-e)" name="excludeAmbiguousPairs" type="boolean" checked="false" truevalue="-e" falsevalue="" />
           </when>
         </conditional>
       </when>
     </conditional>
-    <param label="Maximum number of mismatches permitted in one end of full read (-v)" name="valAlign" type="integer" size="5" value="2" />
+    <param label="Maximum number of mismatches permitted in one end of full read (-v)" name="valAlign" type="integer" value="2" />
     <conditional name="align">
       <param help="Use default setting or specify full parameters list" label="PerM settings to use" name="options" type="select">
         <option value="preSet">Commonly used</option>
@@ -147,7 +147,7 @@
           <option value=":">Colon</option>
           <option value="_">Underscore</option>
         </param>
-        <param label="Use the first n bases of each read for alignment (-T)" name="sTrimL" type="integer" size="5" value="50" />
+        <param name="sTrimL" type="integer" value="50" label="Use the first n bases of each read for alignment (-T)" />
         <param name="includeReadsWN" type="boolean" checked="true" truevalue="--includeReadsWN" falsevalue="" label="Include reads with 'N' or '.' by encoding '.' as 3, 'N' as 'A' (--includeReadsWN)" /> 
         <param name="statsOnly" type="boolean" checked="false" truevalue="--statsOnly" falsevalue="" label="Output mapping stats only. Don't output alignments (--statsOnly)" />
         <param name="ignoreQS" type="boolean" checked="false" truevalue="--ignoreQS" falsevalue="" label="Ignore quality scores (--ignoreQS)" />
diff --git a/tools/sr_mapping/bfast_wrapper.xml b/tools/sr_mapping/bfast_wrapper.xml
index 4c28721990d..c901969d7e8 100644
--- a/tools/sr_mapping/bfast_wrapper.xml
+++ b/tools/sr_mapping/bfast_wrapper.xml
@@ -72,7 +72,7 @@
       <when value="history">
         <param name="ownFile" type="data" format="fasta" metadata_name="dbkey" label="Select a reference from history" />
         <repeat name="custom_index" title="Custom indice" min="1" >
-            <param name="mask" type="text" value="" label="Specify the mask" size="20">
+            <param name="mask" type="text" value="" label="Specify the mask">
               <!-- <validator type="no_options" message="No indexes are available for the selected input dataset"/> need is int validator here or regex all 01s-->
             </param>
             <param name="hash_width" type="integer" value="" label="Hash Width" />
diff --git a/tools/stats/filtering.xml b/tools/stats/filtering.xml
index 460479e664f..1a20cf40c94 100644
--- a/tools/stats/filtering.xml
+++ b/tools/stats/filtering.xml
@@ -11,7 +11,7 @@
   </configfiles>
   <inputs>
     <param format="tabular" name="input" type="data" label="Filter" help="Dataset missing? See TIP below."/>
-    <param name="cond" size="40" type="text" value="c1=='chr22'" label="With following condition" help="Double equal signs, ==, must be used as shown above. To filter for an arbitrary string, use the Select tool.">
+    <param name="cond" type="text" value="c1=='chr22'" label="With following condition" help="Double equal signs, ==, must be used as shown above. To filter for an arbitrary string, use the Select tool.">
       <validator type="empty_field" message="Enter a valid filtering condition, see syntax and examples below."/>
       <sanitizer>
         <valid initial="string.printable"/>
diff --git a/tools/stats/gsummary.xml b/tools/stats/gsummary.xml
index f7168d2400b..b314c8671e2 100644
--- a/tools/stats/gsummary.xml
+++ b/tools/stats/gsummary.xml
@@ -9,25 +9,26 @@
   <stdio>
     <exit_code range="1" level="fatal" />
   </stdio>
-  <command>python $__tool_directory__/gsummary.py "$input" "$out_file1" "$cond"</command>
+  <command>
+python '$__tool_directory__/gsummary.py' '$input' '$out_file1' '$cond'
+  </command>
   <inputs>
-    <param format="tabular" name="input" type="data" label="Summary statistics on" help="Dataset missing? See TIP below"/>
-    <param name="cond" size="30" type="text" value="c5" label="Column or expression" help="See syntax below">
+    <param name="input" type="data" format="tabular" label="Summary statistics on" help="Dataset missing? See TIP below"/>
+    <param name="cond" type="text" value="c5" label="Column or expression" help="See syntax below">
       <validator type="empty_field" message="Enter a valid column or expression, see syntax below for examples"/>
     </param>
   </inputs>
   <outputs>
-    <data format="tabular" name="out_file1" />
+    <data name="out_file1" format="tabular" />
   </outputs>
   <tests>
     <test>
       <param name="input" value="1.bed"/>
-      <output name="out_file1" file="gsummary_out1.tabular"/>
       <param name="cond" value="c2"/>
+      <output name="out_file1" file="gsummary_out1.tabular"/>
     </test>
   </tests>
   <help>
-
 .. class:: warningmark
 
 This tool expects input datasets consisting of tab-delimited columns (blank or comment lines beginning with a # character are automatically skipped).
@@ -77,6 +78,5 @@ This tool computes basic summary statistics on a given column, or on a valid exp
 
     #sum       mean      stdev     0%        25%       50%       75%        100%
     29250.000  7312.500  7198.636  1700.000  1895.000  5280.000  10697.500  16990.000
-
-</help>
+  </help>
 </tool>
diff --git a/tools/stats/gsummary.xml.groups b/tools/stats/gsummary.xml.groups
index 218ab31aa38..b043ed5682e 100644
--- a/tools/stats/gsummary.xml.groups
+++ b/tools/stats/gsummary.xml.groups
@@ -1,17 +1,17 @@
 <tool id="Summary Statistics1" name="Summary Statistics">
   <description>of a column in a tab delimited file according to an expression</description>
-  <command interpreter="python">gsummary.py $input $out_file1 "$cond" "$groups"</command>
+  <command>
+python '$__tool_directory__/gsummary.py' '$input' '$out_file1' '$cond' '$groups'
+  </command>
   <inputs>
-    <param name="cond" size="40" type="text" value="c5" label="expression"/>
-    <param name="groups" size="40" type="text" value="none" label="group terms (c1,c4,etc.)"/>
-    <param format="txt" name="input" type="data" label="summary statistics on"/>
-
+    <param name="cond" type="text" value="c5" label="expression"/>
+    <param name="groups" type="text" value="none" label="group terms (c1,c4,etc.)"/>
+    <param name="input" type="data" format="txt" label="summary statistics on"/>
   </inputs>
   <outputs>
-    <data format="txt" name="out_file1" />
+    <data name="out_file1" format="txt" />
   </outputs>
   <help>
-
 .. class:: warningmark
 
 This tool expects input datasets to consist of tab-delimited columns (blank or comment lines beginning with a # character are automatically skipped).
@@ -33,7 +33,6 @@ This tool computes basic summary statistics on a given column, or on an expressi
     + **c1**  *group by the values in column 1*
     + **c1,c4** *group by the values in column 1, then by the values in column 4*
 
-
 -----
 
 **Expression examples**
@@ -52,11 +51,10 @@ This tool computes basic summary statistics on a given column, or on an expressi
 
 .. class:: infomark
 
-**TIP:** Most functions (like *abs*) take only a single expression. *log* can take one or two parameters, like *log(expression,base)* 
+**TIP:** Most functions (like *abs*) take only a single expression. *log* can take one or two parameters, like *log(expression,base)*
 
 Currently, these R functions are supported: *abs, sign, sqrt, floor, ceiling, trunc, round, signif, exp, log, cos, sin, tan, acos, asin, atan, cosh, sinh, tanh, acosh, asinh, atanh, lgamma, gamma, gammaCody, digamma, trigamma, cumsum, cumprod, cummax, cummin*
 
 .. |INFO| image:: ./static/images/icon_info_sml.gif
-
-</help>
+  </help>
 </tool>