From eba71eb234e5277de5e0c26ab75e27a7526534d6 Mon Sep 17 00:00:00 2001 From: Jeremy Goecks Date: Thu, 8 Jul 2010 15:43:22 -0400 Subject: [PATCH] Enable 'extract genomic DNA' tool to accept and produce GFF files and added functional tests for this feature. --- lib/galaxy/tools/util/gff_util.py | 36 ++++++++++++++++++-------- tools/extract/extract_genomic_dna.py | 11 +++++++- tools/extract/extract_genomic_dna.xml | 36 +++++++++++++++++++------- tools/new_operations/gops_intersect.py | 2 +- tools/new_operations/gops_subtract.py | 2 +- 5 files changed, 64 insertions(+), 23 deletions(-) diff --git a/lib/galaxy/tools/util/gff_util.py b/lib/galaxy/tools/util/gff_util.py index a7acbeaf41b..85843fa4ebf 100644 --- a/lib/galaxy/tools/util/gff_util.py +++ b/lib/galaxy/tools/util/gff_util.py @@ -6,23 +6,37 @@ from bx.intervals.io import NiceReaderWrapper, GenomicInterval class GFFReaderWrapper( NiceReaderWrapper ): """ - Reader wrapper converts GFF format--starting and ending coordinates are 1-based, closed--to the 'traditional' interval format--0 based, - half-open. This is useful when using GFF files as inputs to tools that expect traditional interval format. + Reader wrapper converts GFF format--starting and ending coordinates are 1-based, closed--to the + 'traditional'/BED interval format--0 based, half-open. This is useful when using GFF files as inputs + to tools that expect traditional interval format. """ def parse_row( self, line ): - interval = GenomicInterval( self, line.split( "\t" ), self.chrom_col, self.start_col, self.end_col, self.strand_col, self.default_strand, fix_strand=self.fix_strand ) - # Change from 1-based to 0-based format. - interval.start -= 1 - # Add 1 to end to move from closed to open format for end coordinate. - interval.end += 1 + interval = GenomicInterval( self, line.split( "\t" ), self.chrom_col, self.start_col, self.end_col, \ + self.strand_col, self.default_strand, fix_strand=self.fix_strand ) + interval = convert_gff_coords_to_bed( interval ) return interval -def convert_to_gff_coordinates( interval ): +def convert_bed_coords_to_gff( interval ): """ - Converts a GenomicInterval's coordinates to GFF format. + Converts an interval object's coordinates from BED format to GFF format. Accepted object types include + GenomicInterval and list (where the first element in the list is the interval's start, and the second + element is the interval's end). """ if type( interval ) is GenomicInterval: interval.start += 1 - interval.end -= 1 - return interval + elif type ( interval ) is list: + interval[ 0 ] += 1 return interval + +def convert_gff_coords_to_bed( interval ): + """ + Converts an interval object's coordinates from GFF format to BED format. Accepted object types include + GenomicInterval and list (where the first element in the list is the interval's start, and the second + element is the interval's end). + """ + if type( interval ) is GenomicInterval: + interval.start -= 1 + elif type ( interval ) is list: + interval[ 0 ] -= 1 + return interval + \ No newline at end of file diff --git a/tools/extract/extract_genomic_dna.py b/tools/extract/extract_genomic_dna.py index 7ebdbd60a27..4b6ffcbe6fd 100644 --- a/tools/extract/extract_genomic_dna.py +++ b/tools/extract/extract_genomic_dna.py @@ -5,6 +5,7 @@ usage: %prog $input $out_file1 -d, --dbkey=N: Genome build of input file -o, --output_format=N: the data type of the output file -g, --GALAXY_DATA_INDEX_DIR=N: the directory containing alignseq.loc + -G, --gff: input and output file, when it is interval, coordinates are treated as GFF format (1-based, half-open) rather than 'traditional' 0-based, closed format. """ from galaxy import eggs import pkg_resources @@ -14,6 +15,7 @@ from bx.cookbook import doc_optparse import bx.seq.nib import bx.seq.twobit from galaxy.tools.util.galaxyops import * +from galaxy.tools.util.gff_util import * assert sys.version_info[:2] >= ( 2, 4 ) @@ -50,6 +52,7 @@ def __main__(): chrom_col, start_col, end_col, strand_col = parse_cols_arg( options.cols ) dbkey = options.dbkey output_format = options.output_format + gff_format = options.gff GALAXY_DATA_INDEX_DIR = options.GALAXY_DATA_INDEX_DIR input_filename, output_filename = args except: @@ -80,6 +83,8 @@ def __main__(): chrom = fields[chrom_col] start = int( fields[start_col] ) end = int( fields[end_col] ) + if gff_format: + start, end = convert_gff_coords_to_bed( [start, end] ) if includes_strand_col: strand = fields[strand_col] except: @@ -162,7 +167,11 @@ def __main__(): c = b else: # output_format == "interval" meta_data = "\t".join( fields ) - fout.write( "%s\t%s\n" % ( meta_data, str( sequence ) ) ) + if gff_format: + format_str = "%s seq \"%s\";\n" + else: + format_str = "%s\t%s\n" + fout.write( format_str % ( meta_data, str( sequence ) ) ) fout.close() diff --git a/tools/extract/extract_genomic_dna.xml b/tools/extract/extract_genomic_dna.xml index b2b41614eb2..13715947866 100644 --- a/tools/extract/extract_genomic_dna.xml +++ b/tools/extract/extract_genomic_dna.xml @@ -1,20 +1,27 @@ using coordinates from assembled/unassembled genomes - extract_genomic_dna.py $input $out_file1 -1 ${input.metadata.chromCol},${input.metadata.startCol},${input.metadata.endCol},${input.metadata.strandCol} -d $dbkey -o $out_format -g ${GALAXY_DATA_INDEX_DIR} + + extract_genomic_dna.py $input $out_file1 -d $dbkey -o $out_format -g ${GALAXY_DATA_INDEX_DIR} + #if isinstance( $input.datatype, $__app__.datatypes_registry.get_datatype_by_extension('gff').__class__): + -1 1,4,5,7 --gff + #else: + -1 ${input.metadata.chromCol},${input.metadata.startCol},${input.metadata.endCol},${input.metadata.strandCol} + #end if + - - - + + + - - + + - + - + @@ -34,6 +41,17 @@ + + + + + + + + + + + @@ -90,7 +108,7 @@ Extracting sequences with **FASTA** output data type returns:: CACCAAAACCCTCATCAAGACAATTGTCACCAGGATCAATGACATTTCAC ACACG -Extrracting sequences with **Interval** output data type returns:: +Extracting sequences with **Interval** output data type returns:: chr7 127475281 127475310 NM_000230 0 + GTAGGAATCGCAGCGCCAGCGGTTGCAAG chr7 127485994 127486166 NM_000230 0 + GCCCAAGAAGCCCATCCTGGGAAGGAAAATGCATTGGGGAACCCTGTGCGGATTCTTGTGGCTTTGGCCCTATCTTTTCTATGTCCAAGCTGTGCCCATCCAAAAAGTCCAAGATGACACCAAAACCCTCATCAAGACAATTGTCACCAGGATCAATGACATTTCACACACG diff --git a/tools/new_operations/gops_intersect.py b/tools/new_operations/gops_intersect.py index 5b1bd83b803..6e39d36863c 100755 --- a/tools/new_operations/gops_intersect.py +++ b/tools/new_operations/gops_intersect.py @@ -70,7 +70,7 @@ def main(): for line in intersect( [g1,g2], pieces=pieces, mincols=mincols ): if type( line ) == GenomicInterval: if in1_gff_format: - line = convert_to_gff_coordinates( line ) + line = convert_bed_coords_to_gff( line ) out_file.write( "%s\n" % "\t".join( line.fields ) ) else: out_file.write( "%s\n" % line ) diff --git a/tools/new_operations/gops_subtract.py b/tools/new_operations/gops_subtract.py index 03c542aa079..44ca7143f2e 100644 --- a/tools/new_operations/gops_subtract.py +++ b/tools/new_operations/gops_subtract.py @@ -71,7 +71,7 @@ def main(): for line in subtract( [g1,g2], pieces=pieces, mincols=mincols ): if type( line ) is GenomicInterval: if in1_gff_format: - line = convert_to_gff_coordinates( line ) + line = convert_bed_coords_to_gff( line ) out_file.write( "%s\n" % "\t".join( line.fields ) ) else: out_file.write( "%s\n" % line )