From 1fedf7e680ef287e81e7a55b668b74a0aefc5d77 Mon Sep 17 00:00:00 2001 From: Jelle Scholtalbers Date: Thu, 2 Nov 2017 10:34:56 +0100 Subject: [PATCH 001/112] add maintenance.sh to simplify setting up a cleanup cron job or run the cleanup scripts in general --- scripts/common_startup_variables.sh | 38 ++++++++++++ scripts/maintenance.sh | 90 +++++++++++++++++++++++++++++ 2 files changed, 128 insertions(+) create mode 100755 scripts/common_startup_variables.sh create mode 100755 scripts/maintenance.sh diff --git a/scripts/common_startup_variables.sh b/scripts/common_startup_variables.sh new file mode 100755 index 00000000000..dd3e9a95b1b --- /dev/null +++ b/scripts/common_startup_variables.sh @@ -0,0 +1,38 @@ +#!/usr/bin/env bash + +# This file is sourced in the maintenance.sh script and could be sourced in ./run.sh or ./run_reports.sh +SCRIPTLOCATION="$( cd "$( dirname "${BASH_SOURCE[0]}" )" && pwd )" +# If there is a file that defines a shell environment specific to this +# instance of Galaxy, source the file. +if [ -z $GALAXY_LOCAL_ENV_FILE ]; +then + GALAXY_LOCAL_ENV_FILE="$SCRIPTLOCATION/../config/local_env.sh" +fi + +if [ -f $GALAXY_LOCAL_ENV_FILE ]; +then + echo "Activating local env file: $GALAXY_LOCAL_ENV_FILE" + . $GALAXY_LOCAL_ENV_FILE +fi + +# If there is a .venv/ directory, assume it contains a virtualenv that we +# should run this instance in. +GALAXY_VIRTUAL_ENV="${GALAXY_VIRTUAL_ENV:-$SCRIPTLOCATION/../.venv}" +if [ -d "$GALAXY_VIRTUAL_ENV" -a -z "$skip_venv" ]; +then + [ -n "$PYTHONPATH" ] && { echo 'Unsetting $PYTHONPATH'; unset PYTHONPATH; } + echo "Activating virtualenv at $GALAXY_VIRTUAL_ENV" + . "$GALAXY_VIRTUAL_ENV/bin/activate" +fi +if [ -z "$GALAXY_CONFIG_FILE" ]; then + if [ -f "$SCRIPTLOCATION/../universe_wsgi.ini" ]; then + GALAXY_CONFIG_FILE=universe_wsgi.ini + elif [ -f "$SCRIPTLOCATION/../config/galaxy.ini" ]; then + GALAXY_CONFIG_FILE=config/galaxy.ini + else + GALAXY_CONFIG_FILE=config/galaxy.ini.sample + fi + export GALAXY_CONFIG_FILE +fi + +echo "GALAXY_CONFIG_FILE: ${GALAXY_CONFIG_FILE}" diff --git a/scripts/maintenance.sh b/scripts/maintenance.sh new file mode 100755 index 00000000000..594f459a6da --- /dev/null +++ b/scripts/maintenance.sh @@ -0,0 +1,90 @@ +#!/usr/bin/env bash + +# Configure this script in a cron job to run some common cleanup operations +# Set the Environment variable GALAXY_CONFIG_FILE to use a custom galaxy config file. + +set -e + +display_help(){ + scriptname=`basename $0` + printf "./$scriptname [--help] [--no-dry-run] [--days 10] +Will run the galaxy cleanup scripts in the recommend order. By default a 'dry-run' is started. Specify --no-dry-run to do the actual cleanup. + +--help Show this help +--dry-run|--no-dry-run Dry run(default), will only print out what the scripts would have done. Specify --no-dry-run to do the actual cleanup. +--days Number of days to use as a cut off; do not act on objects updated more recently than this +" +} + +# number of days to use as a cut off; do not act on objects updated more recently than this +DAYS=10 +DRYRUN=true + +while : +do + case "$1" in + --no-dry-run) + DRYRUN=false + shift + ;; + --dry-run ) # default + DRYRUN=true + shift + ;; + --days ) + DAYS="$2" + shift; shift + ;; + -h ) + display_help + exit 1 + ;; + --help ) + display_help + exit 1 + ;; + "") + break + ;; + *) + shift + ;; + esac +done + +SCRIPTLOCATION="$( cd "$( dirname "${BASH_SOURCE[0]}" )" && pwd )" +source ${SCRIPTLOCATION}/common_startup_variables.sh + +if [ "$DRYRUN" = true ]; then + MODE="--info_only" +else + MODE="-r" +fi + +MAINTENANCE_LOG="$SCRIPTLOCATION/../maintenance.log" +COMMANDS=( +"python scripts/cleanup_datasets/cleanup_datasets.py $GALAXY_CONFIG_FILE -d $DAYS $MODE --delete_userless_histories >> $MAINTENANCE_LOG" +"python scripts/cleanup_datasets/cleanup_datasets.py $GALAXY_CONFIG_FILE -d $DAYS $MODE --purge_histories >> $MAINTENANCE_LOG" +"python scripts/cleanup_datasets/cleanup_datasets.py $GALAXY_CONFIG_FILE -d $DAYS $MODE --purge_datasets >> $MAINTENANCE_LOG" +"python scripts/cleanup_datasets/cleanup_datasets.py $GALAXY_CONFIG_FILE -d $DAYS $MODE --purge_folders >> $MAINTENANCE_LOG" +"python scripts/cleanup_datasets/cleanup_datasets.py $GALAXY_CONFIG_FILE -d $DAYS $MODE --delete_datasets >> $MAINTENANCE_LOG" +"python scripts/cleanup_datasets/cleanup_datasets.py $GALAXY_CONFIG_FILE -d $DAYS $MODE --purge_datasets >> $MAINTENANCE_LOG") + +printf "\nDry run: $DRYRUN\nDays: $DAYS\n\n" +echo "Will run following commands and output in $MAINTENANCE_LOG" +for (( i = 0; i < ${#COMMANDS[@]} ; i++ )); do + echo "${COMMANDS[$i]}" +done + +if [ "$DRYRUN" = false ]; then + echo "python scripts/set_user_disk_usage.py >> $MAINTENANCE_LOG" +fi + +# Run the commands +for (( i = 0; i < ${#COMMANDS[@]} ; i++ )); do + eval "${COMMANDS[$i]}" +done + +if [ "$DRYRUN" = false ]; then + python scripts/set_user_disk_usage.py >> $MAINTENANCE_LOG +fi From b372c3b4b9e339b8c4f81ae88e57fc4a37731769 Mon Sep 17 00:00:00 2001 From: Jelle Scholtalbers Date: Thu, 2 Nov 2017 12:37:39 +0100 Subject: [PATCH 002/112] fix location of cleanup_datasets.py if executed outside of the root --- scripts/maintenance.sh | 17 +++++++++-------- 1 file changed, 9 insertions(+), 8 deletions(-) diff --git a/scripts/maintenance.sh b/scripts/maintenance.sh index 594f459a6da..757da5efd00 100755 --- a/scripts/maintenance.sh +++ b/scripts/maintenance.sh @@ -63,12 +63,12 @@ fi MAINTENANCE_LOG="$SCRIPTLOCATION/../maintenance.log" COMMANDS=( -"python scripts/cleanup_datasets/cleanup_datasets.py $GALAXY_CONFIG_FILE -d $DAYS $MODE --delete_userless_histories >> $MAINTENANCE_LOG" -"python scripts/cleanup_datasets/cleanup_datasets.py $GALAXY_CONFIG_FILE -d $DAYS $MODE --purge_histories >> $MAINTENANCE_LOG" -"python scripts/cleanup_datasets/cleanup_datasets.py $GALAXY_CONFIG_FILE -d $DAYS $MODE --purge_datasets >> $MAINTENANCE_LOG" -"python scripts/cleanup_datasets/cleanup_datasets.py $GALAXY_CONFIG_FILE -d $DAYS $MODE --purge_folders >> $MAINTENANCE_LOG" -"python scripts/cleanup_datasets/cleanup_datasets.py $GALAXY_CONFIG_FILE -d $DAYS $MODE --delete_datasets >> $MAINTENANCE_LOG" -"python scripts/cleanup_datasets/cleanup_datasets.py $GALAXY_CONFIG_FILE -d $DAYS $MODE --purge_datasets >> $MAINTENANCE_LOG") +"python $SCRIPTLOCATION/cleanup_datasets/cleanup_datasets.py $GALAXY_CONFIG_FILE -d $DAYS $MODE --delete_userless_histories >> $MAINTENANCE_LOG" +"python $SCRIPTLOCATION/cleanup_datasets/cleanup_datasets.py $GALAXY_CONFIG_FILE -d $DAYS $MODE --purge_histories >> $MAINTENANCE_LOG" +"python $SCRIPTLOCATION/cleanup_datasets/cleanup_datasets.py $GALAXY_CONFIG_FILE -d $DAYS $MODE --purge_datasets >> $MAINTENANCE_LOG" +"python $SCRIPTLOCATION/cleanup_datasets/cleanup_datasets.py $GALAXY_CONFIG_FILE -d $DAYS $MODE --purge_folders >> $MAINTENANCE_LOG" +"python $SCRIPTLOCATION/cleanup_datasets/cleanup_datasets.py $GALAXY_CONFIG_FILE -d $DAYS $MODE --delete_datasets >> $MAINTENANCE_LOG" +"python $SCRIPTLOCATION/cleanup_datasets/cleanup_datasets.py $GALAXY_CONFIG_FILE -d $DAYS $MODE --purge_datasets >> $MAINTENANCE_LOG") printf "\nDry run: $DRYRUN\nDays: $DAYS\n\n" echo "Will run following commands and output in $MAINTENANCE_LOG" @@ -77,14 +77,15 @@ for (( i = 0; i < ${#COMMANDS[@]} ; i++ )); do done if [ "$DRYRUN" = false ]; then - echo "python scripts/set_user_disk_usage.py >> $MAINTENANCE_LOG" + echo "python $SCRIPTLOCATION/set_user_disk_usage.py >> $MAINTENANCE_LOG" fi # Run the commands +cd $SCRIPTLOCATION/../ for (( i = 0; i < ${#COMMANDS[@]} ; i++ )); do eval "${COMMANDS[$i]}" done if [ "$DRYRUN" = false ]; then - python scripts/set_user_disk_usage.py >> $MAINTENANCE_LOG + python $SCRIPTLOCATION/set_user_disk_usage.py >> $MAINTENANCE_LOG fi From c1debb7c63d9b61d7391bb8abbf474d6272be662 Mon Sep 17 00:00:00 2001 From: John Chilton Date: Fri, 1 Dec 2017 09:43:44 -0500 Subject: [PATCH 003/112] Refactor galaxy.ini.sample config comments toward per-option docs. --- config/galaxy.ini.sample | 75 ++++++++++++++++++++++++++-------------- 1 file changed, 49 insertions(+), 26 deletions(-) diff --git a/config/galaxy.ini.sample b/config/galaxy.ini.sample index 8deb3317110..c7d4f216b6e 100644 --- a/config/galaxy.ini.sample +++ b/config/galaxy.ini.sample @@ -944,7 +944,7 @@ use_interactive = True # -- Toolbox Search -# The following boosts are used to customize this instance's toolbox search. +# Boosts are used to customize this instance's toolbox search. # The higher the boost, the more importance the scoring algorithm gives to the # given field. Section refers to the tool group in the tool panel. Rest of # the fields are tool's attributes. @@ -965,8 +965,10 @@ use_interactive = True # each ngram #tool_enable_ngram_search = False -# Set minimum and maximum sizes of ngrams +# Set minimum size of ngrams #tool_ngram_minsize = 3 + +# Set maximum size of ngrams #tool_ngram_maxsize = 4 # -- Users and Security @@ -1086,10 +1088,12 @@ use_interactive = True # Set the following to a number of threads greater than 1 to spawn # a Python task queue for dealing with large tool submissions (either # through the tool form or as part of an individual workflow step across -# large collection). The size of a "large" tool request is controlled by -# the second parameter below and defaults to 10. This affects workflow -# scheduling and web processes, not job handlers. +# large collection). This affects workflow scheduling and web processes, +# not job handlers. This is a beta option and should not be used in production. #tool_submission_burst_threads = 1 + +# If tool_submission_burst_threads is set to a number greater than 1, this +# is the number of jobs to schedule at which the task queue will be created. #tool_submission_burst_at = 10 # Enable beta workflow modules that should not yet be considered part of Galaxy's @@ -1136,8 +1140,12 @@ use_interactive = True # Enable authentication via OpenID. Allows users to log in to their Galaxy # account by authenticating with an OpenID provider. #enable_openid = False -# .sample used if default does not exist + +# If OpenID is enabled, this configuration file specifies providers to use. +# Falls back to the .sample variant in config if default does not exist. #openid_config_file = config/openid_conf.xml + +# If OpenID is enabled, consumer cache directory to use. #openid_consumer_cache_path = database/openid_consumer_cache # XML config file that allows the use of different authentication providers @@ -1316,19 +1324,26 @@ use_interactive = True # always, onsuccess, never #cleanup_job = always -# For sites where all users in Galaxy match users on the system on which Galaxy -# runs, the DRMAA job runner can be configured to submit jobs to the DRM as the -# actual user instead of as the user running the Galaxy server process. For -# details on these options, see the documentation at: -# -# https://galaxyproject.org/admin/config/performance/cluster -# +# When running DRMAA jobs as the Galaxy user +# (https://galaxyproject.org/admin/config/performance/cluster/#submitting-jobs-as-the-real-user) +# this script is used to run the job script Galaxy generates for a tool execution. #drmaa_external_runjob_script = sudo -E scripts/drmaa_external_runner.py --assign_all_groups + +# When running DRMAA jobs as the Galaxy user +# (https://galaxyproject.org/admin/config/performance/cluster/#submitting-jobs-as-the-real-user) +# this script is used to kill such jobs by Galaxy (e.g. if the user cancels +# the job). #drmaa_external_killjob_script = sudo -E scripts/drmaa_external_killer.py + +# When running DRMAA jobs as the Galaxy user +# (https://galaxyproject.org/admin/config/performance/cluster/#submitting-jobs-as-the-real-user) +# this script is used transfer permissions back and forth between the Galaxy user +# and the user that is running the job. #external_chown_script = sudo -E scripts/external_chown_script.py -# For the job submission as the actual system user, Galaxy can extract -# the user name from the email address (actually the local-part before the @) +# When running DRMAA jobs as the Galaxy user +# (https://galaxyproject.org/admin/config/performance/cluster/#submitting-jobs-as-the-real-user) +# Galaxy can extract the user name from the email address (actually the local-part before the @) # or the username which are both stored in the Galaxy data base. # The latter option is particularly useful for installations that get the # authentication from LDAP. @@ -1367,24 +1382,32 @@ use_interactive = True # -- ToolBox filtering -# Modules from lib/galaxy/tools/toolbox/filters/ can be specified in -# the following lines. tool_* filters will be applied for all users -# and can not be changed by them. user_tool_* filters will be shown -# under user preferences and can be toggled on and off at -# runtime. Example shown below are not real defaults (no custom -# filters are applied by default), but can be enabled by renaming the -# examples.py.sample in the filters directory to examples.py. - +# Define toolbox filters (https://galaxyproject.org/user-defined-toolbox-filters/) +# that admins may use to restrict the tools to display. #tool_filters = + +# Define toolbox filters (https://galaxyproject.org/user-defined-toolbox-filters/) +# that admins may use to restrict the tool labels to display. #tool_label_filters = + +# Define toolbox filters (https://galaxyproject.org/user-defined-toolbox-filters/) +# that admins may use to restrict the tool sections to display. #tool_section_filters = + +# Define toolbox filters (https://galaxyproject.org/user-defined-toolbox-filters/) +# that users may use to restrict the tools to display. #user_tool_filters = examples:restrict_upload_to_admins, examples:restrict_encode + +# Define toolbox filters (https://galaxyproject.org/user-defined-toolbox-filters/) +# that users may use to restrict the tool sections to display. #user_tool_section_filters = examples:restrict_text + +# Define toolbox filters (https://galaxyproject.org/user-defined-toolbox-filters/) +# that users may use to restrict the tool labels to display. #user_tool_label_filters = examples:restrict_upload_to_admins, examples:restrict_encode -# The base modules that are searched for modules as described above -# can be modified and modules external to Galaxy can be searched by -# modifying the following option. +# The base module(s) that are searched for modules for toolbox filtering +# (https://galaxyproject.org/user-defined-toolbox-filters/) producedures. #toolbox_filter_base_modules = galaxy.tools.toolbox.filters,galaxy.tools.filters # -- Galaxy Application Internal Message Queue From 025f92bb73c7347536bf23f2adcff833c3c7284c Mon Sep 17 00:00:00 2001 From: John Chilton Date: Thu, 30 Nov 2017 14:04:56 -0500 Subject: [PATCH 004/112] Random fix for tool filters. --- lib/galaxy/tools/toolbox/filters/__init__.py | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/lib/galaxy/tools/toolbox/filters/__init__.py b/lib/galaxy/tools/toolbox/filters/__init__.py index 6a0d0c43a57..43710bdcaf0 100644 --- a/lib/galaxy/tools/toolbox/filters/__init__.py +++ b/lib/galaxy/tools/toolbox/filters/__init__.py @@ -73,7 +73,7 @@ class FilterFactory(object): else: # No module found, just load a function from this file or # one that has be explicitly imported. - function = getattr(globals(), filter_name.strip()) + function = globals()[filter_name.strip()] return function def _import_filter(self, module_name, function_name): From cd30a3424f3e564f3729b083e6abbd642c0122fa Mon Sep 17 00:00:00 2001 From: John Chilton Date: Fri, 1 Dec 2017 15:04:28 -0500 Subject: [PATCH 005/112] Don't read global configuration for reports - it doesn't use it. --- lib/galaxy/webapps/reports/config.py | 7 ------- 1 file changed, 7 deletions(-) diff --git a/lib/galaxy/webapps/reports/config.py b/lib/galaxy/webapps/reports/config.py index 80b20d3b46e..79f1757fc72 100644 --- a/lib/galaxy/webapps/reports/config.py +++ b/lib/galaxy/webapps/reports/config.py @@ -4,8 +4,6 @@ import os import re import sys -from six.moves import configparser - from galaxy.util import string_as_bool log = logging.getLogger(__name__) @@ -53,11 +51,6 @@ class Configuration(object): self.cookie_path = kwargs.get("cookie_path", "/") # Error logging with sentry self.sentry_dsn = kwargs.get('sentry_dsn', None) - # Parse global_conf - global_conf = kwargs.get('global_conf', None) - global_conf_parser = configparser.ConfigParser() - if global_conf and "__file__" in global_conf: - global_conf_parser.read(global_conf['__file__']) def get(self, key, default): return self.config_dict.get(key, default) From 6dd0684be3f8825676a7854b6f36faf874f03176 Mon Sep 17 00:00:00 2001 From: John Chilton Date: Fri, 1 Dec 2017 10:54:20 -0500 Subject: [PATCH 006/112] Fix ignoring ".sample" in newish path module. Required to correctly detect the extension of sample configuration files. --- lib/galaxy/util/path/__init__.py | 4 +++- 1 file changed, 3 insertions(+), 1 deletion(-) diff --git a/lib/galaxy/util/path/__init__.py b/lib/galaxy/util/path/__init__.py index aef913f3bf2..9dcff5f1c6a 100644 --- a/lib/galaxy/util/path/__init__.py +++ b/lib/galaxy/util/path/__init__.py @@ -224,7 +224,9 @@ def __splitext_ignore(path, ignore=None): ignore = map(__ext_strip_sep, __listify(ignore)) root, ext = __splitext_no_sep(path) if ext in ignore: - root, ext = __splitext_no_sep(path) + new_path = path[0:(-len(ext) - 1)] + root, ext = __splitext_no_sep(new_path) + return (root, ext) From 4a2a7e79459f65f1686c8814ca1a4a59bf829be5 Mon Sep 17 00:00:00 2001 From: John Chilton Date: Thu, 30 Nov 2017 08:51:34 -0500 Subject: [PATCH 007/112] config_manage.py - allow printing comment header on sample description files. Generated from the desc field in the app schema. --- lib/galaxy/webapps/config_manage.py | 6 ++++++ 1 file changed, 6 insertions(+) diff --git a/lib/galaxy/webapps/config_manage.py b/lib/galaxy/webapps/config_manage.py index 695500a9cff..8bde7355d28 100644 --- a/lib/galaxy/webapps/config_manage.py +++ b/lib/galaxy/webapps/config_manage.py @@ -215,6 +215,7 @@ class AppSchema(Schema): self.raw_schema = config_all app_schema = config_all["mapping"][app_name] super(AppSchema, self).__init__(app_schema["mapping"]) + self.description = config_all.get("desc", None) def get_app_option(self, name): try: @@ -550,6 +551,11 @@ def _build_sample_yaml(args, app_desc): 'uwsgi_module': app_desc.uwsgi_module, }) value[field] = new_field_value + description = getattr(schema, "description", None) + if description: + description = description.lstrip() + as_comment = "\n".join(["# %s" % l for l in description.split("\n")]) + "\n" + f.write(as_comment) _write_sample_section(args, f, 'uwsgi', Schema(options), as_comment=False) _write_sample_section(args, f, app_desc.app_name, schema) destination = os.path.join(args.galaxy_root, app_desc.sample_destination) From 87ace980d73ba7130dd29015145a09bd10f6dd68 Mon Sep 17 00:00:00 2001 From: John Chilton Date: Thu, 30 Nov 2017 13:02:30 -0500 Subject: [PATCH 008/112] config_manage.py - fix sample file generation for large default values. The various messages in the Galaxy config were being split across lines and generating invalid YAML. --- lib/galaxy/webapps/config_manage.py | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/lib/galaxy/webapps/config_manage.py b/lib/galaxy/webapps/config_manage.py index 8bde7355d28..5637218cac5 100644 --- a/lib/galaxy/webapps/config_manage.py +++ b/lib/galaxy/webapps/config_manage.py @@ -613,7 +613,7 @@ def _write_option(args, f, key, option_value, as_comment=False): comment = "\n".join(YAML_COMMENT_WRAPPER.wrap(desc)) comment += "\n" as_comment_str = "#" if as_comment else "" - key_val_str = yaml.dump({key: value}).lstrip("{").rstrip("\n}") + key_val_str = yaml.dump({key: value}, width=float("inf")).lstrip("{").rstrip("\n}") lines = "%s%s%s" % (comment, as_comment_str, key_val_str) lines_idented = "\n".join([(" %s" % l) for l in lines.split("\n")]) f.write("%s\n\n" % lines_idented) From 146dfd21143774d5451b4417eb223d73cdc23573 Mon Sep 17 00:00:00 2001 From: John Chilton Date: Thu, 30 Nov 2017 13:30:26 -0500 Subject: [PATCH 009/112] config_manage.py - hack uWSGI section of sample file generation. Because uWSGI seems really bad at parsing fairly simple, entirely valid YAML. --- lib/galaxy/webapps/config_manage.py | 13 ++++++++----- 1 file changed, 8 insertions(+), 5 deletions(-) diff --git a/lib/galaxy/webapps/config_manage.py b/lib/galaxy/webapps/config_manage.py index 5637218cac5..be63935945a 100644 --- a/lib/galaxy/webapps/config_manage.py +++ b/lib/galaxy/webapps/config_manage.py @@ -556,7 +556,7 @@ def _build_sample_yaml(args, app_desc): description = description.lstrip() as_comment = "\n".join(["# %s" % l for l in description.split("\n")]) + "\n" f.write(as_comment) - _write_sample_section(args, f, 'uwsgi', Schema(options), as_comment=False) + _write_sample_section(args, f, 'uwsgi', Schema(options), as_comment=False, uwsgi_hack=True) _write_sample_section(args, f, app_desc.app_name, schema) destination = os.path.join(args.galaxy_root, app_desc.sample_destination) _write_to_file(args, f, destination) @@ -586,13 +586,13 @@ def _order_load_path(path): return raw_config -def _write_sample_section(args, f, section_header, schema, as_comment=True): +def _write_sample_section(args, f, section_header, schema, as_comment=True, uwsgi_hack=False): _write_header(f, section_header) for key, value in schema.app_schema.items(): default = None if "default" not in value else value["default"] option = schema.get_app_option(key) option_value = OptionValue(key, default, option) - _write_option(args, f, key, option_value, as_comment=as_comment) + _write_option(args, f, key, option_value, as_comment=as_comment, uwsgi_hack=uwsgi_hack) def _write_section(args, f, section_header, section_dict): @@ -605,7 +605,7 @@ def _write_header(f, section_header): f.write("%s:\n\n" % section_header) -def _write_option(args, f, key, option_value, as_comment=False): +def _write_option(args, f, key, option_value, as_comment=False, uwsgi_hack=False): option, value = _parse_option_value(option_value) desc = option["desc"] comment = "" @@ -613,7 +613,10 @@ def _write_option(args, f, key, option_value, as_comment=False): comment = "\n".join(YAML_COMMENT_WRAPPER.wrap(desc)) comment += "\n" as_comment_str = "#" if as_comment else "" - key_val_str = yaml.dump({key: value}, width=float("inf")).lstrip("{").rstrip("\n}") + if uwsgi_hack: + key_val_str = "%s: %s" % (key, value) + else: + key_val_str = yaml.dump({key: value}, width=float("inf")).lstrip("{").rstrip("\n}") lines = "%s%s%s" % (comment, as_comment_str, key_val_str) lines_idented = "\n".join([(" %s" % l) for l in lines.split("\n")]) f.write("%s\n\n" % lines_idented) From 72466136d148848b560827ac5b34945d308216ed Mon Sep 17 00:00:00 2001 From: John Chilton Date: Thu, 30 Nov 2017 13:40:40 -0500 Subject: [PATCH 010/112] config_manage.py - improve default value formatting in RST. --- lib/galaxy/webapps/config_manage.py | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/lib/galaxy/webapps/config_manage.py b/lib/galaxy/webapps/config_manage.py index be63935945a..5925d20c9fa 100644 --- a/lib/galaxy/webapps/config_manage.py +++ b/lib/galaxy/webapps/config_manage.py @@ -302,7 +302,7 @@ def _write_option_rst(args, rst, key, heading_level, option_value): rst.write("\n") type = option.get("type", None) default = option.get("default", "*null*") - rst.write(":Default: %s\n" % default) + rst.write(":Default: ``%s``\n" % default) if type: rst.write(":Type: %s\n" % type) rst.write("\n\n") From 1b58157d003db7a663aa102994aea2873e2f7a7b Mon Sep 17 00:00:00 2001 From: John Chilton Date: Fri, 1 Dec 2017 14:48:07 -0500 Subject: [PATCH 011/112] config_manage.py - fix to generate YAML booleans in RST docs. The new default - might as well use that representation. --- lib/galaxy/webapps/config_manage.py | 4 ++++ 1 file changed, 4 insertions(+) diff --git a/lib/galaxy/webapps/config_manage.py b/lib/galaxy/webapps/config_manage.py index 5925d20c9fa..06c0c70a691 100644 --- a/lib/galaxy/webapps/config_manage.py +++ b/lib/galaxy/webapps/config_manage.py @@ -302,6 +302,10 @@ def _write_option_rst(args, rst, key, heading_level, option_value): rst.write("\n") type = option.get("type", None) default = option.get("default", "*null*") + if default is True: + default = "true" + elif default is False: + default = "false" rst.write(":Default: ``%s``\n" % default) if type: rst.write(":Type: %s\n" % type) From 0ae21925b7c08c82a8daf4887e78ca66b06f38e9 Mon Sep 17 00:00:00 2001 From: John Chilton Date: Thu, 30 Nov 2017 14:38:34 -0500 Subject: [PATCH 012/112] convert_yaml - script to convert galaxy.ini.sample to config_schema.yml. --- tmp_config_convert/convert.py | 81 +++++++++++++++++++++++++++++++++++ 1 file changed, 81 insertions(+) create mode 100644 tmp_config_convert/convert.py diff --git a/tmp_config_convert/convert.py b/tmp_config_convert/convert.py new file mode 100644 index 00000000000..ac541f126c1 --- /dev/null +++ b/tmp_config_convert/convert.py @@ -0,0 +1,81 @@ + +import string + +HEADER = """ +type: map +desc: | + Galaxy is configured by default to be usable in a single-user development + environment. To tune the application for a multi-user production + environment, see the documentation at: + + http://usegalaxy.org/production + + Throughout this sample configuration file, except where stated otherwise, + uncommented values override the default if left unset, whereas commented + values are set to the default value. Relative paths are relative to the root + Galaxy directory. + + Examples of many of these options are explained in more detail in the Galaxy + Community Hub. + + https://galaxyproject.org/admin/config + + Config hackers are encouraged to check there before asking for help. +mapping: + uwsgi: !include uwsgi_schema.yml + galaxy: + type: map + required: true + mapping: +""" + +OPTION_TEMPLATE = string.Template(""" $name: + type: $type_guess +$default_line required: false + desc: | +$desc""") + +print(HEADER) +with open("galaxy.ini.sample", "r") as f: + lines = f.readlines() + + last_block = "" + for line in lines: + line = line.rstrip("\n") + if not line.strip(): + last_block = "" + continue + if line.startswith("# ") or line == "#": + last_block += line.lstrip("#") + "\n" + continue + elif line.startswith("#"): + assert "=" in line, line + name, value = line.split("=", 1) + name = name.lstrip("#").strip() + default = value.strip() + desc = "\n".join([" %s" % l for l in last_block.split("\n")]) + type_guess = "str" + if default: + # Python -> YAML + if default == "None": + default = "null" + if name.endswith("_boost"): + # boost search modifiers - only floats? + type_guess = "float" + elif default.isdigit(): + type_guess = "int" + elif default.lower() in ["true", "false"]: + type_guess = "bool" + default = default.lower() + default_line = " default: %s\n" % default + else: + default_line = "" + + print(OPTION_TEMPLATE.safe_substitute( + name=name, + default_line=default_line, + desc=desc, + type_guess=type_guess, + )) + else: + assert False, "[%s]" % line From 44341ba5c1ca11bf94eb97c9644d3ac11f1b0268 Mon Sep 17 00:00:00 2001 From: John Chilton Date: Thu, 30 Nov 2017 14:36:31 -0500 Subject: [PATCH 013/112] convert_yaml - setup copy of galaxy.ini.sample for conversion to work on. --- tmp_config_convert/galaxy.ini.sample | 1455 ++++++++++++++++++++++++++ 1 file changed, 1455 insertions(+) create mode 100644 tmp_config_convert/galaxy.ini.sample diff --git a/tmp_config_convert/galaxy.ini.sample b/tmp_config_convert/galaxy.ini.sample new file mode 100644 index 00000000000..c7d4f216b6e --- /dev/null +++ b/tmp_config_convert/galaxy.ini.sample @@ -0,0 +1,1455 @@ +# +# Galaxy is configured by default to be usable in a single-user development +# environment. To tune the application for a multi-user production +# environment, see the documentation at: +# +# http://usegalaxy.org/production +# + +# Throughout this sample configuration file, except where stated otherwise, +# uncommented values override the default if left unset, whereas commented +# values are set to the default value. Relative paths are relative to the root +# Galaxy directory. +# +# Examples of many of these options are explained in more detail in the Galaxy +# Community Hub. +# +# https://galaxyproject.org/admin/config +# +# Config hackers are encouraged to check there before asking for help. + +# ---- HTTP Server ---------------------------------------------------------- + +# Configuration of the internal HTTP server. + +[server:main] + +# The internal HTTP server to use. Currently only Paste is provided. This +# option is required. +use = egg:Paste#http + +# The port on which to listen. +#port = 8080 + +# The address on which to listen. By default, only listen to localhost (Galaxy +# will not be accessible over the network). Use '0.0.0.0' to listen on all +# available network interfaces. +#host = 127.0.0.1 + +# Use a threadpool for the web server instead of creating a thread for each +# request. +use_threadpool = True + +# Number of threads in the web server thread pool. +#threadpool_workers = 10 + +# Set the number of seconds a thread can work before you should kill it +# (assuming it will never finish) to 3 hours. Default is 600 (10 minutes). +threadpool_kill_thread_limit = 10800 + +# ---- Filters -------------------------------------------------------------- + +# Filters sit between Galaxy and the HTTP server. + +# These filters are disabled by default. They can be enabled with +# 'filter-with' in the [app:main] section below. + +# Define the gzip filter. +[filter:gzip] +use = egg:Paste#gzip + +# Define the proxy-prefix filter. +[filter:proxy-prefix] +use = egg:PasteDeploy#prefix +prefix = /galaxy + +# ---- Galaxy --------------------------------------------------------------- + +# Configuration of the Galaxy application. + +[app:main] + +# -- Application and filtering + +# The factory for the WSGI application. This should not be changed. +paste.app_factory = galaxy.web.buildapp:app_factory + +# If not running behind a proxy server, you may want to enable gzip compression +# to decrease the size of data transferred over the network. If using a proxy +# server, please enable gzip compression there instead. +#filter-with = gzip + +# If running behind a proxy server and Galaxy is served from a subdirectory, +# enable the proxy-prefix filter and set the prefix in the +# [filter:proxy-prefix] section above. +#filter-with = proxy-prefix + +# If proxy-prefix is enabled and you're running more than one Galaxy instance +# behind one hostname, you will want to set this to the same path as the prefix +# in the filter above. This value becomes the "path" attribute set in the +# cookie so the cookies from each instance will not clobber each other. +#cookie_path = None + +# -- Database + +# By default, Galaxy uses a SQLite database at 'database/universe.sqlite'. You +# may use a SQLAlchemy connection string to specify an external database +# instead. This string takes many options which are explained in detail in the +# config file documentation. +#database_connection = sqlite:///./database/universe.sqlite?isolation_level=IMMEDIATE + +# If the server logs errors about not having enough database pool connections, +# you will want to increase these values, or consider running more Galaxy +# processes. +#database_engine_option_pool_size = 5 +#database_engine_option_max_overflow = 10 + +# If using MySQL and the server logs the error "MySQL server has gone away", +# you will want to set this to some positive value (7200 should work). +#database_engine_option_pool_recycle = -1 + +# If large database query results are causing memory or response time issues in +# the Galaxy process, leave the result on the server instead. This option is +# only available for PostgreSQL and is highly recommended. +#database_engine_option_server_side_cursors = False + +# Log all database transactions, can be useful for debugging and performance +# profiling. Logging is done via Python's 'logging' module under the qualname +# 'galaxy.model.orm.logging_connection_proxy' +#database_query_profiling_proxy = False + +# If auto-creating a postgres database on startup - it can be based on an existing +# template database. This will set that. This is probably only useful for testing but +# documentation is included here for completeness. +#database_template = None + +# Slow query logging. Queries slower than the threshold indicated below will +# be logged to debug. A value of '0' is disabled. For example, you would set +# this to .005 to log all queries taking longer than 5 milliseconds. +#slow_query_log_threshold = 0 + +# By default, Galaxy will use the same database to track user data and +# tool shed install data. There are many situations in which it is +# valuable to separate these - for instance bootstrapping fresh Galaxy +# instances with pretested installs. The following option can be used to +# separate the tool shed install database (all other options listed above +# but prefixed with install_ are also available). +#install_database_connection = sqlite:///./database/universe.sqlite?isolation_level=IMMEDIATE + +# Setting the following option to true will cause Galaxy to automatically +# migrate the database forward after updates. This is not recommended for production +# use. +#database_auto_migrate = False + +# -- Files and directories + +# Dataset files are stored in this directory. +#file_path = database/files + +# Temporary files are stored in this directory. +#new_file_path = database/tmp + +# Tool config files, defines what tools are available in Galaxy. +# Tools can be locally developed or installed from Galaxy tool sheds. +# (config/tool_conf.xml.sample will be used if left unset and +# config/tool_conf.xml does not exist). +#tool_config_file = config/tool_conf.xml,config/shed_tool_conf.xml + +# Enable / disable checking if any tools defined in the above non-shed +# tool_config_files (i.e., tool_conf.xml) have been migrated from the Galaxy +# code distribution to the Tool Shed. This setting should generally be set to +# False only for development Galaxy environments that are often rebuilt from +# scratch where migrated tools do not need to be available in the Galaxy tool +# panel. If the following setting remains commented, the default setting will +# be True. +#check_migrate_tools = True + +# Tool config maintained by tool migration scripts. If you use the migration +# scripts to install tools that have been migrated to the tool shed upon a new +# release, they will be added to this tool config file. +#migrated_tools_config = config/migrated_tools_conf.xml + +# File that contains the XML section and tool tags from all tool panel config +# files integrated into a single file that defines the tool panel layout. This +# file can be changed by the Galaxy administrator to alter the layout of the +# tool panel. If not present, Galaxy will create it. +#integrated_tool_panel_config = integrated_tool_panel.xml + +# Default path to the directory containing the tools defined in tool_conf.xml. +# Other tool config files must include the tool_path as an attribute in the +# tag. +#tool_path = tools + +# -- Tool dependencies + +# Path to the directory in which tool dependencies are placed. This is used by +# the Tool Shed to install dependencies and can also be used by administrators +# to manually install or link to dependencies. For details, see: +# https://galaxyproject.org/admin/config/tool-dependencies +# Set the string to None to explicitly disable tool dependency handling. +# If this option is set to none or an invalid path, installing tools with dependencies +# from the Tool Shed will fail. +#tool_dependency_dir = database/dependencies + +# The dependency resolvers config file specifies an ordering and options for how +# Galaxy resolves tool dependencies (requirement tags in Tool XML). The default +# ordering is to the use the Tool Shed for tools installed that way, use local +# Galaxy packages, and then use Conda if available. +# See https://github.com/galaxyproject/galaxy/blob/dev/doc/source/admin/dependency_resolvers.rst +# for more information on these options. +#dependency_resolvers_config_file = config/dependency_resolvers_conf.xml + +# The following Conda dependency resolution options will change the defaults for +# all Conda resolvers, but multiple resolvers can be configured independently +# in dependency_resolvers_config_file and these options overridden. +# Location on the filesystem where Conda packages are installed + +# conda_prefix is the location on the filesystem where Conda packages and environments are installed +# IMPORTANT: Due to a current limitation in conda, the total length of the +# conda_prefix and the job_working_directory path should be less than 50 characters! +#conda_prefix = /_conda +# Override the Conda executable to use, it will default to the one on the +# PATH (if available) and then to /bin/conda +#conda_exec = +# Pass debug flag to conda commands. +#conda_debug = False +# conda channels to enable by default (http://conda.pydata.org/docs/custom-channels.html) +#conda_ensure_channels = iuc,bioconda,conda-forge,defaults,r +# Set to True to instruct Galaxy to look for and install missing tool +# dependencies before each job runs. +#conda_auto_install = False +# Set to True to instruct Galaxy to install Conda from the web automatically +# if it cannot find a local copy and conda_exec is not configured. +#conda_auto_init = True +# You must set this to True if conda_prefix and job_working_directory are not on the same +# volume, or some conda dependencies will fail to execute at job runtime. +# Conda will copy packages content instead of creating hardlinks or symlinks. +# This will prevent problems with some specific packages (perl, R), at the cost +# of extra disk space usage and extra time spent copying packages. +#conda_copy_dependencies = False + +# Certain dependency resolvers (namely Conda) take a considerable amount of +# time to build an isolated job environment in the job_working_directory if the +# job working directory is on a network share. Set the following option to True +# to cache the dependencies in a folder. This option is beta and should only be +# used if you experience long waiting times before a job is actually submitted +# to your cluster. +#use_cached_dependency_manager = False + +# By default the tool_dependency_cache_dir is the _cache directory +# of the tool dependency directory +#tool_dependency_cache_dir = /_cache + +# By default, when using a cached dependency manager, the dependencies are cached +# when installing new tools and when using tools for the first time. +# Set this to False if you prefer dependencies to be cached only when installing new tools. +#precache_dependencies = True + +# File containing the Galaxy Tool Sheds that should be made available to +# install from in the admin interface (.sample used if default does not exist). +#tool_sheds_config_file = config/tool_sheds_conf.xml + +# Set to True to enable monitoring of tools and tool directories +# listed in any tool config file specified in tool_config_file option. +# If changes are found, tools are automatically reloaded. Watchdog ( +# https://pypi.python.org/pypi/watchdog ) must be installed and +# available to Galaxy to use this option. Other options include 'auto' +# which will attempt to watch tools if the watchdog library is available +# but won't fail to load Galaxy if it is not and 'polling' which will use +# a less efficient monitoring scheme that may work in wider range of scenarios +# than the watchdog default. +#watch_tools = False + +# Enable Galaxy to fetch Docker containers registered with quay.io generated +# from tool requirements resolved through conda. These containers (when +# available) have been generated using mulled - https://github.com/mulled. +# These containers are highly beta and availability will vary by tool. +# This option will additionally only be used for job destinations with +# Docker enabled. +#enable_beta_mulled_containers = False + +# Container resolvers configuration (beta). Setup a file describing container +# resolvers to use when discovering containers for Galaxy. If this is set to +# None, the default containers loaded is determined by +# enable_beta_mulled_containers. +#containers_resolvers_config_file = None + +# involucro is a tool used to build Docker containers for tools from Conda +# dependencies referenced in tools as `requirement`s. The following path is +# the location of involucro on the Galaxy host. This is ignored if the relevant +# container resolver isn't enabled, and will install on demand unless +# involucro_auto_init is set to False. +#involucro_path = database/dependencies/involucro + +# Install involucro as needed to build Docker containers for tools. Ignored if +# relevant container resolver is not used. +#involucro_auto_init = True + +# Enable automatic polling of relative tool sheds to see if any updates +# are available for installed repositories. Ideally only one Galaxy +# server process should be able to check for repository updates. The +# setting for hours_between_check should be an integer between 1 and 24. +#enable_tool_shed_check = False +#hours_between_check = 12 + +# Enable use of an in-memory registry with bi-directional relationships between +# repositories (i.e., in addition to lists of dependencies for a repository, +# keep an in-memory registry of dependent items for each repository. +#manage_dependency_relationships = False + +# XML config file that contains data table entries for the +# ToolDataTableManager. This file is manually # maintained by the Galaxy +# administrator (.sample used if default does not exist). +#tool_data_table_config_path = config/tool_data_table_conf.xml + +# XML config file that contains additional data table entries for the +# ToolDataTableManager. This file is automatically generated based on the +# current installed tool shed repositories that contain valid +# tool_data_table_conf.xml.sample files. At the time of installation, these +# entries are automatically added to the following file, which is parsed and +# applied to the ToolDataTableManager at server start up. +#shed_tool_data_table_config = config/shed_tool_data_table_conf.xml + +# Directory where data used by tools is located. See the samples in that +# directory and the Galaxy Community Hub for help: +# https://galaxyproject.org/admin/data-integration +#tool_data_path = tool-data + +# Directory where Tool Data Table related files will be placed +# when installed from a ToolShed. Defaults to tool_data_path. +#shed_tool_data_path = tool-data + +# Set to True to enable monitoring of the tool_data and shed_tool_data_path +# directories. If changes in tool data table files are found, the tool data +# tables for that data manager are automatically reloaded. +# Watchdog ( https://pypi.python.org/pypi/watchdog ) must be installed and +# available to Galaxy to use this option. Other options include 'auto' +# which will attempt to use the watchdog library if it is available but won't +# fail to load Galaxy if it is not and 'polling' which will use a less +# efficient monitoring scheme that may work in wider range of scenarios +# than the watchdog default. +#watch_tool_data_dir = False + +# File containing old-style genome builds +#builds_file_path = tool-data/shared/ucsc/builds.txt + +# Directory where chrom len files are kept, currently mainly used by trackster +#len_file_path = tool-data/shared/ucsc/chrom + +# Datatypes config file(s), defines what data (file) types are available in +# Galaxy (.sample is used if default does not exist). If a datatype appears in +# multiple files, the last definition is used (though the first sniffer is used +# so limit sniffer definitions to one file). +#datatypes_config_file = config/datatypes_conf.xml + +# Disable the 'Auto-detect' option for file uploads +#datatypes_disable_auto = False + +# Visualizations config directory: where to look for individual visualization +# plugins. The path is relative to the Galaxy root dir. To use an absolute +# path begin the path with '/'. This is a comma separated list. +# Defaults to "config/plugins/visualizations". +#visualization_plugins_directory = config/plugins/visualizations + +# Interactive environment plugins root directory: where to look for interactive +# environment plugins. By default none will be loaded. Set to +# config/plugins/interactive_environments to load Galaxy's stock plugins. +# These will require Docker to be configured and have security considerations, +# so proceed with caution. The path is relative to the Galaxy root dir. To use +# an absolute path begin the path with '/'. This is a comma +# separated list. +#interactive_environment_plugins_directory = + +# To run interactive environment containers in Docker Swarm mode (on an +# existing swarm), set this option to True and set `docker_connect_port` in the +# IE plugin config (ini) file(s) of any IE plugins you have enabled and ensure +# that you are not using any `docker run`-specific options in your plugins' +# `command_inject` options (swarm mode services run using `docker service +# create`, which has a different and more limited set of options). This option +# can be overridden on a per-plugin basis by using the `swarm_mode` option in +# the plugin's ini config file. +#interactive_environment_swarm_mode = False + +# Galaxy can run a "swarm manager" service that will monitor utilization of the +# swarm and provision/deprovision worker nodes as necessary. The service has +# its own configuration file. +#swarm_manager_config_file = config/swarm_manager_conf.yml + +# Interactive tour directory: where to store interactive tour definition files. +# Galaxy ships with several basic interface tours enabled, though a different +# directory with custom tours can be specified here. The path is relative to the +# Galaxy root dir. To use an absolute path begin the path with '/'. This is a comma +# separated list. +#tour_config_dir = config/plugins/tours + +# Webhooks directory: where to store webhooks - plugins to extend the Galaxy UI. +# By default none will be loaded. Set to config/plugins/webhooks/demo to load Galaxy's +# demo webhooks. To use an absolute path begin the path with '/'. This is a comma +# separated list. Add test/functional/webhooks to this list to include the demo webhooks +# used to test the webhook framework. +#webhooks_dir = config/plugins/webhooks + +# Each job is given a unique empty directory as its current working directory. +# This option defines in what parent directory those directories will be +# created. +#job_working_directory = database/jobs_directory + +# If using a cluster, Galaxy will write job scripts and stdout/stderr to this +# directory. +#cluster_files_directory = database/pbs + +# Mako templates are compiled as needed and cached for reuse, this directory is +# used for the cache +#template_cache_path = database/compiled_templates + +# Set to false to disable various checks Galaxy will do to ensure it +# can run job scripts before attempting to execute or submit them. +#check_job_script_integrity = True +# Number of checks to execute if check_job_script_integrity is enabled. +#check_job_script_integrity_count = 35 +# Time to sleep between checks if check_job_script_integrity is enabled (in seconds). +#check_job_script_integrity_sleep = .25 + +# Set the default shell used by non-containerized jobs Galaxy-wide. This +# defaults to bash for all jobs and can be overridden at the destination +# level for heterogeneous clusters. conda job resolution requires bash or zsh +# so if this is switched to /bin/sh for instance - conda resolution +# should be disabled. Containerized jobs always use /bin/sh - so more maximum +# portability tool authors should assume generated commands run in sh. +#default_job_shell = /bin/bash + +# Citation related caching. Tool citations information maybe fetched from +# external sources such as http://dx.doi.org/ by Galaxy - the following +# parameters can be used to control the caching used to store this information. +#citation_cache_type = file +#citation_cache_data_dir = database/citations/data +#citation_cache_lock_dir = database/citations/lock + +# Tools with a number of outputs not known until runtime can write these +# outputs to a directory for collection by Galaxy when the job is done. +# Previously, this directory was new_file_path, but using one global directory +# can cause performance problems, so using job_working_directory ('.' or cwd +# when a job is run) is encouraged. By default, both are checked to avoid +# breaking existing tools. +#collect_outputs_from = new_file_path,job_working_directory + +# -- Data Storage (Object Store) +# +# Configuration file for the object store +# If this is set and exists, it overrides any other objectstore settings. +#object_store_config_file = config/object_store_conf.xml + + +# -- Mail and notification + +# Galaxy sends mail for various things: subscribing users to the mailing list +# if they request it, password resets, reporting dataset errors, and sending +# activation emails. To do this, it needs to send mail through an SMTP server, +# which you may define here (host:port). +# Galaxy will automatically try STARTTLS but will continue upon failure. +#smtp_server = None + +# If your SMTP server requires a username and password, you can provide them +# here (password in cleartext here, but if your server supports STARTTLS it +# will be sent over the network encrypted). +#smtp_username = None +#smtp_password = None + +# If your SMTP server requires SSL from the beginning of the connection +#smtp_ssl = False + +# On the user registration form, users may choose to join a mailing list. This +# is the address used to subscribe to the list. Uncomment and leave empty if you +# want to remove this option from the user registration form. +#mailing_join_addr = galaxy-announce-join@bx.psu.edu + +# Datasets in an error state include a link to report the error. Those reports +# will be sent to this address. Error reports are disabled if no address is +# set. Also this email is shown as a contact to user in case of Galaxy +# misconfiguration and other events user may encounter. +#error_email_to = None + +# Email address to use in the 'From' field when sending emails for +# account activations, workflow step notifications and password resets. +# We recommend using string in the following format: +# Galaxy Project +# If not configured, '' will be used. +#email_from = None + +# URL of the support resource for the galaxy instance. Used in activation +# emails. +#instance_resource_url = https://galaxyproject.org/ + +# E-mail domains blacklist is used for filtering out users that are using +# disposable email address during the registration. If their address domain +# matches any domain in the blacklist, they are refused the registration. +#blacklist_file = config/disposable_email_blacklist.conf + +# Registration warning message is used to discourage people from registering +# multiple accounts. Applies mostly for the main Galaxy instance. +# If no message specified the warning box will not be shown. +#registration_warning_message = Please register only one account - we provide this service free of charge and have limited computational resources. Multi-accounts are tracked and will be subjected to account termination and data deletion. + + +# -- Account activation + +# User account activation feature global flag. If set to "False", the rest of +# the Account activation configuration is ignored and user activation is +# disabled (i.e. accounts are active since registration). +# The activation is also not working in case the SMTP server is not defined. +#user_activation_on = False + +# Activation grace period (in hours). Activation is not forced (login is not +# disabled) until grace period has passed. Users under grace period can't run +# jobs. Enter 0 to disable grace period. +# Users with OpenID logins have grace period forever. +#activation_grace_period = 3 + +# Shown in warning box to users that were not activated yet. +# In use only if activation_grace_period is set. +#inactivity_box_content = Your account has not been activated yet. Feel free to browse around and see what's available, but you won't be able to upload data or run jobs until you have verified your email address. + +# Password expiration period (in days). Users are required to change their +# password every x days. Users will be redirected to the change password +# screen when they log in after their password expires. Enter 0 to disable +# password expiration. +#password_expiration_period = 0 + +# Galaxy Session Timeout +# This provides a timeout (in minutes) after which a user will have to log back in. +# A duration of 0 disables this feature. +#session_duration = 0 + + +# -- Analytics + +# You can enter tracking code here to track visitor's behavior +# through your Google Analytics account. Example: UA-XXXXXXXX-Y +#ga_code = None + +# -- Display sites + +# Galaxy can display data at various external browsers. These options specify +# which browsers should be available. URLs and builds available at these +# browsers are defined in the specifield files. + +# If use_remote_user = True, display application servers will be denied access +# to Galaxy and so displaying datasets in these sites will fail. +# display_servers contains a list of hostnames which should be allowed to +# bypass security to display datasets. Please be aware that there are security +# implications if this is allowed. More details (including required changes to +# the proxy server config) are available in the Apache proxy documentation on +# the Galaxy Community Hub. +# +# The list of servers in this sample config are for the UCSC Main, Test and +# Archaea browsers, but the default if left commented is to not allow any +# display sites to bypass security (you must uncomment the line below to allow +# them). +#display_servers = hgw1.cse.ucsc.edu,hgw2.cse.ucsc.edu,hgw3.cse.ucsc.edu,hgw4.cse.ucsc.edu,hgw5.cse.ucsc.edu,hgw6.cse.ucsc.edu,hgw7.cse.ucsc.edu,hgw8.cse.ucsc.edu,lowepub.cse.ucsc.edu + +# To disable the old-style display applications that are hardcoded into +# datatype classes, set enable_old_display_applications = False. +# This may be desirable due to using the new-style, XML-defined, display +# applications that have been defined for many of the datatypes that have the +# old-style. +# There is also a potential security concern with the old-style applications, +# where a malicious party could provide a link that appears to reference the +# Galaxy server, but contains a redirect to a third-party server, tricking a +# Galaxy user to access said site. +#enable_old_display_applications = True + +# -- Next gen LIMS interface on top of existing Galaxy Sample/Request +# management code. + +use_nglims = False +nglims_config_file = tool-data/nglims.yaml + +# -- UI Localization + +# Show a message box under the masthead. +#message_box_visible = False +#message_box_content = None +#message_box_class = info + +# Append "/{brand}" to the "Galaxy" text in the masthead. +#brand = None + +# Format string used when showing date and time information. +# The string may contain: +# - the directives used by Python time.strftime() function (see +# https://docs.python.org/2/library/time.html#time.strftime ), +# - $locale (complete format string for the server locale), +# - $iso8601 (complete format string as specified by ISO 8601 international +# standard). +#pretty_datetime_format = $locale (UTC) + +# URL (with schema http/https) of the Galaxy instance as accessible within your +# local network - if specified used as a default by pulsar file staging and +# Jupyter Docker container for communicating back with Galaxy via the API. +# +# If you are attempting to setup GIEs on Mac OS X with Docker for Mac - this +# should likely be the IP address of your machine on the virtualbox network (vboxnet0) +# setup for the Docker host VM. This can found by running ifconfig and using the +# IP address of the network vboxnet0. +#galaxy_infrastructure_url = http://localhost:8080 + +# If the above URL cannot be determined ahead of time in dynamic environments +# but the port which should be used to access Galaxy can be - this should be +# set to prevent Galaxy from having to guess. For example if Galaxy is sitting +# behind a proxy with REMOTE_USER enabled - infrastructure shouldn't talk to +# Python processes directly and this should be set to 80 or 443, etc... If +# unset this file will be read for a server block defining a port corresponding +# to the webapp. +#galaxy_infrastructure_web_port = 8080 + +# The URL of the page to display in Galaxy's middle pane when loaded. This can +# be an absolute or relative URL. +#welcome_url = /static/welcome.html + +# The URL linked by the "Galaxy/brand" text. +#logo_url = / + +# The URL linked by the "Wiki" link in the "Help" menu. +#wiki_url = https://galaxyproject.org/ + +# The URL linked by the "Support" link in the "Help" menu. +#support_url = https://galaxyproject.org/support + +# The URL linked by the "How to Cite Galaxy" link in the "Help" menu. +#citation_url = https://galaxyproject.org/citing-galaxy + +# The URL linked by the "Search" link in the "Help" menu. +#search_url = https://galaxyproject.org/search/ + +# The URL linked by the "Mailing Lists" link in the "Help" menu. +#mailing_lists_url = https://galaxyproject.org/mailing-lists + +# The URL linked by the "Videos" link in the "Help" menu. +#screencasts_url = https://vimeo.com/galaxyproject + +# Points to the GenomeSpace UI service which will be used by +# the GenomeSpace importer and exporter tools +#genomespace_ui_url = https://gsui.genomespace.org/jsui/ + +# The URL linked by the "Terms and Conditions" link in the "Help" menu, as well +# as on the user registration and login forms and in the activation emails. +#terms_url = None + +# The URL linked by the "Galaxy Q&A" link in the "Help" menu +# The Galaxy Q&A site is under development; when the site is done, this URL +# will be set and uncommented. +#qa_url = + +# Serve static content, which must be enabled if you're not serving it via a +# proxy server. These options should be self explanatory and so are not +# documented individually. You can use these paths (or ones in the proxy +# server) to point to your own styles. +#static_enabled = True +#static_cache_time = 360 +#static_dir = static/ +#static_images_dir = static/images +#static_favicon_dir = static/favicon.ico +#static_scripts_dir = static/scripts/ +#static_style_dir = static/june_2007_style/blue +#static_robots_txt = static/robots.txt + +# Incremental Display Options + +#display_chunk_size = 65536 + +# -- Advanced proxy features + +# For help on configuring the Advanced proxy features, see: +# http://usegalaxy.org/production + +# Apache can handle file downloads (Galaxy-to-user) via mod_xsendfile. Set +# this to True to inform Galaxy that mod_xsendfile is enabled upstream. +#apache_xsendfile = False + +# The same download handling can be done by nginx using X-Accel-Redirect. This +# should be set to the path defined in the nginx config as an internal redirect +# with access to Galaxy's data files (see documentation linked above). +#nginx_x_accel_redirect_base = False + +# nginx can make use of mod_zip to create zip files containing multiple library +# files. If using X-Accel-Redirect, this can be the same value as that option. +#nginx_x_archive_files_base = False + +# If using compression in the upstream proxy server, use this option to disable +# gzipping of library .tar.gz and .zip archives, since the proxy server will do +# it faster on the fly. +#upstream_gzip = False + +# The following default adds a header to web request responses that +# will cause modern web browsers to not allow Galaxy to be embedded in +# the frames of web applications hosted at other hosts - this can help +# prevent a class of attack called clickjacking +# (https://www.owasp.org/index.php/Clickjacking). If you configure a +# proxy in front of Galaxy - please ensure this header remains intact +# to protect your users. Uncomment and leave empty to not set the +# `X-Frame-Options` header. +#x_frame_options = SAMEORIGIN + +# nginx can also handle file uploads (user-to-Galaxy) via nginx_upload_module. +# Configuration for this is complex and explained in detail in the +# documentation linked above. The upload store is a temporary directory in +# which files uploaded by the upload module will be placed. +#nginx_upload_store = False + +# This value overrides the action set on the file upload form, e.g. the web +# path where the nginx_upload_module has been configured to intercept upload +# requests. +#nginx_upload_path = False + +# Galaxy can also use nginx_upload_module to receive files staged out upon job +# completion by remote job runners (i.e. Pulsar) that initiate staging +# operations on the remote end. See the Galaxy nginx documentation for the +# corresponding nginx configuration. +#nginx_upload_job_files_store = False +#nginx_upload_job_files_path = False + +# Have Galaxy manage dynamic proxy component for routing requests to other +# services based on Galaxy's session cookie. It will attempt to do this by +# default though you do need to install node+npm and do an npm install from +# `lib/galaxy/web/proxy/js`. It is generally more robust to configure this +# externally, managing it however Galaxy is managed. If True, Galaxy will only +# launch the proxy if it is actually going to be used (e.g. for Jupyter). +#dynamic_proxy_manage=True + +# As of 16.04 Galaxy supports multiple proxy types. The original NodeJS +# implementation, alongside a new Golang single-binary-no-dependencies +# version. Valid values are (node, golang) +#dynamic_proxy=node + +# The NodeJS dynamic proxy can use an SQLite database or a JSON file for IPC, +# set that here. +#dynamic_proxy_session_map=database/session_map.sqlite + +# Set the port and IP for the the dynamic proxy to bind to, this must match +# the external configuration if dynamic_proxy_manage is False. +#dynamic_proxy_bind_port=8800 +#dynamic_proxy_bind_ip=0.0.0.0 + +# Enable verbose debugging of Galaxy-managed dynamic proxy. +#dynamic_proxy_debug=False + +# The dynamic proxy is proxied by an external proxy (e.g. apache frontend to +# nodejs to wrap connections in SSL). +#dynamic_proxy_external_proxy=False + +# Additionally, when the dynamic proxy is proxied by an upstream server, you'll +# want to specify a prefixed URL so both Galaxy and the proxy reside under the +# same path that your cookies are under. This will result in a url like +# https://FQDN/galaxy-prefix/gie_proxy for proxying +#dynamic_proxy_prefix=gie_proxy + +# The Golang proxy also manages the docker containers more closely than the +# NodeJS proxy, so is able to expose more container management related options + +# This attribute governs the minimum length of time between consecutive HTTP/WS +# requests through the proxy, before the proxy considers a container as being +# inactive and kills it. +#dynamic_proxy_golang_noaccess = 60 + +# In order to kill containers, the golang proxy has to check at some interval +# for possibly dead containers. This is exposed as a configurable parameter, +# but the default value is probably fine. +#dynamic_proxy_golang_clean_interval = 10 + +# The golang proxy needs to know how to talk to your docker daemon. Currently +# TLS is not supported, that will come in an update. +#dynamic_proxy_golang_docker_address = unix:///var/run/docker.sock + +# The golang proxy uses a RESTful HTTP API for communication with Galaxy +# instead of a JSON or SQLite file for IPC. If you do not specify this, it will +# be set randomly for you. You should set this if you are managing the proxy +# manually. +#dynamic_proxy_golang_api_key = None + +# -- Logging and Debugging + +# If True, Galaxy will attempt to configure a simple root logger if a +# "loggers" section does not appear in this configuration file. +#auto_configure_logging = True + +# Verbosity of console log messages. Acceptable values can be found here: +# https://docs.python.org/2/library/logging.html#logging-levels +# A custom debug level of "TRACE" is available for even more verbosity. +#log_level = DEBUG + +# Print database operations to the server log (warning, quite verbose!). +#database_engine_option_echo = False + +# Print database pool operations to the server log (warning, quite verbose!). +#database_engine_option_echo_pool = False + +# Turn on logging of application events and some user events to the database. +#log_events = True + +# Turn on logging of user actions to the database. Actions currently logged +# are grid views, tool searches, and use of "recently" used tools menu. The +# log_events and log_actions functionality will eventually be merged. +#log_actions = True + +# Fluentd configuration. Various events can be logged to the fluentd instance +# configured below by enabling fluent_log. +#fluent_log = False +#fluent_host = localhost +#fluent_port = 24224 + +# Sanitize all HTML tool output. By default, all tool output served as +# 'text/html' will be sanitized thoroughly. This can be disabled if you have +# special tools that require unaltered output. WARNING: disabling this does +# make the Galaxy instance susceptible to XSS attacks initiated by your users. +#sanitize_all_html = True + +# Whitelist sanitization file. +# Datasets created by tools listed in this file are trusted and will not have +# their HTML sanitized on display. This can be manually edited or manipulated +# through the Admin control panel -- see "Manage Display Whitelist" +#sanitize_whitelist_file = config/sanitize_whitelist.txt + +# By default Galaxy will serve non-HTML tool output that may potentially +# contain browser executable JavaScript content as plain text. This will for +# instance cause SVG datasets to not render properly and so may be disabled +# by setting the following option to True. +#serve_xss_vulnerable_mimetypes = False + +# Return a Access-Control-Allow-Origin response header that matches the Origin +# header of the request if that Origin hostname matches one of the strings or +# regular expressions listed here. This is a comma separated list of hostname +# strings or regular expressions beginning and ending with /. +# E.g. mysite.com,google.com,usegalaxy.org,/^[\w\.]*example\.com/ +# See: https://developer.mozilla.org/en-US/docs/Web/HTTP/Access_control_CORS +#allowed_origin_hostnames = None + +# Set the following to True to use Jupyter nbconvert to build HTML from Jupyter +# notebooks in Galaxy histories. This process may allow users to execute +# arbitrary code or serve arbitrary HTML. If enabled, Jupyter must be +# available and on Galaxy's PATH, to do this run +# `pip install jinja2 pygments jupyter` in Galaxy's virtualenv. +#trust_jupyter_notebook_conversion = False + +# Debug enables access to various config options useful for development and +# debugging: use_lint, use_profile, use_printdebug and use_interactive. It +# also causes the files used by PBS/SGE (submission script, output, and error) +# to remain on disk after the job is complete. +#debug = False + +# Check for WSGI compliance. +#use_lint = False + +# Run the Python profiler on each request. +#use_profile = False + +# Intercept print statements and show them on the returned page. +#use_printdebug = True + +# Enable live debugging in your browser. This should NEVER be enabled on a +# public site. Enabled in the sample config for development. +use_interactive = True + +# When stopping Galaxy cleanly, how much time to give various monitoring/polling +# threads to finish before giving up on joining them. Set to 0 to disable this and +# restore the pre-18.01 default behavior. +#monitor_thread_join_timeout = 5 + +# Write thread status periodically to 'heartbeat.log', (careful, uses disk +# space rapidly!). Useful to determine why your processes may be consuming a +# lot of CPU. +#use_heartbeat = False + +# Control the period (in seconds) between dumps. Use -1 to disable. Regardless +# of this setting, if use_heartbeat is enabled, you can send a Galaxy process +# (unless running with uWSGI) SIGUSR1 (`kill -USR1`) to force a dump. +#heartbeat_interval = 20 + +# Heartbeat log filename. Can accept the template variables {server_name} and +# {pid} +#heartbeat_log = heartbeat_{server_name}.log + +# Log to Sentry +# Sentry is an open source logging and error aggregation platform. Setting +# sentry_dsn will enable the Sentry middleware and errors will be sent to the +# indicated sentry instance. This connection string is available in your +# sentry instance under -> Settings -> API Keys. +#sentry_dsn = None + +# Log to statsd +# Statsd is an external statistics aggregator (https://github.com/etsy/statsd) +# Enabling the following options will cause galaxy to log request timing and +# other statistics to the configured statsd instance. The statsd_prefix is +# useful if you are running multiple Galaxy instances and want to segment +# statistics between them within the same aggregator. +#statsd_host= +#statsd_port=8125 +#statsd_prefix=galaxy + +# Log to graphite +# Graphite is an external statistics aggregator (https://github.com/graphite-project/carbon) +# Enabling the following options will cause galaxy to log request timing and +# other statistics to the configured graphite instance. The graphite_prefix is +# useful if you are running multiple Galaxy instances and want to segment +# statistics between them within the same aggregator. +#graphite_host= +#graphite_port=2003 +#graphite_prefix=galaxy + +# -- Data Libraries + +# These library upload options are described in much more detail in the Galaxy +# Community Hub: +# https://galaxyproject.org/data-libraries/ + +# Add an option to the library upload form which allows administrators to +# upload a directory of files. +#library_import_dir = None + +# Add an option to the library upload form which allows authorized +# non-administrators to upload a directory of files. The configured directory +# must contain sub-directories named the same as the non-admin user's Galaxy +# login ( email ). The non-admin user is restricted to uploading files or +# sub-directories of files contained in their directory. +#user_library_import_dir = None + +# For security reasons, users may not import any files that actually lie +# outside of their `user_library_import_dir` (e.g. using symbolic links). A +# list of directories can be allowed by setting the following option (the list +# is comma-separated). Be aware that *any* user with library import permissions +# can import from anywhere in these directories (assuming they are able to +# create symlinks to them). +#user_library_import_symlink_whitelist = None + +# Allow admins to paste filesystem paths during upload. For libraries this +# adds an option to the admin library upload tool allowing admins to paste +# filesystem paths to files and directories in a box, and these paths will be +# added to a library. For history uploads, this allows pasting in paths as URIs. +# (i.e. prefixed with file://). Set to True to enable. Please note the security +# implication that this will give Galaxy Admins access to anything your Galaxy +# user has access to. +#allow_path_paste = False + +# Users may choose to download multiple files from a library in an archive. By +# default, Galaxy allows users to select from a few different archive formats +# if testing shows that Galaxy is able to create files using these formats. +# Specific formats can be disabled with this option, separate more than one +# format with commas. Available formats are currently 'zip', 'gz', and 'bz2'. +#disable_library_comptypes = + +# Some sequencer integration features in beta allow you to automatically +# transfer datasets. This is done using a lightweight transfer manager which +# runs outside of Galaxy (but is spawned by it automatically). Galaxy will +# communicate with this manager over the port specified here. +#transfer_manager_port = 8163 + +# -- Toolbox Search + +# Boosts are used to customize this instance's toolbox search. +# The higher the boost, the more importance the scoring algorithm gives to the +# given field. Section refers to the tool group in the tool panel. Rest of +# the fields are tool's attributes. +#tool_name_boost = 9 +#tool_section_boost = 3 +#tool_description_boost = 2 +#tool_label_boost = 1 +#tool_stub_boost = 5 +#tool_help_boost = 0.5 + +# Limits the number of results in toolbox search. Can be used to tweak how many +# results will appear. +#tool_search_limit = 20 + +# Enable/ disable Ngram-search for tools. It makes tool +# search results tolerant for spelling mistakes in the query +# by dividing the query into multiple ngrams and search for +# each ngram +#tool_enable_ngram_search = False + +# Set minimum size of ngrams +#tool_ngram_minsize = 3 + +# Set maximum size of ngrams +#tool_ngram_maxsize = 4 + +# -- Users and Security + +# Galaxy encodes various internal values when these values will be output in +# some format (for example, in a URL or cookie). You should set a key to be +# used by the algorithm that encodes and decodes these values. It can be any +# string up to 448 bits long. +# One simple way to generate a value for this is with the shell command: +# python -c 'import time; print time.time()' | md5sum | cut -f 1 -d ' ' +#id_secret = USING THE DEFAULT IS NOT SECURE! + +# User authentication can be delegated to an upstream proxy server (usually +# Apache). The upstream proxy should set a REMOTE_USER header in the request. +# Enabling remote user disables regular logins. For more information, see: +# https://galaxyproject.org/admin/config/apache-proxy +#use_remote_user = False + +# If use_remote_user is enabled and your external authentication +# method just returns bare usernames, set a default mail domain to be appended +# to usernames, to become your Galaxy usernames (email addresses). +#remote_user_maildomain = None + +# If use_remote_user is enabled, the header that the upstream proxy provides +# the remote username in defaults to HTTP_REMOTE_USER (the 'HTTP_' is prepended +# by WSGI). This option allows you to change the header. Note, you still need +# to prepend 'HTTP_' to the header in this option, but your proxy server should +# *not* include 'HTTP_' at the beginning of the header name. +#remote_user_header = HTTP_REMOTE_USER + +# If use_remote_user is enabled, anyone who can log in to the Galaxy host may +# impersonate any other user by simply sending the appropriate header. Thus a +# secret shared between the upstream proxy server, and Galaxy is required. +# If anyone other than the Galaxy user is using the server, then apache/nginx +# should pass a value in the header 'GX_SECRET' that is identical to the one +# below. +#remote_user_secret = USING THE DEFAULT IS NOT SECURE! + +# If use_remote_user is enabled, you can set this to a URL that will log your +# users out. +#remote_user_logout_href = None + +# If your proxy and/or authentication source does not normalize e-mail +# addresses or user names being passed to Galaxy - set the following option +# to True to force these to lower case. +#normalize_remote_user_email = False + +# If an e-mail address is specified here, it will hijack remote user mechanics +# (``use_remote_user``) and have the webapp inject a single fixed user. This +# has the effect of turning Galaxy into a single user application with no +# login or external proxy required. Such applications should not be exposed to +# the world. +#single_user = + +# Administrative users - set this to a comma-separated list of valid Galaxy +# users (email addresses). These users will have access to the Admin section +# of the server, and will have access to create users, groups, roles, +# libraries, and more. For more information, see: +# https://galaxyproject.org/admin/ +#admin_users = None + +# Force everyone to log in (disable anonymous access). +#require_login = False + +# Show the site's welcome page (see welcome_url) alongside the login page +# (even if require_login is True) +#show_welcome_with_login = False + +# Allow unregistered users to create new accounts (otherwise, they will have to +# be created by an admin). +#allow_user_creation = True + +# Allow administrators to delete accounts. +#allow_user_deletion = False + +# Allow administrators to log in as other users (useful for debugging) +#allow_user_impersonation = False + +# Allow users to remove their datasets from disk immediately (otherwise, +# datasets will be removed after a time period specified by an administrator in +# the cleanup scripts run via cron) +#allow_user_dataset_purge = True + +# By default, users' data will be public, but setting this to True will cause +# it to be private. Does not affect existing users and data, only ones created +# after this option is set. Users may still change their default back to +# public. +#new_user_dataset_access_role_default_private = False + +# Expose user list. Setting this to True will expose the user list to +# authenticated users. This makes sharing datasets in smaller galaxy instances +# much easier as they can type a name/email and have the correct user show up. +# This makes less sense on large public Galaxy instances where that data +# shouldn't be exposed. For semi-public Galaxies, it may make sense to expose +# just the username and not email, or vice versa. +#expose_user_name = False +#expose_user_email = False + +# Whitelist for local network addresses for "Upload from URL" dialog. +# By default, Galaxy will deny access to the local network address space, to +# prevent users making requests to services which the administrator did not +# intend to expose. Previously, you could request any network service that +# Galaxy might have had access to, even if the user could not normally access it. +# It should be a comma separated list of IP addresses or IP address/mask, e.g. +# 10.10.10.10,10.0.1.0/24,fd00::/8 +#fetch_url_whitelist= + +# -- Beta features + +# Enable the new interface for installing tools from Tool Shed +# via the API. Admin menu will list both if enabled. +#enable_beta_ts_api_install = True + +# Enable the new container interface for Interactive Environments +#enable_beta_containers_interface = False + +# Set the following to a number of threads greater than 1 to spawn +# a Python task queue for dealing with large tool submissions (either +# through the tool form or as part of an individual workflow step across +# large collection). This affects workflow scheduling and web processes, +# not job handlers. This is a beta option and should not be used in production. +#tool_submission_burst_threads = 1 + +# If tool_submission_burst_threads is set to a number greater than 1, this +# is the number of jobs to schedule at which the task queue will be created. +#tool_submission_burst_at = 10 + +# Enable beta workflow modules that should not yet be considered part of Galaxy's +# stable API. +#enable_beta_workflow_modules = False + +# Following options only apply to workflows scheduled using the legacy workflow +# run API (running workflows via a POST to /api/workflows). +# Force usage of Galaxy's beta workflow scheduler under certain circumstances - +# this workflow scheduling forces Galaxy to schedule workflows in the background +# so initial submission of the workflows is significantly sped up. This does +# however force the user to refresh their history manually to see newly scheduled +# steps (for "normal" workflows - steps are still scheduled far in advance of +# them being queued and scheduling here doesn't refer to actual cluster job +# scheduling). +# Workflows containing more than the specified number of steps will always use +# the Galaxy's beta workflow scheduling. +#force_beta_workflow_scheduled_min_steps=250 +# Switch to using Galaxy's beta workflow scheduling for all workflows involving +# collections. +#force_beta_workflow_scheduled_for_collections=False + +# If multiple job handlers are enabled, allow Galaxy to schedule workflow invocations +# in multiple handlers simultaneously. This is discouraged because it results in a +# less predictable order of workflow datasets within in histories. +#parallelize_workflow_scheduling_within_histories = False + +# This is the maximum amount of time a workflow invocation may stay in an active +# scheduling state in seconds. Set to -1 to disable this maximum and allow any workflow +# invocation to schedule indefinitely. The default corresponds to 1 month. +#maximum_workflow_invocation_duration = 2678400 + +# Specify a maximum number of jobs that any given workflow scheduling iteration can create. +# Set this to a positive integer to prevent large collection jobs in a workflow from +# preventing other jobs from executing. This may also mitigate memory issues associated with +# scheduling workflows at the expense of increased total DB traffic because model objects +# are expunged from the SQL alchemy session between workflow invocation scheduling iterations. +# Set to -1 to disable any such maximum (the default). +#maximum_workflow_jobs_per_scheduling_iteration = -1 + +# Force serial scheduling of workflows within the context of a particular history +#history_local_serial_workflow_scheduling=False + +# Enable authentication via OpenID. Allows users to log in to their Galaxy +# account by authenticating with an OpenID provider. +#enable_openid = False + +# If OpenID is enabled, this configuration file specifies providers to use. +# Falls back to the .sample variant in config if default does not exist. +#openid_config_file = config/openid_conf.xml + +# If OpenID is enabled, consumer cache directory to use. +#openid_consumer_cache_path = database/openid_consumer_cache + +# XML config file that allows the use of different authentication providers +# (e.g. LDAP) instead or in addition to local authentication (.sample is used +# if default does not exist). +#auth_config_file = config/auth_conf.xml + +# Optional list of email addresses of API users who can make calls on behalf of +# other users. +#api_allow_run_as = None + +# Master key that allows many API admin actions to be used without actually +# having a defined admin user in the database/config. Only set this if you +# need to bootstrap Galaxy, you probably do not want to set this on public +# servers. +#master_api_key = changethis + +# Enable tool tags (associating tools with tags). This has its own option +# since its implementation has a few performance implications on startup for +# large servers. +#enable_tool_tags = False + +# Enable a feature when running workflows. When enabled, default datasets +# are selected for "Set at Runtime" inputs from the history such that the +# same input will not be selected twice, unless there are more inputs than +# compatible datasets in the history. +# When False, the most recently added compatible item in the history will +# be used for each "Set at Runtime" input, independent of others in the Workflow +#enable_unique_workflow_defaults = False + +# The URL to the myExperiment instance being used (omit scheme but include port) +#myexperiment_url = www.myexperiment.org:80 + +# Enable Galaxy's "Upload via FTP" interface. You'll need to install and +# configure an FTP server (we've used ProFTPd since it can use Galaxy's +# database for authentication) and set the following two options. +# This should point to a directory containing subdirectories matching users' +# identifier (defaults to e-mail), where Galaxy will look for files. +#ftp_upload_dir = None + +# This should be the hostname of your FTP server, which will be provided to +# users in the help text. +#ftp_upload_site = None + +# User attribute to use as subdirectory in calculating default ftp_upload_dir +# pattern. By default this will be email so a user's FTP upload directory will be +# ${ftp_upload_dir}/${user.email}. Can set this to other attributes such as id or +# username though. +#ftp_upload_dir_identifier = email + +# Python string template used to determine an FTP upload directory for a +# particular user. +#ftp_upload_dir_template = ${ftp_upload_dir}/${ftp_upload_dir_identifier} + +# This should be set to False to prevent Galaxy from deleting uploaded FTP files +# as it imports them. +#ftp_upload_purge = True + +# Enable enforcement of quotas. Quotas can be set from the Admin interface. +#enable_quotas = False + +# This option allows users to see the full path of datasets via the "View +# Details" option in the history. This option also exposes the command line to +# non-administrative users. Administrators can always see dataset paths. +#expose_dataset_path = False + +# This option allows users to see the job metrics (except for environment +# variables). +#expose_potentially_sensitive_job_metrics = False + +# Enable the API for sample tracking +#enable_legacy_sample_tracking_api = False + +# -- Data manager configuration options + +# Allow non-admin users to view available Data Manager options. +#enable_data_manager_user_view = False + +# File where Data Managers are configured (.sample used if default does not +# exist). +#data_manager_config_file = config/data_manager_conf.xml + +# File where Tool Shed based Data Managers are configured. +#shed_data_manager_config_file = config/shed_data_manager_conf.xml + +# Directory to store Data Manager based tool-data; defaults to tool_data_path. +#galaxy_data_manager_data_path = tool-data + +# -- Job Execution + +# To increase performance of job execution and the web interface, you can +# separate Galaxy into multiple processes. There are more than one way to do +# this, and they are explained in detail in the documentation: +# +# https://galaxyproject.org/admin/config/performance/scaling + +# By default, Galaxy manages and executes jobs from within a single process and +# notifies itself of new jobs via in-memory queues. Jobs are run locally on +# the system on which Galaxy is started. Advanced job running capabilities can +# be configured through the job configuration file. +#job_config_file = config/job_conf.xml + +# When jobs fail due to job runner problems, Galaxy can be configured to retry +# these or reroute the jobs to new destinations. Very fine control of this is +# available with resubmit declarations in job_conf.xml. For simple deployments +# of Galaxy though, the following attribute can define resubmission conditions +# for all job destinations. If any job destination defines even one +# resubmission condition explicitly in job_conf.xml - the condition described +# by this option will not apply to that destination. For instance, the condition: +# 'attempt < 3 and unknown_error and (time_running < 300 or time_since_queued < 300)' +# would retry up to two times jobs that didn't fail due to detected memory or +# walltime limits but did fail quickly (either while queueing or running). The +# commented out default below results in no default job resubmission condition, +# failing jobs are just failed outright. +#default_job_resubmission_condition = + +# In multiprocess configurations, notification between processes about new jobs +# must be done via the database. In single process configurations, this can be +# done in memory, which is a bit quicker. +#track_jobs_in_database = True + +# This enables splitting of jobs into tasks, if specified by the particular tool +# config. +# This is a new feature and not recommended for production servers yet. +#use_tasked_jobs = False +#local_task_queue_workers = 2 + +# Enable job recovery (if Galaxy is restarted while cluster jobs are running, +# it can "recover" them when it starts). This is not safe to use if you are +# running more than one Galaxy server using the same database. +#enable_job_recovery = True + +# Although it is fairly reliable, setting metadata can occasionally fail. In +# these instances, you can choose to retry setting it internally or leave it in +# a failed state (since retrying internally may cause the Galaxy process to be +# unresponsive). If this option is set to False, the user will be given the +# option to retry externally, or set metadata manually (when possible). +#retry_metadata_internally = True + +# Very large metadata values can cause Galaxy crashes. This will allow +# limiting the maximum metadata key size (in bytes used in memory, not the end +# result database value size) Galaxy will attempt to save with a dataset. Use +# 0 to disable this feature. The default is 5MB, but as low as 1MB seems to be +# a reasonable size. +#max_metadata_value_size = 5242880 + +# If (for example) you run on a cluster and your datasets (by default, +# database/files/) are mounted read-only, this option will override tool output +# paths to write outputs to the working directory instead, and the job manager +# will move the outputs to their proper place in the dataset directory on the +# Galaxy server after the job completes. +#outputs_to_working_directory = False + +# If your network filesystem's caching prevents the Galaxy server from seeing +# the job's stdout and stderr files when it completes, you can retry reading +# these files. The job runner will retry the number of times specified below, +# waiting 1 second between tries. For NFS, you may want to try the -noac mount +# option (Linux) or -actimeo=0 (Solaris). +#retry_job_output_collection = 0 + +# In the past Galaxy would preserve its Python environment when running jobs ( +# and still does for internal tools packaged with Galaxy). This behavior exposes +# Galaxy internals to tools and could result in problems when activating +# Python environments for tools (such as with Conda packaging). The default +# legacy_only will restrict this behavior to tools identified by the Galaxy +# team as requiring this environment. Set this to "always" to restore the +# previous behavior (and potentially break Conda dependency resolution for many +# tools). Set this to legacy_and_local to preserve the environment for legacy +# tools and locally managed tools (this might be useful for instance if you are +# installing software into Galaxy's virtualenv for tool development). +#preserve_python_environment = legacy_only + +# Clean up various bits of jobs left on the filesystem after completion. These +# bits include the job working directory, external metadata temporary files, +# and DRM stdout and stderr files (if using a DRM). Possible values are: +# always, onsuccess, never +#cleanup_job = always + +# When running DRMAA jobs as the Galaxy user +# (https://galaxyproject.org/admin/config/performance/cluster/#submitting-jobs-as-the-real-user) +# this script is used to run the job script Galaxy generates for a tool execution. +#drmaa_external_runjob_script = sudo -E scripts/drmaa_external_runner.py --assign_all_groups + +# When running DRMAA jobs as the Galaxy user +# (https://galaxyproject.org/admin/config/performance/cluster/#submitting-jobs-as-the-real-user) +# this script is used to kill such jobs by Galaxy (e.g. if the user cancels +# the job). +#drmaa_external_killjob_script = sudo -E scripts/drmaa_external_killer.py + +# When running DRMAA jobs as the Galaxy user +# (https://galaxyproject.org/admin/config/performance/cluster/#submitting-jobs-as-the-real-user) +# this script is used transfer permissions back and forth between the Galaxy user +# and the user that is running the job. +#external_chown_script = sudo -E scripts/external_chown_script.py + +# When running DRMAA jobs as the Galaxy user +# (https://galaxyproject.org/admin/config/performance/cluster/#submitting-jobs-as-the-real-user) +# Galaxy can extract the user name from the email address (actually the local-part before the @) +# or the username which are both stored in the Galaxy data base. +# The latter option is particularly useful for installations that get the +# authentication from LDAP. +# Also, Galaxy can accept the name of a common system user (eg. galaxy_worker) +# who can run every job being submitted. This user should not be the same user +# running the galaxy system. +# Possible values are user_email (default), username or +#real_system_username = user_email + +# File to source to set up the environment when running jobs. By default, the +# environment in which the Galaxy server starts is used when running jobs +# locally, and the environment set up per the DRM's submission method and +# policy is used when running jobs on a cluster (try testing with `qsub` on the +# command line). environment_setup_file can be set to the path of a file on +# the cluster that should be sourced by the user to set up the environment +# prior to running tools. This can be especially useful for running jobs as +# the actual user, to remove the need to configure each user's environment +# individually. +#environment_setup_file = None + +# Optional file containing job resource data entry fields definition. +# These fields will be presented to users in the tool forms and allow them to +# overwrite default job resources such as number of processors, memory and +# walltime. +#job_resource_params_file = config/job_resource_params_conf.xml + +# If using job concurrency limits (configured in job_config_file), several +# extra database queries must be performed to determine the number of jobs a +# user has dispatched to a given destination. By default, these queries will +# happen for every job that is waiting to run, but if cache_user_job_count is +# set to True, it will only happen once per iteration of the handler queue. +# Although better for performance due to reduced queries, the trade-off is a +# greater possibility that jobs will be dispatched past the configured limits +# if running many handlers. +#cache_user_job_count = False + +# -- ToolBox filtering + +# Define toolbox filters (https://galaxyproject.org/user-defined-toolbox-filters/) +# that admins may use to restrict the tools to display. +#tool_filters = + +# Define toolbox filters (https://galaxyproject.org/user-defined-toolbox-filters/) +# that admins may use to restrict the tool labels to display. +#tool_label_filters = + +# Define toolbox filters (https://galaxyproject.org/user-defined-toolbox-filters/) +# that admins may use to restrict the tool sections to display. +#tool_section_filters = + +# Define toolbox filters (https://galaxyproject.org/user-defined-toolbox-filters/) +# that users may use to restrict the tools to display. +#user_tool_filters = examples:restrict_upload_to_admins, examples:restrict_encode + +# Define toolbox filters (https://galaxyproject.org/user-defined-toolbox-filters/) +# that users may use to restrict the tool sections to display. +#user_tool_section_filters = examples:restrict_text + +# Define toolbox filters (https://galaxyproject.org/user-defined-toolbox-filters/) +# that users may use to restrict the tool labels to display. +#user_tool_label_filters = examples:restrict_upload_to_admins, examples:restrict_encode + +# The base module(s) that are searched for modules for toolbox filtering +# (https://galaxyproject.org/user-defined-toolbox-filters/) producedures. +#toolbox_filter_base_modules = galaxy.tools.toolbox.filters,galaxy.tools.filters + +# -- Galaxy Application Internal Message Queue + +# Galaxy uses AMQP internally for communicating between processes. For +# example, when reloading the toolbox or locking job execution, the process +# that handled that particular request will tell all others to also reload, +# lock jobs, etc. +# For connection examples, see http://docs.celeryproject.org/projects/kombu/en/latest/userguide/connections.html +# +# Without specifying anything here, galaxy will first attempt to use your +# specified database_connection above. If that's not specified either, Galaxy +# will automatically create and use a separate sqlite database located in your +# /database folder (indicated in the commented out line below). + +#amqp_internal_connection = sqlalchemy+sqlite:///./database/control.sqlite?isolation_level=IMMEDIATE + +# Galaxy real time communication server settings +#enable_communication_server = False +#communication_server_host = http://localhost +#communication_server_port = 7070 +# persistent_communication_rooms is a comma-separated list of rooms that should be always available. +#persistent_communication_rooms = + + +# ---- Galaxy External Message Queue ------------------------------------------------- + +# Galaxy uses Advanced Message Queuing Protocol (AMQP) to receive messages from +# external sources like barcode scanners. Galaxy has been tested against +# RabbitMQ AMQP implementation. For Galaxy to receive messages from a message +# queue, the RabbitMQ server has to be set up with a user account and other +# parameters listed below. The 'host' and 'port' fields should point to where +# the RabbitMQ server is running. + +[galaxy_amqp] + +#host = 127.0.0.1 +#port = 5672 +#userid = galaxy +#password = galaxy +#virtual_host = galaxy_messaging_engine +#queue = galaxy_queue +#exchange = galaxy_exchange +#routing_key = bar_code_scanner +#rabbitmqctl_path = /path/to/rabbitmqctl From 3703f05c33b702bf4c27e14619bb6965f1d4e38f Mon Sep 17 00:00:00 2001 From: John Chilton Date: Fri, 1 Dec 2017 10:31:39 -0500 Subject: [PATCH 014/112] convert_yaml - cleanup noise in conversion's copy of galaxy.ini.sample before conversion. --- tmp_config_convert/galaxy.ini.sample | 162 +++------------------------ 1 file changed, 17 insertions(+), 145 deletions(-) diff --git a/tmp_config_convert/galaxy.ini.sample b/tmp_config_convert/galaxy.ini.sample index c7d4f216b6e..5adb4fc5029 100644 --- a/tmp_config_convert/galaxy.ini.sample +++ b/tmp_config_convert/galaxy.ini.sample @@ -1,78 +1,3 @@ -# -# Galaxy is configured by default to be usable in a single-user development -# environment. To tune the application for a multi-user production -# environment, see the documentation at: -# -# http://usegalaxy.org/production -# - -# Throughout this sample configuration file, except where stated otherwise, -# uncommented values override the default if left unset, whereas commented -# values are set to the default value. Relative paths are relative to the root -# Galaxy directory. -# -# Examples of many of these options are explained in more detail in the Galaxy -# Community Hub. -# -# https://galaxyproject.org/admin/config -# -# Config hackers are encouraged to check there before asking for help. - -# ---- HTTP Server ---------------------------------------------------------- - -# Configuration of the internal HTTP server. - -[server:main] - -# The internal HTTP server to use. Currently only Paste is provided. This -# option is required. -use = egg:Paste#http - -# The port on which to listen. -#port = 8080 - -# The address on which to listen. By default, only listen to localhost (Galaxy -# will not be accessible over the network). Use '0.0.0.0' to listen on all -# available network interfaces. -#host = 127.0.0.1 - -# Use a threadpool for the web server instead of creating a thread for each -# request. -use_threadpool = True - -# Number of threads in the web server thread pool. -#threadpool_workers = 10 - -# Set the number of seconds a thread can work before you should kill it -# (assuming it will never finish) to 3 hours. Default is 600 (10 minutes). -threadpool_kill_thread_limit = 10800 - -# ---- Filters -------------------------------------------------------------- - -# Filters sit between Galaxy and the HTTP server. - -# These filters are disabled by default. They can be enabled with -# 'filter-with' in the [app:main] section below. - -# Define the gzip filter. -[filter:gzip] -use = egg:Paste#gzip - -# Define the proxy-prefix filter. -[filter:proxy-prefix] -use = egg:PasteDeploy#prefix -prefix = /galaxy - -# ---- Galaxy --------------------------------------------------------------- - -# Configuration of the Galaxy application. - -[app:main] - -# -- Application and filtering - -# The factory for the WSGI application. This should not be changed. -paste.app_factory = galaxy.web.buildapp:app_factory # If not running behind a proxy server, you may want to enable gzip compression # to decrease the size of data transferred over the network. If using a proxy @@ -90,8 +15,6 @@ paste.app_factory = galaxy.web.buildapp:app_factory # cookie so the cookies from each instance will not clobber each other. #cookie_path = None -# -- Database - # By default, Galaxy uses a SQLite database at 'database/universe.sqlite'. You # may use a SQLAlchemy connection string to specify an external database # instead. This string takes many options which are explained in detail in the @@ -141,8 +64,6 @@ paste.app_factory = galaxy.web.buildapp:app_factory # use. #database_auto_migrate = False -# -- Files and directories - # Dataset files are stored in this directory. #file_path = database/files @@ -180,8 +101,6 @@ paste.app_factory = galaxy.web.buildapp:app_factory # tag. #tool_path = tools -# -- Tool dependencies - # Path to the directory in which tool dependencies are placed. This is used by # the Tool Shed to install dependencies and can also be used by administrators # to manually install or link to dependencies. For details, see: @@ -208,19 +127,25 @@ paste.app_factory = galaxy.web.buildapp:app_factory # IMPORTANT: Due to a current limitation in conda, the total length of the # conda_prefix and the job_working_directory path should be less than 50 characters! #conda_prefix = /_conda + # Override the Conda executable to use, it will default to the one on the # PATH (if available) and then to /bin/conda #conda_exec = + # Pass debug flag to conda commands. #conda_debug = False + # conda channels to enable by default (http://conda.pydata.org/docs/custom-channels.html) #conda_ensure_channels = iuc,bioconda,conda-forge,defaults,r + # Set to True to instruct Galaxy to look for and install missing tool # dependencies before each job runs. #conda_auto_install = False + # Set to True to instruct Galaxy to install Conda from the web automatically # if it cannot find a local copy and conda_exec is not configured. #conda_auto_init = True + # You must set this to True if conda_prefix and job_working_directory are not on the same # volume, or some conda dependencies will fail to execute at job runtime. # Conda will copy packages content instead of creating hardlinks or symlinks. @@ -405,8 +330,10 @@ paste.app_factory = galaxy.web.buildapp:app_factory # Set to false to disable various checks Galaxy will do to ensure it # can run job scripts before attempting to execute or submit them. #check_job_script_integrity = True + # Number of checks to execute if check_job_script_integrity is enabled. #check_job_script_integrity_count = 35 + # Time to sleep between checks if check_job_script_integrity is enabled (in seconds). #check_job_script_integrity_sleep = .25 @@ -433,15 +360,10 @@ paste.app_factory = galaxy.web.buildapp:app_factory # breaking existing tools. #collect_outputs_from = new_file_path,job_working_directory -# -- Data Storage (Object Store) -# # Configuration file for the object store # If this is set and exists, it overrides any other objectstore settings. #object_store_config_file = config/object_store_conf.xml - -# -- Mail and notification - # Galaxy sends mail for various things: subscribing users to the mailing list # if they request it, password resets, reporting dataset errors, and sending # activation emails. To do this, it needs to send mail through an SMTP server, @@ -490,9 +412,6 @@ paste.app_factory = galaxy.web.buildapp:app_factory # If no message specified the warning box will not be shown. #registration_warning_message = Please register only one account - we provide this service free of charge and have limited computational resources. Multi-accounts are tracked and will be subjected to account termination and data deletion. - -# -- Account activation - # User account activation feature global flag. If set to "False", the rest of # the Account activation configuration is ignored and user activation is # disabled (i.e. accounts are active since registration). @@ -521,18 +440,14 @@ paste.app_factory = galaxy.web.buildapp:app_factory #session_duration = 0 -# -- Analytics - # You can enter tracking code here to track visitor's behavior # through your Google Analytics account. Example: UA-XXXXXXXX-Y #ga_code = None -# -- Display sites - # Galaxy can display data at various external browsers. These options specify # which browsers should be available. URLs and builds available at these # browsers are defined in the specifield files. - +# # If use_remote_user = True, display application servers will be denied access # to Galaxy and so displaying datasets in these sites will fail. # display_servers contains a list of hostnames which should be allowed to @@ -558,13 +473,11 @@ paste.app_factory = galaxy.web.buildapp:app_factory # Galaxy user to access said site. #enable_old_display_applications = True -# -- Next gen LIMS interface on top of existing Galaxy Sample/Request +# Next gen LIMS interface on top of existing Galaxy Sample/Request # management code. - -use_nglims = False -nglims_config_file = tool-data/nglims.yaml - -# -- UI Localization +# +# use_nglims = False +# nglims_config_file = tool-data/nglims.yaml # Show a message box under the masthead. #message_box_visible = False @@ -654,14 +567,11 @@ nglims_config_file = tool-data/nglims.yaml #static_robots_txt = static/robots.txt # Incremental Display Options - #display_chunk_size = 65536 -# -- Advanced proxy features - # For help on configuring the Advanced proxy features, see: # http://usegalaxy.org/production - +# # Apache can handle file downloads (Galaxy-to-user) via mod_xsendfile. Set # this to True to inform Galaxy that mod_xsendfile is enabled upstream. #apache_xsendfile = False @@ -766,8 +676,6 @@ nglims_config_file = tool-data/nglims.yaml # manually. #dynamic_proxy_golang_api_key = None -# -- Logging and Debugging - # If True, Galaxy will attempt to configure a simple root logger if a # "loggers" section does not appear in this configuration file. #auto_configure_logging = True @@ -847,7 +755,7 @@ nglims_config_file = tool-data/nglims.yaml # Enable live debugging in your browser. This should NEVER be enabled on a # public site. Enabled in the sample config for development. -use_interactive = True +#use_interactive = True # When stopping Galaxy cleanly, how much time to give various monitoring/polling # threads to finish before giving up on joining them. Set to 0 to disable this and @@ -942,8 +850,6 @@ use_interactive = True # communicate with this manager over the port specified here. #transfer_manager_port = 8163 -# -- Toolbox Search - # Boosts are used to customize this instance's toolbox search. # The higher the boost, the more importance the scoring algorithm gives to the # given field. Section refers to the tool group in the tool panel. Rest of @@ -971,8 +877,6 @@ use_interactive = True # Set maximum size of ngrams #tool_ngram_maxsize = 4 -# -- Users and Security - # Galaxy encodes various internal values when these values will be output in # some format (for example, in a URL or cookie). You should set a key to be # used by the algorithm that encodes and decodes these values. It can be any @@ -1076,8 +980,6 @@ use_interactive = True # 10.10.10.10,10.0.1.0/24,fd00::/8 #fetch_url_whitelist= -# -- Beta features - # Enable the new interface for installing tools from Tool Shed # via the API. Admin menu will list both if enabled. #enable_beta_ts_api_install = True @@ -1219,8 +1121,6 @@ use_interactive = True # Enable the API for sample tracking #enable_legacy_sample_tracking_api = False -# -- Data manager configuration options - # Allow non-admin users to view available Data Manager options. #enable_data_manager_user_view = False @@ -1234,14 +1134,12 @@ use_interactive = True # Directory to store Data Manager based tool-data; defaults to tool_data_path. #galaxy_data_manager_data_path = tool-data -# -- Job Execution - # To increase performance of job execution and the web interface, you can # separate Galaxy into multiple processes. There are more than one way to do # this, and they are explained in detail in the documentation: # # https://galaxyproject.org/admin/config/performance/scaling - +# # By default, Galaxy manages and executes jobs from within a single process and # notifies itself of new jobs via in-memory queues. Jobs are run locally on # the system on which Galaxy is started. Advanced job running capabilities can @@ -1380,8 +1278,6 @@ use_interactive = True # if running many handlers. #cache_user_job_count = False -# -- ToolBox filtering - # Define toolbox filters (https://galaxyproject.org/user-defined-toolbox-filters/) # that admins may use to restrict the tools to display. #tool_filters = @@ -1410,8 +1306,6 @@ use_interactive = True # (https://galaxyproject.org/user-defined-toolbox-filters/) producedures. #toolbox_filter_base_modules = galaxy.tools.toolbox.filters,galaxy.tools.filters -# -- Galaxy Application Internal Message Queue - # Galaxy uses AMQP internally for communicating between processes. For # example, when reloading the toolbox or locking job execution, the process # that handled that particular request will tell all others to also reload, @@ -1422,34 +1316,12 @@ use_interactive = True # specified database_connection above. If that's not specified either, Galaxy # will automatically create and use a separate sqlite database located in your # /database folder (indicated in the commented out line below). - #amqp_internal_connection = sqlalchemy+sqlite:///./database/control.sqlite?isolation_level=IMMEDIATE # Galaxy real time communication server settings #enable_communication_server = False #communication_server_host = http://localhost #communication_server_port = 7070 + # persistent_communication_rooms is a comma-separated list of rooms that should be always available. #persistent_communication_rooms = - - -# ---- Galaxy External Message Queue ------------------------------------------------- - -# Galaxy uses Advanced Message Queuing Protocol (AMQP) to receive messages from -# external sources like barcode scanners. Galaxy has been tested against -# RabbitMQ AMQP implementation. For Galaxy to receive messages from a message -# queue, the RabbitMQ server has to be set up with a user account and other -# parameters listed below. The 'host' and 'port' fields should point to where -# the RabbitMQ server is running. - -[galaxy_amqp] - -#host = 127.0.0.1 -#port = 5672 -#userid = galaxy -#password = galaxy -#virtual_host = galaxy_messaging_engine -#queue = galaxy_queue -#exchange = galaxy_exchange -#routing_key = bar_code_scanner -#rabbitmqctl_path = /path/to/rabbitmqctl From f058370a98fa84f3b7bdf5286c4e16cd3b811947 Mon Sep 17 00:00:00 2001 From: John Chilton Date: Fri, 1 Dec 2017 14:29:26 -0500 Subject: [PATCH 015/112] convert_yaml - run conversion to YAML. --- config/galaxy.ini.sample | 3979 ++++++++++++++++++++++++-------------- 1 file changed, 2525 insertions(+), 1454 deletions(-) diff --git a/config/galaxy.ini.sample b/config/galaxy.ini.sample index c7d4f216b6e..f256aab7065 100644 --- a/config/galaxy.ini.sample +++ b/config/galaxy.ini.sample @@ -1,1455 +1,2526 @@ -# -# Galaxy is configured by default to be usable in a single-user development -# environment. To tune the application for a multi-user production -# environment, see the documentation at: -# -# http://usegalaxy.org/production -# -# Throughout this sample configuration file, except where stated otherwise, -# uncommented values override the default if left unset, whereas commented -# values are set to the default value. Relative paths are relative to the root -# Galaxy directory. -# -# Examples of many of these options are explained in more detail in the Galaxy -# Community Hub. -# -# https://galaxyproject.org/admin/config -# -# Config hackers are encouraged to check there before asking for help. - -# ---- HTTP Server ---------------------------------------------------------- - -# Configuration of the internal HTTP server. - -[server:main] - -# The internal HTTP server to use. Currently only Paste is provided. This -# option is required. -use = egg:Paste#http - -# The port on which to listen. -#port = 8080 - -# The address on which to listen. By default, only listen to localhost (Galaxy -# will not be accessible over the network). Use '0.0.0.0' to listen on all -# available network interfaces. -#host = 127.0.0.1 - -# Use a threadpool for the web server instead of creating a thread for each -# request. -use_threadpool = True - -# Number of threads in the web server thread pool. -#threadpool_workers = 10 - -# Set the number of seconds a thread can work before you should kill it -# (assuming it will never finish) to 3 hours. Default is 600 (10 minutes). -threadpool_kill_thread_limit = 10800 - -# ---- Filters -------------------------------------------------------------- - -# Filters sit between Galaxy and the HTTP server. - -# These filters are disabled by default. They can be enabled with -# 'filter-with' in the [app:main] section below. - -# Define the gzip filter. -[filter:gzip] -use = egg:Paste#gzip - -# Define the proxy-prefix filter. -[filter:proxy-prefix] -use = egg:PasteDeploy#prefix -prefix = /galaxy - -# ---- Galaxy --------------------------------------------------------------- - -# Configuration of the Galaxy application. - -[app:main] - -# -- Application and filtering - -# The factory for the WSGI application. This should not be changed. -paste.app_factory = galaxy.web.buildapp:app_factory - -# If not running behind a proxy server, you may want to enable gzip compression -# to decrease the size of data transferred over the network. If using a proxy -# server, please enable gzip compression there instead. -#filter-with = gzip - -# If running behind a proxy server and Galaxy is served from a subdirectory, -# enable the proxy-prefix filter and set the prefix in the -# [filter:proxy-prefix] section above. -#filter-with = proxy-prefix - -# If proxy-prefix is enabled and you're running more than one Galaxy instance -# behind one hostname, you will want to set this to the same path as the prefix -# in the filter above. This value becomes the "path" attribute set in the -# cookie so the cookies from each instance will not clobber each other. -#cookie_path = None - -# -- Database - -# By default, Galaxy uses a SQLite database at 'database/universe.sqlite'. You -# may use a SQLAlchemy connection string to specify an external database -# instead. This string takes many options which are explained in detail in the -# config file documentation. -#database_connection = sqlite:///./database/universe.sqlite?isolation_level=IMMEDIATE - -# If the server logs errors about not having enough database pool connections, -# you will want to increase these values, or consider running more Galaxy -# processes. -#database_engine_option_pool_size = 5 -#database_engine_option_max_overflow = 10 - -# If using MySQL and the server logs the error "MySQL server has gone away", -# you will want to set this to some positive value (7200 should work). -#database_engine_option_pool_recycle = -1 - -# If large database query results are causing memory or response time issues in -# the Galaxy process, leave the result on the server instead. This option is -# only available for PostgreSQL and is highly recommended. -#database_engine_option_server_side_cursors = False - -# Log all database transactions, can be useful for debugging and performance -# profiling. Logging is done via Python's 'logging' module under the qualname -# 'galaxy.model.orm.logging_connection_proxy' -#database_query_profiling_proxy = False - -# If auto-creating a postgres database on startup - it can be based on an existing -# template database. This will set that. This is probably only useful for testing but -# documentation is included here for completeness. -#database_template = None - -# Slow query logging. Queries slower than the threshold indicated below will -# be logged to debug. A value of '0' is disabled. For example, you would set -# this to .005 to log all queries taking longer than 5 milliseconds. -#slow_query_log_threshold = 0 - -# By default, Galaxy will use the same database to track user data and -# tool shed install data. There are many situations in which it is -# valuable to separate these - for instance bootstrapping fresh Galaxy -# instances with pretested installs. The following option can be used to -# separate the tool shed install database (all other options listed above -# but prefixed with install_ are also available). -#install_database_connection = sqlite:///./database/universe.sqlite?isolation_level=IMMEDIATE - -# Setting the following option to true will cause Galaxy to automatically -# migrate the database forward after updates. This is not recommended for production -# use. -#database_auto_migrate = False - -# -- Files and directories - -# Dataset files are stored in this directory. -#file_path = database/files - -# Temporary files are stored in this directory. -#new_file_path = database/tmp - -# Tool config files, defines what tools are available in Galaxy. -# Tools can be locally developed or installed from Galaxy tool sheds. -# (config/tool_conf.xml.sample will be used if left unset and -# config/tool_conf.xml does not exist). -#tool_config_file = config/tool_conf.xml,config/shed_tool_conf.xml - -# Enable / disable checking if any tools defined in the above non-shed -# tool_config_files (i.e., tool_conf.xml) have been migrated from the Galaxy -# code distribution to the Tool Shed. This setting should generally be set to -# False only for development Galaxy environments that are often rebuilt from -# scratch where migrated tools do not need to be available in the Galaxy tool -# panel. If the following setting remains commented, the default setting will -# be True. -#check_migrate_tools = True - -# Tool config maintained by tool migration scripts. If you use the migration -# scripts to install tools that have been migrated to the tool shed upon a new -# release, they will be added to this tool config file. -#migrated_tools_config = config/migrated_tools_conf.xml - -# File that contains the XML section and tool tags from all tool panel config -# files integrated into a single file that defines the tool panel layout. This -# file can be changed by the Galaxy administrator to alter the layout of the -# tool panel. If not present, Galaxy will create it. -#integrated_tool_panel_config = integrated_tool_panel.xml - -# Default path to the directory containing the tools defined in tool_conf.xml. -# Other tool config files must include the tool_path as an attribute in the -# tag. -#tool_path = tools - -# -- Tool dependencies - -# Path to the directory in which tool dependencies are placed. This is used by -# the Tool Shed to install dependencies and can also be used by administrators -# to manually install or link to dependencies. For details, see: -# https://galaxyproject.org/admin/config/tool-dependencies -# Set the string to None to explicitly disable tool dependency handling. -# If this option is set to none or an invalid path, installing tools with dependencies -# from the Tool Shed will fail. -#tool_dependency_dir = database/dependencies - -# The dependency resolvers config file specifies an ordering and options for how -# Galaxy resolves tool dependencies (requirement tags in Tool XML). The default -# ordering is to the use the Tool Shed for tools installed that way, use local -# Galaxy packages, and then use Conda if available. -# See https://github.com/galaxyproject/galaxy/blob/dev/doc/source/admin/dependency_resolvers.rst -# for more information on these options. -#dependency_resolvers_config_file = config/dependency_resolvers_conf.xml - -# The following Conda dependency resolution options will change the defaults for -# all Conda resolvers, but multiple resolvers can be configured independently -# in dependency_resolvers_config_file and these options overridden. -# Location on the filesystem where Conda packages are installed - -# conda_prefix is the location on the filesystem where Conda packages and environments are installed -# IMPORTANT: Due to a current limitation in conda, the total length of the -# conda_prefix and the job_working_directory path should be less than 50 characters! -#conda_prefix = /_conda -# Override the Conda executable to use, it will default to the one on the -# PATH (if available) and then to /bin/conda -#conda_exec = -# Pass debug flag to conda commands. -#conda_debug = False -# conda channels to enable by default (http://conda.pydata.org/docs/custom-channels.html) -#conda_ensure_channels = iuc,bioconda,conda-forge,defaults,r -# Set to True to instruct Galaxy to look for and install missing tool -# dependencies before each job runs. -#conda_auto_install = False -# Set to True to instruct Galaxy to install Conda from the web automatically -# if it cannot find a local copy and conda_exec is not configured. -#conda_auto_init = True -# You must set this to True if conda_prefix and job_working_directory are not on the same -# volume, or some conda dependencies will fail to execute at job runtime. -# Conda will copy packages content instead of creating hardlinks or symlinks. -# This will prevent problems with some specific packages (perl, R), at the cost -# of extra disk space usage and extra time spent copying packages. -#conda_copy_dependencies = False - -# Certain dependency resolvers (namely Conda) take a considerable amount of -# time to build an isolated job environment in the job_working_directory if the -# job working directory is on a network share. Set the following option to True -# to cache the dependencies in a folder. This option is beta and should only be -# used if you experience long waiting times before a job is actually submitted -# to your cluster. -#use_cached_dependency_manager = False - -# By default the tool_dependency_cache_dir is the _cache directory -# of the tool dependency directory -#tool_dependency_cache_dir = /_cache - -# By default, when using a cached dependency manager, the dependencies are cached -# when installing new tools and when using tools for the first time. -# Set this to False if you prefer dependencies to be cached only when installing new tools. -#precache_dependencies = True - -# File containing the Galaxy Tool Sheds that should be made available to -# install from in the admin interface (.sample used if default does not exist). -#tool_sheds_config_file = config/tool_sheds_conf.xml - -# Set to True to enable monitoring of tools and tool directories -# listed in any tool config file specified in tool_config_file option. -# If changes are found, tools are automatically reloaded. Watchdog ( -# https://pypi.python.org/pypi/watchdog ) must be installed and -# available to Galaxy to use this option. Other options include 'auto' -# which will attempt to watch tools if the watchdog library is available -# but won't fail to load Galaxy if it is not and 'polling' which will use -# a less efficient monitoring scheme that may work in wider range of scenarios -# than the watchdog default. -#watch_tools = False - -# Enable Galaxy to fetch Docker containers registered with quay.io generated -# from tool requirements resolved through conda. These containers (when -# available) have been generated using mulled - https://github.com/mulled. -# These containers are highly beta and availability will vary by tool. -# This option will additionally only be used for job destinations with -# Docker enabled. -#enable_beta_mulled_containers = False - -# Container resolvers configuration (beta). Setup a file describing container -# resolvers to use when discovering containers for Galaxy. If this is set to -# None, the default containers loaded is determined by -# enable_beta_mulled_containers. -#containers_resolvers_config_file = None - -# involucro is a tool used to build Docker containers for tools from Conda -# dependencies referenced in tools as `requirement`s. The following path is -# the location of involucro on the Galaxy host. This is ignored if the relevant -# container resolver isn't enabled, and will install on demand unless -# involucro_auto_init is set to False. -#involucro_path = database/dependencies/involucro - -# Install involucro as needed to build Docker containers for tools. Ignored if -# relevant container resolver is not used. -#involucro_auto_init = True - -# Enable automatic polling of relative tool sheds to see if any updates -# are available for installed repositories. Ideally only one Galaxy -# server process should be able to check for repository updates. The -# setting for hours_between_check should be an integer between 1 and 24. -#enable_tool_shed_check = False -#hours_between_check = 12 - -# Enable use of an in-memory registry with bi-directional relationships between -# repositories (i.e., in addition to lists of dependencies for a repository, -# keep an in-memory registry of dependent items for each repository. -#manage_dependency_relationships = False - -# XML config file that contains data table entries for the -# ToolDataTableManager. This file is manually # maintained by the Galaxy -# administrator (.sample used if default does not exist). -#tool_data_table_config_path = config/tool_data_table_conf.xml - -# XML config file that contains additional data table entries for the -# ToolDataTableManager. This file is automatically generated based on the -# current installed tool shed repositories that contain valid -# tool_data_table_conf.xml.sample files. At the time of installation, these -# entries are automatically added to the following file, which is parsed and -# applied to the ToolDataTableManager at server start up. -#shed_tool_data_table_config = config/shed_tool_data_table_conf.xml - -# Directory where data used by tools is located. See the samples in that -# directory and the Galaxy Community Hub for help: -# https://galaxyproject.org/admin/data-integration -#tool_data_path = tool-data - -# Directory where Tool Data Table related files will be placed -# when installed from a ToolShed. Defaults to tool_data_path. -#shed_tool_data_path = tool-data - -# Set to True to enable monitoring of the tool_data and shed_tool_data_path -# directories. If changes in tool data table files are found, the tool data -# tables for that data manager are automatically reloaded. -# Watchdog ( https://pypi.python.org/pypi/watchdog ) must be installed and -# available to Galaxy to use this option. Other options include 'auto' -# which will attempt to use the watchdog library if it is available but won't -# fail to load Galaxy if it is not and 'polling' which will use a less -# efficient monitoring scheme that may work in wider range of scenarios -# than the watchdog default. -#watch_tool_data_dir = False - -# File containing old-style genome builds -#builds_file_path = tool-data/shared/ucsc/builds.txt - -# Directory where chrom len files are kept, currently mainly used by trackster -#len_file_path = tool-data/shared/ucsc/chrom - -# Datatypes config file(s), defines what data (file) types are available in -# Galaxy (.sample is used if default does not exist). If a datatype appears in -# multiple files, the last definition is used (though the first sniffer is used -# so limit sniffer definitions to one file). -#datatypes_config_file = config/datatypes_conf.xml - -# Disable the 'Auto-detect' option for file uploads -#datatypes_disable_auto = False - -# Visualizations config directory: where to look for individual visualization -# plugins. The path is relative to the Galaxy root dir. To use an absolute -# path begin the path with '/'. This is a comma separated list. -# Defaults to "config/plugins/visualizations". -#visualization_plugins_directory = config/plugins/visualizations - -# Interactive environment plugins root directory: where to look for interactive -# environment plugins. By default none will be loaded. Set to -# config/plugins/interactive_environments to load Galaxy's stock plugins. -# These will require Docker to be configured and have security considerations, -# so proceed with caution. The path is relative to the Galaxy root dir. To use -# an absolute path begin the path with '/'. This is a comma -# separated list. -#interactive_environment_plugins_directory = - -# To run interactive environment containers in Docker Swarm mode (on an -# existing swarm), set this option to True and set `docker_connect_port` in the -# IE plugin config (ini) file(s) of any IE plugins you have enabled and ensure -# that you are not using any `docker run`-specific options in your plugins' -# `command_inject` options (swarm mode services run using `docker service -# create`, which has a different and more limited set of options). This option -# can be overridden on a per-plugin basis by using the `swarm_mode` option in -# the plugin's ini config file. -#interactive_environment_swarm_mode = False - -# Galaxy can run a "swarm manager" service that will monitor utilization of the -# swarm and provision/deprovision worker nodes as necessary. The service has -# its own configuration file. -#swarm_manager_config_file = config/swarm_manager_conf.yml - -# Interactive tour directory: where to store interactive tour definition files. -# Galaxy ships with several basic interface tours enabled, though a different -# directory with custom tours can be specified here. The path is relative to the -# Galaxy root dir. To use an absolute path begin the path with '/'. This is a comma -# separated list. -#tour_config_dir = config/plugins/tours - -# Webhooks directory: where to store webhooks - plugins to extend the Galaxy UI. -# By default none will be loaded. Set to config/plugins/webhooks/demo to load Galaxy's -# demo webhooks. To use an absolute path begin the path with '/'. This is a comma -# separated list. Add test/functional/webhooks to this list to include the demo webhooks -# used to test the webhook framework. -#webhooks_dir = config/plugins/webhooks - -# Each job is given a unique empty directory as its current working directory. -# This option defines in what parent directory those directories will be -# created. -#job_working_directory = database/jobs_directory - -# If using a cluster, Galaxy will write job scripts and stdout/stderr to this -# directory. -#cluster_files_directory = database/pbs - -# Mako templates are compiled as needed and cached for reuse, this directory is -# used for the cache -#template_cache_path = database/compiled_templates - -# Set to false to disable various checks Galaxy will do to ensure it -# can run job scripts before attempting to execute or submit them. -#check_job_script_integrity = True -# Number of checks to execute if check_job_script_integrity is enabled. -#check_job_script_integrity_count = 35 -# Time to sleep between checks if check_job_script_integrity is enabled (in seconds). -#check_job_script_integrity_sleep = .25 - -# Set the default shell used by non-containerized jobs Galaxy-wide. This -# defaults to bash for all jobs and can be overridden at the destination -# level for heterogeneous clusters. conda job resolution requires bash or zsh -# so if this is switched to /bin/sh for instance - conda resolution -# should be disabled. Containerized jobs always use /bin/sh - so more maximum -# portability tool authors should assume generated commands run in sh. -#default_job_shell = /bin/bash - -# Citation related caching. Tool citations information maybe fetched from -# external sources such as http://dx.doi.org/ by Galaxy - the following -# parameters can be used to control the caching used to store this information. -#citation_cache_type = file -#citation_cache_data_dir = database/citations/data -#citation_cache_lock_dir = database/citations/lock - -# Tools with a number of outputs not known until runtime can write these -# outputs to a directory for collection by Galaxy when the job is done. -# Previously, this directory was new_file_path, but using one global directory -# can cause performance problems, so using job_working_directory ('.' or cwd -# when a job is run) is encouraged. By default, both are checked to avoid -# breaking existing tools. -#collect_outputs_from = new_file_path,job_working_directory - -# -- Data Storage (Object Store) -# -# Configuration file for the object store -# If this is set and exists, it overrides any other objectstore settings. -#object_store_config_file = config/object_store_conf.xml - - -# -- Mail and notification - -# Galaxy sends mail for various things: subscribing users to the mailing list -# if they request it, password resets, reporting dataset errors, and sending -# activation emails. To do this, it needs to send mail through an SMTP server, -# which you may define here (host:port). -# Galaxy will automatically try STARTTLS but will continue upon failure. -#smtp_server = None - -# If your SMTP server requires a username and password, you can provide them -# here (password in cleartext here, but if your server supports STARTTLS it -# will be sent over the network encrypted). -#smtp_username = None -#smtp_password = None - -# If your SMTP server requires SSL from the beginning of the connection -#smtp_ssl = False - -# On the user registration form, users may choose to join a mailing list. This -# is the address used to subscribe to the list. Uncomment and leave empty if you -# want to remove this option from the user registration form. -#mailing_join_addr = galaxy-announce-join@bx.psu.edu - -# Datasets in an error state include a link to report the error. Those reports -# will be sent to this address. Error reports are disabled if no address is -# set. Also this email is shown as a contact to user in case of Galaxy -# misconfiguration and other events user may encounter. -#error_email_to = None - -# Email address to use in the 'From' field when sending emails for -# account activations, workflow step notifications and password resets. -# We recommend using string in the following format: -# Galaxy Project -# If not configured, '' will be used. -#email_from = None - -# URL of the support resource for the galaxy instance. Used in activation -# emails. -#instance_resource_url = https://galaxyproject.org/ - -# E-mail domains blacklist is used for filtering out users that are using -# disposable email address during the registration. If their address domain -# matches any domain in the blacklist, they are refused the registration. -#blacklist_file = config/disposable_email_blacklist.conf - -# Registration warning message is used to discourage people from registering -# multiple accounts. Applies mostly for the main Galaxy instance. -# If no message specified the warning box will not be shown. -#registration_warning_message = Please register only one account - we provide this service free of charge and have limited computational resources. Multi-accounts are tracked and will be subjected to account termination and data deletion. - - -# -- Account activation - -# User account activation feature global flag. If set to "False", the rest of -# the Account activation configuration is ignored and user activation is -# disabled (i.e. accounts are active since registration). -# The activation is also not working in case the SMTP server is not defined. -#user_activation_on = False - -# Activation grace period (in hours). Activation is not forced (login is not -# disabled) until grace period has passed. Users under grace period can't run -# jobs. Enter 0 to disable grace period. -# Users with OpenID logins have grace period forever. -#activation_grace_period = 3 - -# Shown in warning box to users that were not activated yet. -# In use only if activation_grace_period is set. -#inactivity_box_content = Your account has not been activated yet. Feel free to browse around and see what's available, but you won't be able to upload data or run jobs until you have verified your email address. - -# Password expiration period (in days). Users are required to change their -# password every x days. Users will be redirected to the change password -# screen when they log in after their password expires. Enter 0 to disable -# password expiration. -#password_expiration_period = 0 - -# Galaxy Session Timeout -# This provides a timeout (in minutes) after which a user will have to log back in. -# A duration of 0 disables this feature. -#session_duration = 0 - - -# -- Analytics - -# You can enter tracking code here to track visitor's behavior -# through your Google Analytics account. Example: UA-XXXXXXXX-Y -#ga_code = None - -# -- Display sites - -# Galaxy can display data at various external browsers. These options specify -# which browsers should be available. URLs and builds available at these -# browsers are defined in the specifield files. - -# If use_remote_user = True, display application servers will be denied access -# to Galaxy and so displaying datasets in these sites will fail. -# display_servers contains a list of hostnames which should be allowed to -# bypass security to display datasets. Please be aware that there are security -# implications if this is allowed. More details (including required changes to -# the proxy server config) are available in the Apache proxy documentation on -# the Galaxy Community Hub. -# -# The list of servers in this sample config are for the UCSC Main, Test and -# Archaea browsers, but the default if left commented is to not allow any -# display sites to bypass security (you must uncomment the line below to allow -# them). -#display_servers = hgw1.cse.ucsc.edu,hgw2.cse.ucsc.edu,hgw3.cse.ucsc.edu,hgw4.cse.ucsc.edu,hgw5.cse.ucsc.edu,hgw6.cse.ucsc.edu,hgw7.cse.ucsc.edu,hgw8.cse.ucsc.edu,lowepub.cse.ucsc.edu - -# To disable the old-style display applications that are hardcoded into -# datatype classes, set enable_old_display_applications = False. -# This may be desirable due to using the new-style, XML-defined, display -# applications that have been defined for many of the datatypes that have the -# old-style. -# There is also a potential security concern with the old-style applications, -# where a malicious party could provide a link that appears to reference the -# Galaxy server, but contains a redirect to a third-party server, tricking a -# Galaxy user to access said site. -#enable_old_display_applications = True - -# -- Next gen LIMS interface on top of existing Galaxy Sample/Request -# management code. - -use_nglims = False -nglims_config_file = tool-data/nglims.yaml - -# -- UI Localization - -# Show a message box under the masthead. -#message_box_visible = False -#message_box_content = None -#message_box_class = info - -# Append "/{brand}" to the "Galaxy" text in the masthead. -#brand = None - -# Format string used when showing date and time information. -# The string may contain: -# - the directives used by Python time.strftime() function (see -# https://docs.python.org/2/library/time.html#time.strftime ), -# - $locale (complete format string for the server locale), -# - $iso8601 (complete format string as specified by ISO 8601 international -# standard). -#pretty_datetime_format = $locale (UTC) - -# URL (with schema http/https) of the Galaxy instance as accessible within your -# local network - if specified used as a default by pulsar file staging and -# Jupyter Docker container for communicating back with Galaxy via the API. -# -# If you are attempting to setup GIEs on Mac OS X with Docker for Mac - this -# should likely be the IP address of your machine on the virtualbox network (vboxnet0) -# setup for the Docker host VM. This can found by running ifconfig and using the -# IP address of the network vboxnet0. -#galaxy_infrastructure_url = http://localhost:8080 - -# If the above URL cannot be determined ahead of time in dynamic environments -# but the port which should be used to access Galaxy can be - this should be -# set to prevent Galaxy from having to guess. For example if Galaxy is sitting -# behind a proxy with REMOTE_USER enabled - infrastructure shouldn't talk to -# Python processes directly and this should be set to 80 or 443, etc... If -# unset this file will be read for a server block defining a port corresponding -# to the webapp. -#galaxy_infrastructure_web_port = 8080 - -# The URL of the page to display in Galaxy's middle pane when loaded. This can -# be an absolute or relative URL. -#welcome_url = /static/welcome.html - -# The URL linked by the "Galaxy/brand" text. -#logo_url = / - -# The URL linked by the "Wiki" link in the "Help" menu. -#wiki_url = https://galaxyproject.org/ - -# The URL linked by the "Support" link in the "Help" menu. -#support_url = https://galaxyproject.org/support - -# The URL linked by the "How to Cite Galaxy" link in the "Help" menu. -#citation_url = https://galaxyproject.org/citing-galaxy - -# The URL linked by the "Search" link in the "Help" menu. -#search_url = https://galaxyproject.org/search/ - -# The URL linked by the "Mailing Lists" link in the "Help" menu. -#mailing_lists_url = https://galaxyproject.org/mailing-lists - -# The URL linked by the "Videos" link in the "Help" menu. -#screencasts_url = https://vimeo.com/galaxyproject - -# Points to the GenomeSpace UI service which will be used by -# the GenomeSpace importer and exporter tools -#genomespace_ui_url = https://gsui.genomespace.org/jsui/ - -# The URL linked by the "Terms and Conditions" link in the "Help" menu, as well -# as on the user registration and login forms and in the activation emails. -#terms_url = None - -# The URL linked by the "Galaxy Q&A" link in the "Help" menu -# The Galaxy Q&A site is under development; when the site is done, this URL -# will be set and uncommented. -#qa_url = - -# Serve static content, which must be enabled if you're not serving it via a -# proxy server. These options should be self explanatory and so are not -# documented individually. You can use these paths (or ones in the proxy -# server) to point to your own styles. -#static_enabled = True -#static_cache_time = 360 -#static_dir = static/ -#static_images_dir = static/images -#static_favicon_dir = static/favicon.ico -#static_scripts_dir = static/scripts/ -#static_style_dir = static/june_2007_style/blue -#static_robots_txt = static/robots.txt - -# Incremental Display Options - -#display_chunk_size = 65536 - -# -- Advanced proxy features - -# For help on configuring the Advanced proxy features, see: -# http://usegalaxy.org/production - -# Apache can handle file downloads (Galaxy-to-user) via mod_xsendfile. Set -# this to True to inform Galaxy that mod_xsendfile is enabled upstream. -#apache_xsendfile = False - -# The same download handling can be done by nginx using X-Accel-Redirect. This -# should be set to the path defined in the nginx config as an internal redirect -# with access to Galaxy's data files (see documentation linked above). -#nginx_x_accel_redirect_base = False - -# nginx can make use of mod_zip to create zip files containing multiple library -# files. If using X-Accel-Redirect, this can be the same value as that option. -#nginx_x_archive_files_base = False - -# If using compression in the upstream proxy server, use this option to disable -# gzipping of library .tar.gz and .zip archives, since the proxy server will do -# it faster on the fly. -#upstream_gzip = False - -# The following default adds a header to web request responses that -# will cause modern web browsers to not allow Galaxy to be embedded in -# the frames of web applications hosted at other hosts - this can help -# prevent a class of attack called clickjacking -# (https://www.owasp.org/index.php/Clickjacking). If you configure a -# proxy in front of Galaxy - please ensure this header remains intact -# to protect your users. Uncomment and leave empty to not set the -# `X-Frame-Options` header. -#x_frame_options = SAMEORIGIN - -# nginx can also handle file uploads (user-to-Galaxy) via nginx_upload_module. -# Configuration for this is complex and explained in detail in the -# documentation linked above. The upload store is a temporary directory in -# which files uploaded by the upload module will be placed. -#nginx_upload_store = False - -# This value overrides the action set on the file upload form, e.g. the web -# path where the nginx_upload_module has been configured to intercept upload -# requests. -#nginx_upload_path = False - -# Galaxy can also use nginx_upload_module to receive files staged out upon job -# completion by remote job runners (i.e. Pulsar) that initiate staging -# operations on the remote end. See the Galaxy nginx documentation for the -# corresponding nginx configuration. -#nginx_upload_job_files_store = False -#nginx_upload_job_files_path = False - -# Have Galaxy manage dynamic proxy component for routing requests to other -# services based on Galaxy's session cookie. It will attempt to do this by -# default though you do need to install node+npm and do an npm install from -# `lib/galaxy/web/proxy/js`. It is generally more robust to configure this -# externally, managing it however Galaxy is managed. If True, Galaxy will only -# launch the proxy if it is actually going to be used (e.g. for Jupyter). -#dynamic_proxy_manage=True - -# As of 16.04 Galaxy supports multiple proxy types. The original NodeJS -# implementation, alongside a new Golang single-binary-no-dependencies -# version. Valid values are (node, golang) -#dynamic_proxy=node - -# The NodeJS dynamic proxy can use an SQLite database or a JSON file for IPC, -# set that here. -#dynamic_proxy_session_map=database/session_map.sqlite - -# Set the port and IP for the the dynamic proxy to bind to, this must match -# the external configuration if dynamic_proxy_manage is False. -#dynamic_proxy_bind_port=8800 -#dynamic_proxy_bind_ip=0.0.0.0 - -# Enable verbose debugging of Galaxy-managed dynamic proxy. -#dynamic_proxy_debug=False - -# The dynamic proxy is proxied by an external proxy (e.g. apache frontend to -# nodejs to wrap connections in SSL). -#dynamic_proxy_external_proxy=False - -# Additionally, when the dynamic proxy is proxied by an upstream server, you'll -# want to specify a prefixed URL so both Galaxy and the proxy reside under the -# same path that your cookies are under. This will result in a url like -# https://FQDN/galaxy-prefix/gie_proxy for proxying -#dynamic_proxy_prefix=gie_proxy - -# The Golang proxy also manages the docker containers more closely than the -# NodeJS proxy, so is able to expose more container management related options - -# This attribute governs the minimum length of time between consecutive HTTP/WS -# requests through the proxy, before the proxy considers a container as being -# inactive and kills it. -#dynamic_proxy_golang_noaccess = 60 - -# In order to kill containers, the golang proxy has to check at some interval -# for possibly dead containers. This is exposed as a configurable parameter, -# but the default value is probably fine. -#dynamic_proxy_golang_clean_interval = 10 - -# The golang proxy needs to know how to talk to your docker daemon. Currently -# TLS is not supported, that will come in an update. -#dynamic_proxy_golang_docker_address = unix:///var/run/docker.sock - -# The golang proxy uses a RESTful HTTP API for communication with Galaxy -# instead of a JSON or SQLite file for IPC. If you do not specify this, it will -# be set randomly for you. You should set this if you are managing the proxy -# manually. -#dynamic_proxy_golang_api_key = None - -# -- Logging and Debugging - -# If True, Galaxy will attempt to configure a simple root logger if a -# "loggers" section does not appear in this configuration file. -#auto_configure_logging = True - -# Verbosity of console log messages. Acceptable values can be found here: -# https://docs.python.org/2/library/logging.html#logging-levels -# A custom debug level of "TRACE" is available for even more verbosity. -#log_level = DEBUG - -# Print database operations to the server log (warning, quite verbose!). -#database_engine_option_echo = False - -# Print database pool operations to the server log (warning, quite verbose!). -#database_engine_option_echo_pool = False - -# Turn on logging of application events and some user events to the database. -#log_events = True - -# Turn on logging of user actions to the database. Actions currently logged -# are grid views, tool searches, and use of "recently" used tools menu. The -# log_events and log_actions functionality will eventually be merged. -#log_actions = True - -# Fluentd configuration. Various events can be logged to the fluentd instance -# configured below by enabling fluent_log. -#fluent_log = False -#fluent_host = localhost -#fluent_port = 24224 - -# Sanitize all HTML tool output. By default, all tool output served as -# 'text/html' will be sanitized thoroughly. This can be disabled if you have -# special tools that require unaltered output. WARNING: disabling this does -# make the Galaxy instance susceptible to XSS attacks initiated by your users. -#sanitize_all_html = True - -# Whitelist sanitization file. -# Datasets created by tools listed in this file are trusted and will not have -# their HTML sanitized on display. This can be manually edited or manipulated -# through the Admin control panel -- see "Manage Display Whitelist" -#sanitize_whitelist_file = config/sanitize_whitelist.txt - -# By default Galaxy will serve non-HTML tool output that may potentially -# contain browser executable JavaScript content as plain text. This will for -# instance cause SVG datasets to not render properly and so may be disabled -# by setting the following option to True. -#serve_xss_vulnerable_mimetypes = False - -# Return a Access-Control-Allow-Origin response header that matches the Origin -# header of the request if that Origin hostname matches one of the strings or -# regular expressions listed here. This is a comma separated list of hostname -# strings or regular expressions beginning and ending with /. -# E.g. mysite.com,google.com,usegalaxy.org,/^[\w\.]*example\.com/ -# See: https://developer.mozilla.org/en-US/docs/Web/HTTP/Access_control_CORS -#allowed_origin_hostnames = None - -# Set the following to True to use Jupyter nbconvert to build HTML from Jupyter -# notebooks in Galaxy histories. This process may allow users to execute -# arbitrary code or serve arbitrary HTML. If enabled, Jupyter must be -# available and on Galaxy's PATH, to do this run -# `pip install jinja2 pygments jupyter` in Galaxy's virtualenv. -#trust_jupyter_notebook_conversion = False - -# Debug enables access to various config options useful for development and -# debugging: use_lint, use_profile, use_printdebug and use_interactive. It -# also causes the files used by PBS/SGE (submission script, output, and error) -# to remain on disk after the job is complete. -#debug = False - -# Check for WSGI compliance. -#use_lint = False - -# Run the Python profiler on each request. -#use_profile = False - -# Intercept print statements and show them on the returned page. -#use_printdebug = True - -# Enable live debugging in your browser. This should NEVER be enabled on a -# public site. Enabled in the sample config for development. -use_interactive = True - -# When stopping Galaxy cleanly, how much time to give various monitoring/polling -# threads to finish before giving up on joining them. Set to 0 to disable this and -# restore the pre-18.01 default behavior. -#monitor_thread_join_timeout = 5 - -# Write thread status periodically to 'heartbeat.log', (careful, uses disk -# space rapidly!). Useful to determine why your processes may be consuming a -# lot of CPU. -#use_heartbeat = False - -# Control the period (in seconds) between dumps. Use -1 to disable. Regardless -# of this setting, if use_heartbeat is enabled, you can send a Galaxy process -# (unless running with uWSGI) SIGUSR1 (`kill -USR1`) to force a dump. -#heartbeat_interval = 20 - -# Heartbeat log filename. Can accept the template variables {server_name} and -# {pid} -#heartbeat_log = heartbeat_{server_name}.log - -# Log to Sentry -# Sentry is an open source logging and error aggregation platform. Setting -# sentry_dsn will enable the Sentry middleware and errors will be sent to the -# indicated sentry instance. This connection string is available in your -# sentry instance under -> Settings -> API Keys. -#sentry_dsn = None - -# Log to statsd -# Statsd is an external statistics aggregator (https://github.com/etsy/statsd) -# Enabling the following options will cause galaxy to log request timing and -# other statistics to the configured statsd instance. The statsd_prefix is -# useful if you are running multiple Galaxy instances and want to segment -# statistics between them within the same aggregator. -#statsd_host= -#statsd_port=8125 -#statsd_prefix=galaxy - -# Log to graphite -# Graphite is an external statistics aggregator (https://github.com/graphite-project/carbon) -# Enabling the following options will cause galaxy to log request timing and -# other statistics to the configured graphite instance. The graphite_prefix is -# useful if you are running multiple Galaxy instances and want to segment -# statistics between them within the same aggregator. -#graphite_host= -#graphite_port=2003 -#graphite_prefix=galaxy - -# -- Data Libraries - -# These library upload options are described in much more detail in the Galaxy -# Community Hub: -# https://galaxyproject.org/data-libraries/ - -# Add an option to the library upload form which allows administrators to -# upload a directory of files. -#library_import_dir = None - -# Add an option to the library upload form which allows authorized -# non-administrators to upload a directory of files. The configured directory -# must contain sub-directories named the same as the non-admin user's Galaxy -# login ( email ). The non-admin user is restricted to uploading files or -# sub-directories of files contained in their directory. -#user_library_import_dir = None - -# For security reasons, users may not import any files that actually lie -# outside of their `user_library_import_dir` (e.g. using symbolic links). A -# list of directories can be allowed by setting the following option (the list -# is comma-separated). Be aware that *any* user with library import permissions -# can import from anywhere in these directories (assuming they are able to -# create symlinks to them). -#user_library_import_symlink_whitelist = None - -# Allow admins to paste filesystem paths during upload. For libraries this -# adds an option to the admin library upload tool allowing admins to paste -# filesystem paths to files and directories in a box, and these paths will be -# added to a library. For history uploads, this allows pasting in paths as URIs. -# (i.e. prefixed with file://). Set to True to enable. Please note the security -# implication that this will give Galaxy Admins access to anything your Galaxy -# user has access to. -#allow_path_paste = False - -# Users may choose to download multiple files from a library in an archive. By -# default, Galaxy allows users to select from a few different archive formats -# if testing shows that Galaxy is able to create files using these formats. -# Specific formats can be disabled with this option, separate more than one -# format with commas. Available formats are currently 'zip', 'gz', and 'bz2'. -#disable_library_comptypes = - -# Some sequencer integration features in beta allow you to automatically -# transfer datasets. This is done using a lightweight transfer manager which -# runs outside of Galaxy (but is spawned by it automatically). Galaxy will -# communicate with this manager over the port specified here. -#transfer_manager_port = 8163 - -# -- Toolbox Search - -# Boosts are used to customize this instance's toolbox search. -# The higher the boost, the more importance the scoring algorithm gives to the -# given field. Section refers to the tool group in the tool panel. Rest of -# the fields are tool's attributes. -#tool_name_boost = 9 -#tool_section_boost = 3 -#tool_description_boost = 2 -#tool_label_boost = 1 -#tool_stub_boost = 5 -#tool_help_boost = 0.5 - -# Limits the number of results in toolbox search. Can be used to tweak how many -# results will appear. -#tool_search_limit = 20 - -# Enable/ disable Ngram-search for tools. It makes tool -# search results tolerant for spelling mistakes in the query -# by dividing the query into multiple ngrams and search for -# each ngram -#tool_enable_ngram_search = False - -# Set minimum size of ngrams -#tool_ngram_minsize = 3 - -# Set maximum size of ngrams -#tool_ngram_maxsize = 4 - -# -- Users and Security - -# Galaxy encodes various internal values when these values will be output in -# some format (for example, in a URL or cookie). You should set a key to be -# used by the algorithm that encodes and decodes these values. It can be any -# string up to 448 bits long. -# One simple way to generate a value for this is with the shell command: -# python -c 'import time; print time.time()' | md5sum | cut -f 1 -d ' ' -#id_secret = USING THE DEFAULT IS NOT SECURE! - -# User authentication can be delegated to an upstream proxy server (usually -# Apache). The upstream proxy should set a REMOTE_USER header in the request. -# Enabling remote user disables regular logins. For more information, see: -# https://galaxyproject.org/admin/config/apache-proxy -#use_remote_user = False - -# If use_remote_user is enabled and your external authentication -# method just returns bare usernames, set a default mail domain to be appended -# to usernames, to become your Galaxy usernames (email addresses). -#remote_user_maildomain = None - -# If use_remote_user is enabled, the header that the upstream proxy provides -# the remote username in defaults to HTTP_REMOTE_USER (the 'HTTP_' is prepended -# by WSGI). This option allows you to change the header. Note, you still need -# to prepend 'HTTP_' to the header in this option, but your proxy server should -# *not* include 'HTTP_' at the beginning of the header name. -#remote_user_header = HTTP_REMOTE_USER - -# If use_remote_user is enabled, anyone who can log in to the Galaxy host may -# impersonate any other user by simply sending the appropriate header. Thus a -# secret shared between the upstream proxy server, and Galaxy is required. -# If anyone other than the Galaxy user is using the server, then apache/nginx -# should pass a value in the header 'GX_SECRET' that is identical to the one -# below. -#remote_user_secret = USING THE DEFAULT IS NOT SECURE! - -# If use_remote_user is enabled, you can set this to a URL that will log your -# users out. -#remote_user_logout_href = None - -# If your proxy and/or authentication source does not normalize e-mail -# addresses or user names being passed to Galaxy - set the following option -# to True to force these to lower case. -#normalize_remote_user_email = False - -# If an e-mail address is specified here, it will hijack remote user mechanics -# (``use_remote_user``) and have the webapp inject a single fixed user. This -# has the effect of turning Galaxy into a single user application with no -# login or external proxy required. Such applications should not be exposed to -# the world. -#single_user = - -# Administrative users - set this to a comma-separated list of valid Galaxy -# users (email addresses). These users will have access to the Admin section -# of the server, and will have access to create users, groups, roles, -# libraries, and more. For more information, see: -# https://galaxyproject.org/admin/ -#admin_users = None - -# Force everyone to log in (disable anonymous access). -#require_login = False - -# Show the site's welcome page (see welcome_url) alongside the login page -# (even if require_login is True) -#show_welcome_with_login = False - -# Allow unregistered users to create new accounts (otherwise, they will have to -# be created by an admin). -#allow_user_creation = True - -# Allow administrators to delete accounts. -#allow_user_deletion = False - -# Allow administrators to log in as other users (useful for debugging) -#allow_user_impersonation = False - -# Allow users to remove their datasets from disk immediately (otherwise, -# datasets will be removed after a time period specified by an administrator in -# the cleanup scripts run via cron) -#allow_user_dataset_purge = True - -# By default, users' data will be public, but setting this to True will cause -# it to be private. Does not affect existing users and data, only ones created -# after this option is set. Users may still change their default back to -# public. -#new_user_dataset_access_role_default_private = False - -# Expose user list. Setting this to True will expose the user list to -# authenticated users. This makes sharing datasets in smaller galaxy instances -# much easier as they can type a name/email and have the correct user show up. -# This makes less sense on large public Galaxy instances where that data -# shouldn't be exposed. For semi-public Galaxies, it may make sense to expose -# just the username and not email, or vice versa. -#expose_user_name = False -#expose_user_email = False - -# Whitelist for local network addresses for "Upload from URL" dialog. -# By default, Galaxy will deny access to the local network address space, to -# prevent users making requests to services which the administrator did not -# intend to expose. Previously, you could request any network service that -# Galaxy might have had access to, even if the user could not normally access it. -# It should be a comma separated list of IP addresses or IP address/mask, e.g. -# 10.10.10.10,10.0.1.0/24,fd00::/8 -#fetch_url_whitelist= - -# -- Beta features - -# Enable the new interface for installing tools from Tool Shed -# via the API. Admin menu will list both if enabled. -#enable_beta_ts_api_install = True - -# Enable the new container interface for Interactive Environments -#enable_beta_containers_interface = False - -# Set the following to a number of threads greater than 1 to spawn -# a Python task queue for dealing with large tool submissions (either -# through the tool form or as part of an individual workflow step across -# large collection). This affects workflow scheduling and web processes, -# not job handlers. This is a beta option and should not be used in production. -#tool_submission_burst_threads = 1 - -# If tool_submission_burst_threads is set to a number greater than 1, this -# is the number of jobs to schedule at which the task queue will be created. -#tool_submission_burst_at = 10 - -# Enable beta workflow modules that should not yet be considered part of Galaxy's -# stable API. -#enable_beta_workflow_modules = False - -# Following options only apply to workflows scheduled using the legacy workflow -# run API (running workflows via a POST to /api/workflows). -# Force usage of Galaxy's beta workflow scheduler under certain circumstances - -# this workflow scheduling forces Galaxy to schedule workflows in the background -# so initial submission of the workflows is significantly sped up. This does -# however force the user to refresh their history manually to see newly scheduled -# steps (for "normal" workflows - steps are still scheduled far in advance of -# them being queued and scheduling here doesn't refer to actual cluster job -# scheduling). -# Workflows containing more than the specified number of steps will always use -# the Galaxy's beta workflow scheduling. -#force_beta_workflow_scheduled_min_steps=250 -# Switch to using Galaxy's beta workflow scheduling for all workflows involving -# collections. -#force_beta_workflow_scheduled_for_collections=False - -# If multiple job handlers are enabled, allow Galaxy to schedule workflow invocations -# in multiple handlers simultaneously. This is discouraged because it results in a -# less predictable order of workflow datasets within in histories. -#parallelize_workflow_scheduling_within_histories = False - -# This is the maximum amount of time a workflow invocation may stay in an active -# scheduling state in seconds. Set to -1 to disable this maximum and allow any workflow -# invocation to schedule indefinitely. The default corresponds to 1 month. -#maximum_workflow_invocation_duration = 2678400 - -# Specify a maximum number of jobs that any given workflow scheduling iteration can create. -# Set this to a positive integer to prevent large collection jobs in a workflow from -# preventing other jobs from executing. This may also mitigate memory issues associated with -# scheduling workflows at the expense of increased total DB traffic because model objects -# are expunged from the SQL alchemy session between workflow invocation scheduling iterations. -# Set to -1 to disable any such maximum (the default). -#maximum_workflow_jobs_per_scheduling_iteration = -1 - -# Force serial scheduling of workflows within the context of a particular history -#history_local_serial_workflow_scheduling=False - -# Enable authentication via OpenID. Allows users to log in to their Galaxy -# account by authenticating with an OpenID provider. -#enable_openid = False - -# If OpenID is enabled, this configuration file specifies providers to use. -# Falls back to the .sample variant in config if default does not exist. -#openid_config_file = config/openid_conf.xml - -# If OpenID is enabled, consumer cache directory to use. -#openid_consumer_cache_path = database/openid_consumer_cache - -# XML config file that allows the use of different authentication providers -# (e.g. LDAP) instead or in addition to local authentication (.sample is used -# if default does not exist). -#auth_config_file = config/auth_conf.xml - -# Optional list of email addresses of API users who can make calls on behalf of -# other users. -#api_allow_run_as = None - -# Master key that allows many API admin actions to be used without actually -# having a defined admin user in the database/config. Only set this if you -# need to bootstrap Galaxy, you probably do not want to set this on public -# servers. -#master_api_key = changethis - -# Enable tool tags (associating tools with tags). This has its own option -# since its implementation has a few performance implications on startup for -# large servers. -#enable_tool_tags = False - -# Enable a feature when running workflows. When enabled, default datasets -# are selected for "Set at Runtime" inputs from the history such that the -# same input will not be selected twice, unless there are more inputs than -# compatible datasets in the history. -# When False, the most recently added compatible item in the history will -# be used for each "Set at Runtime" input, independent of others in the Workflow -#enable_unique_workflow_defaults = False - -# The URL to the myExperiment instance being used (omit scheme but include port) -#myexperiment_url = www.myexperiment.org:80 - -# Enable Galaxy's "Upload via FTP" interface. You'll need to install and -# configure an FTP server (we've used ProFTPd since it can use Galaxy's -# database for authentication) and set the following two options. -# This should point to a directory containing subdirectories matching users' -# identifier (defaults to e-mail), where Galaxy will look for files. -#ftp_upload_dir = None - -# This should be the hostname of your FTP server, which will be provided to -# users in the help text. -#ftp_upload_site = None - -# User attribute to use as subdirectory in calculating default ftp_upload_dir -# pattern. By default this will be email so a user's FTP upload directory will be -# ${ftp_upload_dir}/${user.email}. Can set this to other attributes such as id or -# username though. -#ftp_upload_dir_identifier = email - -# Python string template used to determine an FTP upload directory for a -# particular user. -#ftp_upload_dir_template = ${ftp_upload_dir}/${ftp_upload_dir_identifier} - -# This should be set to False to prevent Galaxy from deleting uploaded FTP files -# as it imports them. -#ftp_upload_purge = True - -# Enable enforcement of quotas. Quotas can be set from the Admin interface. -#enable_quotas = False - -# This option allows users to see the full path of datasets via the "View -# Details" option in the history. This option also exposes the command line to -# non-administrative users. Administrators can always see dataset paths. -#expose_dataset_path = False - -# This option allows users to see the job metrics (except for environment -# variables). -#expose_potentially_sensitive_job_metrics = False - -# Enable the API for sample tracking -#enable_legacy_sample_tracking_api = False - -# -- Data manager configuration options - -# Allow non-admin users to view available Data Manager options. -#enable_data_manager_user_view = False - -# File where Data Managers are configured (.sample used if default does not -# exist). -#data_manager_config_file = config/data_manager_conf.xml - -# File where Tool Shed based Data Managers are configured. -#shed_data_manager_config_file = config/shed_data_manager_conf.xml - -# Directory to store Data Manager based tool-data; defaults to tool_data_path. -#galaxy_data_manager_data_path = tool-data - -# -- Job Execution - -# To increase performance of job execution and the web interface, you can -# separate Galaxy into multiple processes. There are more than one way to do -# this, and they are explained in detail in the documentation: -# -# https://galaxyproject.org/admin/config/performance/scaling - -# By default, Galaxy manages and executes jobs from within a single process and -# notifies itself of new jobs via in-memory queues. Jobs are run locally on -# the system on which Galaxy is started. Advanced job running capabilities can -# be configured through the job configuration file. -#job_config_file = config/job_conf.xml - -# When jobs fail due to job runner problems, Galaxy can be configured to retry -# these or reroute the jobs to new destinations. Very fine control of this is -# available with resubmit declarations in job_conf.xml. For simple deployments -# of Galaxy though, the following attribute can define resubmission conditions -# for all job destinations. If any job destination defines even one -# resubmission condition explicitly in job_conf.xml - the condition described -# by this option will not apply to that destination. For instance, the condition: -# 'attempt < 3 and unknown_error and (time_running < 300 or time_since_queued < 300)' -# would retry up to two times jobs that didn't fail due to detected memory or -# walltime limits but did fail quickly (either while queueing or running). The -# commented out default below results in no default job resubmission condition, -# failing jobs are just failed outright. -#default_job_resubmission_condition = - -# In multiprocess configurations, notification between processes about new jobs -# must be done via the database. In single process configurations, this can be -# done in memory, which is a bit quicker. -#track_jobs_in_database = True - -# This enables splitting of jobs into tasks, if specified by the particular tool -# config. -# This is a new feature and not recommended for production servers yet. -#use_tasked_jobs = False -#local_task_queue_workers = 2 - -# Enable job recovery (if Galaxy is restarted while cluster jobs are running, -# it can "recover" them when it starts). This is not safe to use if you are -# running more than one Galaxy server using the same database. -#enable_job_recovery = True - -# Although it is fairly reliable, setting metadata can occasionally fail. In -# these instances, you can choose to retry setting it internally or leave it in -# a failed state (since retrying internally may cause the Galaxy process to be -# unresponsive). If this option is set to False, the user will be given the -# option to retry externally, or set metadata manually (when possible). -#retry_metadata_internally = True - -# Very large metadata values can cause Galaxy crashes. This will allow -# limiting the maximum metadata key size (in bytes used in memory, not the end -# result database value size) Galaxy will attempt to save with a dataset. Use -# 0 to disable this feature. The default is 5MB, but as low as 1MB seems to be -# a reasonable size. -#max_metadata_value_size = 5242880 - -# If (for example) you run on a cluster and your datasets (by default, -# database/files/) are mounted read-only, this option will override tool output -# paths to write outputs to the working directory instead, and the job manager -# will move the outputs to their proper place in the dataset directory on the -# Galaxy server after the job completes. -#outputs_to_working_directory = False - -# If your network filesystem's caching prevents the Galaxy server from seeing -# the job's stdout and stderr files when it completes, you can retry reading -# these files. The job runner will retry the number of times specified below, -# waiting 1 second between tries. For NFS, you may want to try the -noac mount -# option (Linux) or -actimeo=0 (Solaris). -#retry_job_output_collection = 0 - -# In the past Galaxy would preserve its Python environment when running jobs ( -# and still does for internal tools packaged with Galaxy). This behavior exposes -# Galaxy internals to tools and could result in problems when activating -# Python environments for tools (such as with Conda packaging). The default -# legacy_only will restrict this behavior to tools identified by the Galaxy -# team as requiring this environment. Set this to "always" to restore the -# previous behavior (and potentially break Conda dependency resolution for many -# tools). Set this to legacy_and_local to preserve the environment for legacy -# tools and locally managed tools (this might be useful for instance if you are -# installing software into Galaxy's virtualenv for tool development). -#preserve_python_environment = legacy_only - -# Clean up various bits of jobs left on the filesystem after completion. These -# bits include the job working directory, external metadata temporary files, -# and DRM stdout and stderr files (if using a DRM). Possible values are: -# always, onsuccess, never -#cleanup_job = always - -# When running DRMAA jobs as the Galaxy user -# (https://galaxyproject.org/admin/config/performance/cluster/#submitting-jobs-as-the-real-user) -# this script is used to run the job script Galaxy generates for a tool execution. -#drmaa_external_runjob_script = sudo -E scripts/drmaa_external_runner.py --assign_all_groups - -# When running DRMAA jobs as the Galaxy user -# (https://galaxyproject.org/admin/config/performance/cluster/#submitting-jobs-as-the-real-user) -# this script is used to kill such jobs by Galaxy (e.g. if the user cancels -# the job). -#drmaa_external_killjob_script = sudo -E scripts/drmaa_external_killer.py - -# When running DRMAA jobs as the Galaxy user -# (https://galaxyproject.org/admin/config/performance/cluster/#submitting-jobs-as-the-real-user) -# this script is used transfer permissions back and forth between the Galaxy user -# and the user that is running the job. -#external_chown_script = sudo -E scripts/external_chown_script.py - -# When running DRMAA jobs as the Galaxy user -# (https://galaxyproject.org/admin/config/performance/cluster/#submitting-jobs-as-the-real-user) -# Galaxy can extract the user name from the email address (actually the local-part before the @) -# or the username which are both stored in the Galaxy data base. -# The latter option is particularly useful for installations that get the -# authentication from LDAP. -# Also, Galaxy can accept the name of a common system user (eg. galaxy_worker) -# who can run every job being submitted. This user should not be the same user -# running the galaxy system. -# Possible values are user_email (default), username or -#real_system_username = user_email - -# File to source to set up the environment when running jobs. By default, the -# environment in which the Galaxy server starts is used when running jobs -# locally, and the environment set up per the DRM's submission method and -# policy is used when running jobs on a cluster (try testing with `qsub` on the -# command line). environment_setup_file can be set to the path of a file on -# the cluster that should be sourced by the user to set up the environment -# prior to running tools. This can be especially useful for running jobs as -# the actual user, to remove the need to configure each user's environment -# individually. -#environment_setup_file = None - -# Optional file containing job resource data entry fields definition. -# These fields will be presented to users in the tool forms and allow them to -# overwrite default job resources such as number of processors, memory and -# walltime. -#job_resource_params_file = config/job_resource_params_conf.xml - -# If using job concurrency limits (configured in job_config_file), several -# extra database queries must be performed to determine the number of jobs a -# user has dispatched to a given destination. By default, these queries will -# happen for every job that is waiting to run, but if cache_user_job_count is -# set to True, it will only happen once per iteration of the handler queue. -# Although better for performance due to reduced queries, the trade-off is a -# greater possibility that jobs will be dispatched past the configured limits -# if running many handlers. -#cache_user_job_count = False - -# -- ToolBox filtering - -# Define toolbox filters (https://galaxyproject.org/user-defined-toolbox-filters/) -# that admins may use to restrict the tools to display. -#tool_filters = - -# Define toolbox filters (https://galaxyproject.org/user-defined-toolbox-filters/) -# that admins may use to restrict the tool labels to display. -#tool_label_filters = - -# Define toolbox filters (https://galaxyproject.org/user-defined-toolbox-filters/) -# that admins may use to restrict the tool sections to display. -#tool_section_filters = - -# Define toolbox filters (https://galaxyproject.org/user-defined-toolbox-filters/) -# that users may use to restrict the tools to display. -#user_tool_filters = examples:restrict_upload_to_admins, examples:restrict_encode - -# Define toolbox filters (https://galaxyproject.org/user-defined-toolbox-filters/) -# that users may use to restrict the tool sections to display. -#user_tool_section_filters = examples:restrict_text - -# Define toolbox filters (https://galaxyproject.org/user-defined-toolbox-filters/) -# that users may use to restrict the tool labels to display. -#user_tool_label_filters = examples:restrict_upload_to_admins, examples:restrict_encode - -# The base module(s) that are searched for modules for toolbox filtering -# (https://galaxyproject.org/user-defined-toolbox-filters/) producedures. -#toolbox_filter_base_modules = galaxy.tools.toolbox.filters,galaxy.tools.filters - -# -- Galaxy Application Internal Message Queue - -# Galaxy uses AMQP internally for communicating between processes. For -# example, when reloading the toolbox or locking job execution, the process -# that handled that particular request will tell all others to also reload, -# lock jobs, etc. -# For connection examples, see http://docs.celeryproject.org/projects/kombu/en/latest/userguide/connections.html -# -# Without specifying anything here, galaxy will first attempt to use your -# specified database_connection above. If that's not specified either, Galaxy -# will automatically create and use a separate sqlite database located in your -# /database folder (indicated in the commented out line below). - -#amqp_internal_connection = sqlalchemy+sqlite:///./database/control.sqlite?isolation_level=IMMEDIATE - -# Galaxy real time communication server settings -#enable_communication_server = False -#communication_server_host = http://localhost -#communication_server_port = 7070 -# persistent_communication_rooms is a comma-separated list of rooms that should be always available. -#persistent_communication_rooms = - - -# ---- Galaxy External Message Queue ------------------------------------------------- - -# Galaxy uses Advanced Message Queuing Protocol (AMQP) to receive messages from -# external sources like barcode scanners. Galaxy has been tested against -# RabbitMQ AMQP implementation. For Galaxy to receive messages from a message -# queue, the RabbitMQ server has to be set up with a user account and other -# parameters listed below. The 'host' and 'port' fields should point to where -# the RabbitMQ server is running. - -[galaxy_amqp] - -#host = 127.0.0.1 -#port = 5672 -#userid = galaxy -#password = galaxy -#virtual_host = galaxy_messaging_engine -#queue = galaxy_queue -#exchange = galaxy_exchange -#routing_key = bar_code_scanner -#rabbitmqctl_path = /path/to/rabbitmqctl +type: map +desc: | + Galaxy is configured by default to be usable in a single-user development + environment. To tune the application for a multi-user production + environment, see the documentation at: + + http://usegalaxy.org/production + + Throughout this sample configuration file, except where stated otherwise, + uncommented values override the default if left unset, whereas commented + values are set to the default value. Relative paths are relative to the root + Galaxy directory. + + Examples of many of these options are explained in more detail in the Galaxy + Community Hub. + + https://galaxyproject.org/admin/config + + Config hackers are encouraged to check there before asking for help. +mapping: + uwsgi: !include uwsgi_schema.yml + galaxy: + type: map + required: true + mapping: + + filter-with: + type: str + default: gzip + required: false + desc: | + If not running behind a proxy server, you may want to enable gzip compression + to decrease the size of data transferred over the network. If using a proxy + server, please enable gzip compression there instead. + + filter-with: + type: str + default: proxy-prefix + required: false + desc: | + If running behind a proxy server and Galaxy is served from a subdirectory, + enable the proxy-prefix filter and set the prefix in the + [filter:proxy-prefix] section above. + + cookie_path: + type: str + default: null + required: false + desc: | + If proxy-prefix is enabled and you're running more than one Galaxy instance + behind one hostname, you will want to set this to the same path as the prefix + in the filter above. This value becomes the "path" attribute set in the + cookie so the cookies from each instance will not clobber each other. + + database_connection: + type: str + default: sqlite:///./database/universe.sqlite?isolation_level=IMMEDIATE + required: false + desc: | + By default, Galaxy uses a SQLite database at 'database/universe.sqlite'. You + may use a SQLAlchemy connection string to specify an external database + instead. This string takes many options which are explained in detail in the + config file documentation. + + database_engine_option_pool_size: + type: int + default: 5 + required: false + desc: | + If the server logs errors about not having enough database pool connections, + you will want to increase these values, or consider running more Galaxy + processes. + + database_engine_option_max_overflow: + type: int + default: 10 + required: false + desc: | + If the server logs errors about not having enough database pool connections, + you will want to increase these values, or consider running more Galaxy + processes. + + database_engine_option_pool_recycle: + type: str + default: -1 + required: false + desc: | + If using MySQL and the server logs the error "MySQL server has gone away", + you will want to set this to some positive value (7200 should work). + + database_engine_option_server_side_cursors: + type: bool + default: false + required: false + desc: | + If large database query results are causing memory or response time issues in + the Galaxy process, leave the result on the server instead. This option is + only available for PostgreSQL and is highly recommended. + + database_query_profiling_proxy: + type: bool + default: false + required: false + desc: | + Log all database transactions, can be useful for debugging and performance + profiling. Logging is done via Python's 'logging' module under the qualname + 'galaxy.model.orm.logging_connection_proxy' + + database_template: + type: str + default: null + required: false + desc: | + If auto-creating a postgres database on startup - it can be based on an existing + template database. This will set that. This is probably only useful for testing but + documentation is included here for completeness. + + slow_query_log_threshold: + type: int + default: 0 + required: false + desc: | + Slow query logging. Queries slower than the threshold indicated below will + be logged to debug. A value of '0' is disabled. For example, you would set + this to .005 to log all queries taking longer than 5 milliseconds. + + install_database_connection: + type: str + default: sqlite:///./database/universe.sqlite?isolation_level=IMMEDIATE + required: false + desc: | + By default, Galaxy will use the same database to track user data and + tool shed install data. There are many situations in which it is + valuable to separate these - for instance bootstrapping fresh Galaxy + instances with pretested installs. The following option can be used to + separate the tool shed install database (all other options listed above + but prefixed with install_ are also available). + + database_auto_migrate: + type: bool + default: false + required: false + desc: | + Setting the following option to true will cause Galaxy to automatically + migrate the database forward after updates. This is not recommended for production + use. + + file_path: + type: str + default: database/files + required: false + desc: | + Dataset files are stored in this directory. + + new_file_path: + type: str + default: database/tmp + required: false + desc: | + Temporary files are stored in this directory. + + tool_config_file: + type: str + default: config/tool_conf.xml,config/shed_tool_conf.xml + required: false + desc: | + Tool config files, defines what tools are available in Galaxy. + Tools can be locally developed or installed from Galaxy tool sheds. + (config/tool_conf.xml.sample will be used if left unset and + config/tool_conf.xml does not exist). + + check_migrate_tools: + type: bool + default: true + required: false + desc: | + Enable / disable checking if any tools defined in the above non-shed + tool_config_files (i.e., tool_conf.xml) have been migrated from the Galaxy + code distribution to the Tool Shed. This setting should generally be set to + False only for development Galaxy environments that are often rebuilt from + scratch where migrated tools do not need to be available in the Galaxy tool + panel. If the following setting remains commented, the default setting will + be True. + + migrated_tools_config: + type: str + default: config/migrated_tools_conf.xml + required: false + desc: | + Tool config maintained by tool migration scripts. If you use the migration + scripts to install tools that have been migrated to the tool shed upon a new + release, they will be added to this tool config file. + + integrated_tool_panel_config: + type: str + default: integrated_tool_panel.xml + required: false + desc: | + File that contains the XML section and tool tags from all tool panel config + files integrated into a single file that defines the tool panel layout. This + file can be changed by the Galaxy administrator to alter the layout of the + tool panel. If not present, Galaxy will create it. + + tool_path: + type: str + default: tools + required: false + desc: | + Default path to the directory containing the tools defined in tool_conf.xml. + Other tool config files must include the tool_path as an attribute in the + tag. + + tool_dependency_dir: + type: str + default: database/dependencies + required: false + desc: | + Path to the directory in which tool dependencies are placed. This is used by + the Tool Shed to install dependencies and can also be used by administrators + to manually install or link to dependencies. For details, see: + https://galaxyproject.org/admin/config/tool-dependencies + Set the string to None to explicitly disable tool dependency handling. + If this option is set to none or an invalid path, installing tools with dependencies + from the Tool Shed will fail. + + dependency_resolvers_config_file: + type: str + default: config/dependency_resolvers_conf.xml + required: false + desc: | + The dependency resolvers config file specifies an ordering and options for how + Galaxy resolves tool dependencies (requirement tags in Tool XML). The default + ordering is to the use the Tool Shed for tools installed that way, use local + Galaxy packages, and then use Conda if available. + See https://github.com/galaxyproject/galaxy/blob/dev/doc/source/admin/dependency_resolvers.rst + for more information on these options. + + conda_prefix: + type: str + default: /_conda + required: false + desc: | + conda_prefix is the location on the filesystem where Conda packages and environments are installed + IMPORTANT: Due to a current limitation in conda, the total length of the + conda_prefix and the job_working_directory path should be less than 50 characters! + + conda_exec: + type: str + required: false + desc: | + Override the Conda executable to use, it will default to the one on the + PATH (if available) and then to /bin/conda + + conda_debug: + type: bool + default: false + required: false + desc: | + Pass debug flag to conda commands. + + conda_ensure_channels: + type: str + default: iuc,bioconda,conda-forge,defaults,r + required: false + desc: | + conda channels to enable by default (http://conda.pydata.org/docs/custom-channels.html) + + conda_auto_install: + type: bool + default: false + required: false + desc: | + Set to True to instruct Galaxy to look for and install missing tool + dependencies before each job runs. + + conda_auto_init: + type: bool + default: true + required: false + desc: | + Set to True to instruct Galaxy to install Conda from the web automatically + if it cannot find a local copy and conda_exec is not configured. + + conda_copy_dependencies: + type: bool + default: false + required: false + desc: | + You must set this to True if conda_prefix and job_working_directory are not on the same + volume, or some conda dependencies will fail to execute at job runtime. + Conda will copy packages content instead of creating hardlinks or symlinks. + This will prevent problems with some specific packages (perl, R), at the cost + of extra disk space usage and extra time spent copying packages. + + use_cached_dependency_manager: + type: bool + default: false + required: false + desc: | + Certain dependency resolvers (namely Conda) take a considerable amount of + time to build an isolated job environment in the job_working_directory if the + job working directory is on a network share. Set the following option to True + to cache the dependencies in a folder. This option is beta and should only be + used if you experience long waiting times before a job is actually submitted + to your cluster. + + tool_dependency_cache_dir: + type: str + default: /_cache + required: false + desc: | + By default the tool_dependency_cache_dir is the _cache directory + of the tool dependency directory + + precache_dependencies: + type: bool + default: true + required: false + desc: | + By default, when using a cached dependency manager, the dependencies are cached + when installing new tools and when using tools for the first time. + Set this to False if you prefer dependencies to be cached only when installing new tools. + + tool_sheds_config_file: + type: str + default: config/tool_sheds_conf.xml + required: false + desc: | + File containing the Galaxy Tool Sheds that should be made available to + install from in the admin interface (.sample used if default does not exist). + + watch_tools: + type: bool + default: false + required: false + desc: | + Set to True to enable monitoring of tools and tool directories + listed in any tool config file specified in tool_config_file option. + If changes are found, tools are automatically reloaded. Watchdog ( + https://pypi.python.org/pypi/watchdog ) must be installed and + available to Galaxy to use this option. Other options include 'auto' + which will attempt to watch tools if the watchdog library is available + but won't fail to load Galaxy if it is not and 'polling' which will use + a less efficient monitoring scheme that may work in wider range of scenarios + than the watchdog default. + + enable_beta_mulled_containers: + type: bool + default: false + required: false + desc: | + Enable Galaxy to fetch Docker containers registered with quay.io generated + from tool requirements resolved through conda. These containers (when + available) have been generated using mulled - https://github.com/mulled. + These containers are highly beta and availability will vary by tool. + This option will additionally only be used for job destinations with + Docker enabled. + + containers_resolvers_config_file: + type: str + default: null + required: false + desc: | + Container resolvers configuration (beta). Setup a file describing container + resolvers to use when discovering containers for Galaxy. If this is set to + None, the default containers loaded is determined by + enable_beta_mulled_containers. + + involucro_path: + type: str + default: database/dependencies/involucro + required: false + desc: | + involucro is a tool used to build Docker containers for tools from Conda + dependencies referenced in tools as `requirement`s. The following path is + the location of involucro on the Galaxy host. This is ignored if the relevant + container resolver isn't enabled, and will install on demand unless + involucro_auto_init is set to False. + + involucro_auto_init: + type: bool + default: true + required: false + desc: | + Install involucro as needed to build Docker containers for tools. Ignored if + relevant container resolver is not used. + + enable_tool_shed_check: + type: bool + default: false + required: false + desc: | + Enable automatic polling of relative tool sheds to see if any updates + are available for installed repositories. Ideally only one Galaxy + server process should be able to check for repository updates. The + setting for hours_between_check should be an integer between 1 and 24. + + hours_between_check: + type: int + default: 12 + required: false + desc: | + Enable automatic polling of relative tool sheds to see if any updates + are available for installed repositories. Ideally only one Galaxy + server process should be able to check for repository updates. The + setting for hours_between_check should be an integer between 1 and 24. + + manage_dependency_relationships: + type: bool + default: false + required: false + desc: | + Enable use of an in-memory registry with bi-directional relationships between + repositories (i.e., in addition to lists of dependencies for a repository, + keep an in-memory registry of dependent items for each repository. + + tool_data_table_config_path: + type: str + default: config/tool_data_table_conf.xml + required: false + desc: | + XML config file that contains data table entries for the + ToolDataTableManager. This file is manually # maintained by the Galaxy + administrator (.sample used if default does not exist). + + shed_tool_data_table_config: + type: str + default: config/shed_tool_data_table_conf.xml + required: false + desc: | + XML config file that contains additional data table entries for the + ToolDataTableManager. This file is automatically generated based on the + current installed tool shed repositories that contain valid + tool_data_table_conf.xml.sample files. At the time of installation, these + entries are automatically added to the following file, which is parsed and + applied to the ToolDataTableManager at server start up. + + tool_data_path: + type: str + default: tool-data + required: false + desc: | + Directory where data used by tools is located. See the samples in that + directory and the Galaxy Community Hub for help: + https://galaxyproject.org/admin/data-integration + + shed_tool_data_path: + type: str + default: tool-data + required: false + desc: | + Directory where Tool Data Table related files will be placed + when installed from a ToolShed. Defaults to tool_data_path. + + watch_tool_data_dir: + type: bool + default: false + required: false + desc: | + Set to True to enable monitoring of the tool_data and shed_tool_data_path + directories. If changes in tool data table files are found, the tool data + tables for that data manager are automatically reloaded. + Watchdog ( https://pypi.python.org/pypi/watchdog ) must be installed and + available to Galaxy to use this option. Other options include 'auto' + which will attempt to use the watchdog library if it is available but won't + fail to load Galaxy if it is not and 'polling' which will use a less + efficient monitoring scheme that may work in wider range of scenarios + than the watchdog default. + + builds_file_path: + type: str + default: tool-data/shared/ucsc/builds.txt + required: false + desc: | + File containing old-style genome builds + + len_file_path: + type: str + default: tool-data/shared/ucsc/chrom + required: false + desc: | + Directory where chrom len files are kept, currently mainly used by trackster + + datatypes_config_file: + type: str + default: config/datatypes_conf.xml + required: false + desc: | + Datatypes config file(s), defines what data (file) types are available in + Galaxy (.sample is used if default does not exist). If a datatype appears in + multiple files, the last definition is used (though the first sniffer is used + so limit sniffer definitions to one file). + + datatypes_disable_auto: + type: bool + default: false + required: false + desc: | + Disable the 'Auto-detect' option for file uploads + + visualization_plugins_directory: + type: str + default: config/plugins/visualizations + required: false + desc: | + Visualizations config directory: where to look for individual visualization + plugins. The path is relative to the Galaxy root dir. To use an absolute + path begin the path with '/'. This is a comma separated list. + Defaults to "config/plugins/visualizations". + + interactive_environment_plugins_directory: + type: str + required: false + desc: | + Interactive environment plugins root directory: where to look for interactive + environment plugins. By default none will be loaded. Set to + config/plugins/interactive_environments to load Galaxy's stock plugins. + These will require Docker to be configured and have security considerations, + so proceed with caution. The path is relative to the Galaxy root dir. To use + an absolute path begin the path with '/'. This is a comma + separated list. + + interactive_environment_swarm_mode: + type: bool + default: false + required: false + desc: | + To run interactive environment containers in Docker Swarm mode (on an + existing swarm), set this option to True and set `docker_connect_port` in the + IE plugin config (ini) file(s) of any IE plugins you have enabled and ensure + that you are not using any `docker run`-specific options in your plugins' + `command_inject` options (swarm mode services run using `docker service + create`, which has a different and more limited set of options). This option + can be overridden on a per-plugin basis by using the `swarm_mode` option in + the plugin's ini config file. + + swarm_manager_config_file: + type: str + default: config/swarm_manager_conf.yml + required: false + desc: | + Galaxy can run a "swarm manager" service that will monitor utilization of the + swarm and provision/deprovision worker nodes as necessary. The service has + its own configuration file. + + tour_config_dir: + type: str + default: config/plugins/tours + required: false + desc: | + Interactive tour directory: where to store interactive tour definition files. + Galaxy ships with several basic interface tours enabled, though a different + directory with custom tours can be specified here. The path is relative to the + Galaxy root dir. To use an absolute path begin the path with '/'. This is a comma + separated list. + + webhooks_dir: + type: str + default: config/plugins/webhooks + required: false + desc: | + Webhooks directory: where to store webhooks - plugins to extend the Galaxy UI. + By default none will be loaded. Set to config/plugins/webhooks/demo to load Galaxy's + demo webhooks. To use an absolute path begin the path with '/'. This is a comma + separated list. Add test/functional/webhooks to this list to include the demo webhooks + used to test the webhook framework. + + job_working_directory: + type: str + default: database/jobs_directory + required: false + desc: | + Each job is given a unique empty directory as its current working directory. + This option defines in what parent directory those directories will be + created. + + cluster_files_directory: + type: str + default: database/pbs + required: false + desc: | + If using a cluster, Galaxy will write job scripts and stdout/stderr to this + directory. + + template_cache_path: + type: str + default: database/compiled_templates + required: false + desc: | + Mako templates are compiled as needed and cached for reuse, this directory is + used for the cache + + check_job_script_integrity: + type: bool + default: true + required: false + desc: | + Set to false to disable various checks Galaxy will do to ensure it + can run job scripts before attempting to execute or submit them. + + check_job_script_integrity_count: + type: int + default: 35 + required: false + desc: | + Number of checks to execute if check_job_script_integrity is enabled. + + check_job_script_integrity_sleep: + type: str + default: .25 + required: false + desc: | + Time to sleep between checks if check_job_script_integrity is enabled (in seconds). + + default_job_shell: + type: str + default: /bin/bash + required: false + desc: | + Set the default shell used by non-containerized jobs Galaxy-wide. This + defaults to bash for all jobs and can be overridden at the destination + level for heterogeneous clusters. conda job resolution requires bash or zsh + so if this is switched to /bin/sh for instance - conda resolution + should be disabled. Containerized jobs always use /bin/sh - so more maximum + portability tool authors should assume generated commands run in sh. + + citation_cache_type: + type: str + default: file + required: false + desc: | + Citation related caching. Tool citations information maybe fetched from + external sources such as http://dx.doi.org/ by Galaxy - the following + parameters can be used to control the caching used to store this information. + + citation_cache_data_dir: + type: str + default: database/citations/data + required: false + desc: | + Citation related caching. Tool citations information maybe fetched from + external sources such as http://dx.doi.org/ by Galaxy - the following + parameters can be used to control the caching used to store this information. + + citation_cache_lock_dir: + type: str + default: database/citations/lock + required: false + desc: | + Citation related caching. Tool citations information maybe fetched from + external sources such as http://dx.doi.org/ by Galaxy - the following + parameters can be used to control the caching used to store this information. + + collect_outputs_from: + type: str + default: new_file_path,job_working_directory + required: false + desc: | + Tools with a number of outputs not known until runtime can write these + outputs to a directory for collection by Galaxy when the job is done. + Previously, this directory was new_file_path, but using one global directory + can cause performance problems, so using job_working_directory ('.' or cwd + when a job is run) is encouraged. By default, both are checked to avoid + breaking existing tools. + + object_store_config_file: + type: str + default: config/object_store_conf.xml + required: false + desc: | + Configuration file for the object store + If this is set and exists, it overrides any other objectstore settings. + + smtp_server: + type: str + default: null + required: false + desc: | + Galaxy sends mail for various things: subscribing users to the mailing list + if they request it, password resets, reporting dataset errors, and sending + activation emails. To do this, it needs to send mail through an SMTP server, + which you may define here (host:port). + Galaxy will automatically try STARTTLS but will continue upon failure. + + smtp_username: + type: str + default: null + required: false + desc: | + If your SMTP server requires a username and password, you can provide them + here (password in cleartext here, but if your server supports STARTTLS it + will be sent over the network encrypted). + + smtp_password: + type: str + default: null + required: false + desc: | + If your SMTP server requires a username and password, you can provide them + here (password in cleartext here, but if your server supports STARTTLS it + will be sent over the network encrypted). + + smtp_ssl: + type: bool + default: false + required: false + desc: | + If your SMTP server requires SSL from the beginning of the connection + + mailing_join_addr: + type: str + default: galaxy-announce-join@bx.psu.edu + required: false + desc: | + On the user registration form, users may choose to join a mailing list. This + is the address used to subscribe to the list. Uncomment and leave empty if you + want to remove this option from the user registration form. + + error_email_to: + type: str + default: null + required: false + desc: | + Datasets in an error state include a link to report the error. Those reports + will be sent to this address. Error reports are disabled if no address is + set. Also this email is shown as a contact to user in case of Galaxy + misconfiguration and other events user may encounter. + + email_from: + type: str + default: null + required: false + desc: | + Email address to use in the 'From' field when sending emails for + account activations, workflow step notifications and password resets. + We recommend using string in the following format: + Galaxy Project + If not configured, '' will be used. + + instance_resource_url: + type: str + default: https://galaxyproject.org/ + required: false + desc: | + URL of the support resource for the galaxy instance. Used in activation + emails. + + blacklist_file: + type: str + default: config/disposable_email_blacklist.conf + required: false + desc: | + E-mail domains blacklist is used for filtering out users that are using + disposable email address during the registration. If their address domain + matches any domain in the blacklist, they are refused the registration. + + registration_warning_message: + type: str + default: Please register only one account - we provide this service free of charge and have limited computational resources. Multi-accounts are tracked and will be subjected to account termination and data deletion. + required: false + desc: | + Registration warning message is used to discourage people from registering + multiple accounts. Applies mostly for the main Galaxy instance. + If no message specified the warning box will not be shown. + + user_activation_on: + type: bool + default: false + required: false + desc: | + User account activation feature global flag. If set to "False", the rest of + the Account activation configuration is ignored and user activation is + disabled (i.e. accounts are active since registration). + The activation is also not working in case the SMTP server is not defined. + + activation_grace_period: + type: int + default: 3 + required: false + desc: | + Activation grace period (in hours). Activation is not forced (login is not + disabled) until grace period has passed. Users under grace period can't run + jobs. Enter 0 to disable grace period. + Users with OpenID logins have grace period forever. + + inactivity_box_content: + type: str + default: Your account has not been activated yet. Feel free to browse around and see what's available, but you won't be able to upload data or run jobs until you have verified your email address. + required: false + desc: | + Shown in warning box to users that were not activated yet. + In use only if activation_grace_period is set. + + password_expiration_period: + type: int + default: 0 + required: false + desc: | + Password expiration period (in days). Users are required to change their + password every x days. Users will be redirected to the change password + screen when they log in after their password expires. Enter 0 to disable + password expiration. + + session_duration: + type: int + default: 0 + required: false + desc: | + Galaxy Session Timeout + This provides a timeout (in minutes) after which a user will have to log back in. + A duration of 0 disables this feature. + + ga_code: + type: str + default: null + required: false + desc: | + You can enter tracking code here to track visitor's behavior + through your Google Analytics account. Example: UA-XXXXXXXX-Y + + display_servers: + type: str + default: hgw1.cse.ucsc.edu,hgw2.cse.ucsc.edu,hgw3.cse.ucsc.edu,hgw4.cse.ucsc.edu,hgw5.cse.ucsc.edu,hgw6.cse.ucsc.edu,hgw7.cse.ucsc.edu,hgw8.cse.ucsc.edu,lowepub.cse.ucsc.edu + required: false + desc: | + Galaxy can display data at various external browsers. These options specify + which browsers should be available. URLs and builds available at these + browsers are defined in the specifield files. + + If use_remote_user = True, display application servers will be denied access + to Galaxy and so displaying datasets in these sites will fail. + display_servers contains a list of hostnames which should be allowed to + bypass security to display datasets. Please be aware that there are security + implications if this is allowed. More details (including required changes to + the proxy server config) are available in the Apache proxy documentation on + the Galaxy Community Hub. + + The list of servers in this sample config are for the UCSC Main, Test and + Archaea browsers, but the default if left commented is to not allow any + display sites to bypass security (you must uncomment the line below to allow + them). + + enable_old_display_applications: + type: bool + default: true + required: false + desc: | + To disable the old-style display applications that are hardcoded into + datatype classes, set enable_old_display_applications = False. + This may be desirable due to using the new-style, XML-defined, display + applications that have been defined for many of the datatypes that have the + old-style. + There is also a potential security concern with the old-style applications, + where a malicious party could provide a link that appears to reference the + Galaxy server, but contains a redirect to a third-party server, tricking a + Galaxy user to access said site. + + message_box_visible: + type: bool + default: false + required: false + desc: | + Show a message box under the masthead. + + message_box_content: + type: str + default: null + required: false + desc: | + Show a message box under the masthead. + + message_box_class: + type: str + default: info + required: false + desc: | + Show a message box under the masthead. + + brand: + type: str + default: null + required: false + desc: | + Append "/{brand}" to the "Galaxy" text in the masthead. + + pretty_datetime_format: + type: str + default: $locale (UTC) + required: false + desc: | + Format string used when showing date and time information. + The string may contain: + - the directives used by Python time.strftime() function (see + https://docs.python.org/2/library/time.html#time.strftime ), + - $locale (complete format string for the server locale), + - $iso8601 (complete format string as specified by ISO 8601 international + standard). + + galaxy_infrastructure_url: + type: str + default: http://localhost:8080 + required: false + desc: | + URL (with schema http/https) of the Galaxy instance as accessible within your + local network - if specified used as a default by pulsar file staging and + Jupyter Docker container for communicating back with Galaxy via the API. + + If you are attempting to setup GIEs on Mac OS X with Docker for Mac - this + should likely be the IP address of your machine on the virtualbox network (vboxnet0) + setup for the Docker host VM. This can found by running ifconfig and using the + IP address of the network vboxnet0. + + galaxy_infrastructure_web_port: + type: int + default: 8080 + required: false + desc: | + If the above URL cannot be determined ahead of time in dynamic environments + but the port which should be used to access Galaxy can be - this should be + set to prevent Galaxy from having to guess. For example if Galaxy is sitting + behind a proxy with REMOTE_USER enabled - infrastructure shouldn't talk to + Python processes directly and this should be set to 80 or 443, etc... If + unset this file will be read for a server block defining a port corresponding + to the webapp. + + welcome_url: + type: str + default: /static/welcome.html + required: false + desc: | + The URL of the page to display in Galaxy's middle pane when loaded. This can + be an absolute or relative URL. + + logo_url: + type: str + default: / + required: false + desc: | + The URL linked by the "Galaxy/brand" text. + + wiki_url: + type: str + default: https://galaxyproject.org/ + required: false + desc: | + The URL linked by the "Wiki" link in the "Help" menu. + + support_url: + type: str + default: https://galaxyproject.org/support + required: false + desc: | + The URL linked by the "Support" link in the "Help" menu. + + citation_url: + type: str + default: https://galaxyproject.org/citing-galaxy + required: false + desc: | + The URL linked by the "How to Cite Galaxy" link in the "Help" menu. + + search_url: + type: str + default: https://galaxyproject.org/search/ + required: false + desc: | + The URL linked by the "Search" link in the "Help" menu. + + mailing_lists_url: + type: str + default: https://galaxyproject.org/mailing-lists + required: false + desc: | + The URL linked by the "Mailing Lists" link in the "Help" menu. + + screencasts_url: + type: str + default: https://vimeo.com/galaxyproject + required: false + desc: | + The URL linked by the "Videos" link in the "Help" menu. + + genomespace_ui_url: + type: str + default: https://gsui.genomespace.org/jsui/ + required: false + desc: | + Points to the GenomeSpace UI service which will be used by + the GenomeSpace importer and exporter tools + + terms_url: + type: str + default: null + required: false + desc: | + The URL linked by the "Terms and Conditions" link in the "Help" menu, as well + as on the user registration and login forms and in the activation emails. + + qa_url: + type: str + required: false + desc: | + The URL linked by the "Galaxy Q&A" link in the "Help" menu + The Galaxy Q&A site is under development; when the site is done, this URL + will be set and uncommented. + + static_enabled: + type: bool + default: true + required: false + desc: | + Serve static content, which must be enabled if you're not serving it via a + proxy server. These options should be self explanatory and so are not + documented individually. You can use these paths (or ones in the proxy + server) to point to your own styles. + + static_cache_time: + type: int + default: 360 + required: false + desc: | + Serve static content, which must be enabled if you're not serving it via a + proxy server. These options should be self explanatory and so are not + documented individually. You can use these paths (or ones in the proxy + server) to point to your own styles. + + static_dir: + type: str + default: static/ + required: false + desc: | + Serve static content, which must be enabled if you're not serving it via a + proxy server. These options should be self explanatory and so are not + documented individually. You can use these paths (or ones in the proxy + server) to point to your own styles. + + static_images_dir: + type: str + default: static/images + required: false + desc: | + Serve static content, which must be enabled if you're not serving it via a + proxy server. These options should be self explanatory and so are not + documented individually. You can use these paths (or ones in the proxy + server) to point to your own styles. + + static_favicon_dir: + type: str + default: static/favicon.ico + required: false + desc: | + Serve static content, which must be enabled if you're not serving it via a + proxy server. These options should be self explanatory and so are not + documented individually. You can use these paths (or ones in the proxy + server) to point to your own styles. + + static_scripts_dir: + type: str + default: static/scripts/ + required: false + desc: | + Serve static content, which must be enabled if you're not serving it via a + proxy server. These options should be self explanatory and so are not + documented individually. You can use these paths (or ones in the proxy + server) to point to your own styles. + + static_style_dir: + type: str + default: static/june_2007_style/blue + required: false + desc: | + Serve static content, which must be enabled if you're not serving it via a + proxy server. These options should be self explanatory and so are not + documented individually. You can use these paths (or ones in the proxy + server) to point to your own styles. + + static_robots_txt: + type: str + default: static/robots.txt + required: false + desc: | + Serve static content, which must be enabled if you're not serving it via a + proxy server. These options should be self explanatory and so are not + documented individually. You can use these paths (or ones in the proxy + server) to point to your own styles. + + display_chunk_size: + type: int + default: 65536 + required: false + desc: | + Incremental Display Options + + apache_xsendfile: + type: bool + default: false + required: false + desc: | + For help on configuring the Advanced proxy features, see: + http://usegalaxy.org/production + + Apache can handle file downloads (Galaxy-to-user) via mod_xsendfile. Set + this to True to inform Galaxy that mod_xsendfile is enabled upstream. + + nginx_x_accel_redirect_base: + type: bool + default: false + required: false + desc: | + The same download handling can be done by nginx using X-Accel-Redirect. This + should be set to the path defined in the nginx config as an internal redirect + with access to Galaxy's data files (see documentation linked above). + + nginx_x_archive_files_base: + type: bool + default: false + required: false + desc: | + nginx can make use of mod_zip to create zip files containing multiple library + files. If using X-Accel-Redirect, this can be the same value as that option. + + upstream_gzip: + type: bool + default: false + required: false + desc: | + If using compression in the upstream proxy server, use this option to disable + gzipping of library .tar.gz and .zip archives, since the proxy server will do + it faster on the fly. + + x_frame_options: + type: str + default: SAMEORIGIN + required: false + desc: | + The following default adds a header to web request responses that + will cause modern web browsers to not allow Galaxy to be embedded in + the frames of web applications hosted at other hosts - this can help + prevent a class of attack called clickjacking + (https://www.owasp.org/index.php/Clickjacking). If you configure a + proxy in front of Galaxy - please ensure this header remains intact + to protect your users. Uncomment and leave empty to not set the + `X-Frame-Options` header. + + nginx_upload_store: + type: bool + default: false + required: false + desc: | + nginx can also handle file uploads (user-to-Galaxy) via nginx_upload_module. + Configuration for this is complex and explained in detail in the + documentation linked above. The upload store is a temporary directory in + which files uploaded by the upload module will be placed. + + nginx_upload_path: + type: bool + default: false + required: false + desc: | + This value overrides the action set on the file upload form, e.g. the web + path where the nginx_upload_module has been configured to intercept upload + requests. + + nginx_upload_job_files_store: + type: bool + default: false + required: false + desc: | + Galaxy can also use nginx_upload_module to receive files staged out upon job + completion by remote job runners (i.e. Pulsar) that initiate staging + operations on the remote end. See the Galaxy nginx documentation for the + corresponding nginx configuration. + + nginx_upload_job_files_path: + type: bool + default: false + required: false + desc: | + Galaxy can also use nginx_upload_module to receive files staged out upon job + completion by remote job runners (i.e. Pulsar) that initiate staging + operations on the remote end. See the Galaxy nginx documentation for the + corresponding nginx configuration. + + dynamic_proxy_manage: + type: bool + default: true + required: false + desc: | + Have Galaxy manage dynamic proxy component for routing requests to other + services based on Galaxy's session cookie. It will attempt to do this by + default though you do need to install node+npm and do an npm install from + `lib/galaxy/web/proxy/js`. It is generally more robust to configure this + externally, managing it however Galaxy is managed. If True, Galaxy will only + launch the proxy if it is actually going to be used (e.g. for Jupyter). + + dynamic_proxy: + type: str + default: node + required: false + desc: | + As of 16.04 Galaxy supports multiple proxy types. The original NodeJS + implementation, alongside a new Golang single-binary-no-dependencies + version. Valid values are (node, golang) + + dynamic_proxy_session_map: + type: str + default: database/session_map.sqlite + required: false + desc: | + The NodeJS dynamic proxy can use an SQLite database or a JSON file for IPC, + set that here. + + dynamic_proxy_bind_port: + type: int + default: 8800 + required: false + desc: | + Set the port and IP for the the dynamic proxy to bind to, this must match + the external configuration if dynamic_proxy_manage is False. + + dynamic_proxy_bind_ip: + type: str + default: 0.0.0.0 + required: false + desc: | + Set the port and IP for the the dynamic proxy to bind to, this must match + the external configuration if dynamic_proxy_manage is False. + + dynamic_proxy_debug: + type: bool + default: false + required: false + desc: | + Enable verbose debugging of Galaxy-managed dynamic proxy. + + dynamic_proxy_external_proxy: + type: bool + default: false + required: false + desc: | + The dynamic proxy is proxied by an external proxy (e.g. apache frontend to + nodejs to wrap connections in SSL). + + dynamic_proxy_prefix: + type: str + default: gie_proxy + required: false + desc: | + Additionally, when the dynamic proxy is proxied by an upstream server, you'll + want to specify a prefixed URL so both Galaxy and the proxy reside under the + same path that your cookies are under. This will result in a url like + https://FQDN/galaxy-prefix/gie_proxy for proxying + + dynamic_proxy_golang_noaccess: + type: int + default: 60 + required: false + desc: | + This attribute governs the minimum length of time between consecutive HTTP/WS + requests through the proxy, before the proxy considers a container as being + inactive and kills it. + + dynamic_proxy_golang_clean_interval: + type: int + default: 10 + required: false + desc: | + In order to kill containers, the golang proxy has to check at some interval + for possibly dead containers. This is exposed as a configurable parameter, + but the default value is probably fine. + + dynamic_proxy_golang_docker_address: + type: str + default: unix:///var/run/docker.sock + required: false + desc: | + The golang proxy needs to know how to talk to your docker daemon. Currently + TLS is not supported, that will come in an update. + + dynamic_proxy_golang_api_key: + type: str + default: null + required: false + desc: | + The golang proxy uses a RESTful HTTP API for communication with Galaxy + instead of a JSON or SQLite file for IPC. If you do not specify this, it will + be set randomly for you. You should set this if you are managing the proxy + manually. + + auto_configure_logging: + type: bool + default: true + required: false + desc: | + If True, Galaxy will attempt to configure a simple root logger if a + "loggers" section does not appear in this configuration file. + + log_level: + type: str + default: DEBUG + required: false + desc: | + Verbosity of console log messages. Acceptable values can be found here: + https://docs.python.org/2/library/logging.html#logging-levels + A custom debug level of "TRACE" is available for even more verbosity. + + database_engine_option_echo: + type: bool + default: false + required: false + desc: | + Print database operations to the server log (warning, quite verbose!). + + database_engine_option_echo_pool: + type: bool + default: false + required: false + desc: | + Print database pool operations to the server log (warning, quite verbose!). + + log_events: + type: bool + default: true + required: false + desc: | + Turn on logging of application events and some user events to the database. + + log_actions: + type: bool + default: true + required: false + desc: | + Turn on logging of user actions to the database. Actions currently logged + are grid views, tool searches, and use of "recently" used tools menu. The + log_events and log_actions functionality will eventually be merged. + + fluent_log: + type: bool + default: false + required: false + desc: | + Fluentd configuration. Various events can be logged to the fluentd instance + configured below by enabling fluent_log. + + fluent_host: + type: str + default: localhost + required: false + desc: | + Fluentd configuration. Various events can be logged to the fluentd instance + configured below by enabling fluent_log. + + fluent_port: + type: int + default: 24224 + required: false + desc: | + Fluentd configuration. Various events can be logged to the fluentd instance + configured below by enabling fluent_log. + + sanitize_all_html: + type: bool + default: true + required: false + desc: | + Sanitize all HTML tool output. By default, all tool output served as + 'text/html' will be sanitized thoroughly. This can be disabled if you have + special tools that require unaltered output. WARNING: disabling this does + make the Galaxy instance susceptible to XSS attacks initiated by your users. + + sanitize_whitelist_file: + type: str + default: config/sanitize_whitelist.txt + required: false + desc: | + Whitelist sanitization file. + Datasets created by tools listed in this file are trusted and will not have + their HTML sanitized on display. This can be manually edited or manipulated + through the Admin control panel -- see "Manage Display Whitelist" + + serve_xss_vulnerable_mimetypes: + type: bool + default: false + required: false + desc: | + By default Galaxy will serve non-HTML tool output that may potentially + contain browser executable JavaScript content as plain text. This will for + instance cause SVG datasets to not render properly and so may be disabled + by setting the following option to True. + + allowed_origin_hostnames: + type: str + default: null + required: false + desc: | + Return a Access-Control-Allow-Origin response header that matches the Origin + header of the request if that Origin hostname matches one of the strings or + regular expressions listed here. This is a comma separated list of hostname + strings or regular expressions beginning and ending with /. + E.g. mysite.com,google.com,usegalaxy.org,/^[\w\.]*example\.com/ + See: https://developer.mozilla.org/en-US/docs/Web/HTTP/Access_control_CORS + + trust_jupyter_notebook_conversion: + type: bool + default: false + required: false + desc: | + Set the following to True to use Jupyter nbconvert to build HTML from Jupyter + notebooks in Galaxy histories. This process may allow users to execute + arbitrary code or serve arbitrary HTML. If enabled, Jupyter must be + available and on Galaxy's PATH, to do this run + `pip install jinja2 pygments jupyter` in Galaxy's virtualenv. + + debug: + type: bool + default: false + required: false + desc: | + Debug enables access to various config options useful for development and + debugging: use_lint, use_profile, use_printdebug and use_interactive. It + also causes the files used by PBS/SGE (submission script, output, and error) + to remain on disk after the job is complete. + + use_lint: + type: bool + default: false + required: false + desc: | + Check for WSGI compliance. + + use_profile: + type: bool + default: false + required: false + desc: | + Run the Python profiler on each request. + + use_printdebug: + type: bool + default: true + required: false + desc: | + Intercept print statements and show them on the returned page. + + use_interactive: + type: bool + default: true + required: false + desc: | + Enable live debugging in your browser. This should NEVER be enabled on a + public site. Enabled in the sample config for development. + + monitor_thread_join_timeout: + type: int + default: 5 + required: false + desc: | + When stopping Galaxy cleanly, how much time to give various monitoring/polling + threads to finish before giving up on joining them. Set to 0 to disable this and + restore the pre-18.01 default behavior. + + use_heartbeat: + type: bool + default: false + required: false + desc: | + Write thread status periodically to 'heartbeat.log', (careful, uses disk + space rapidly!). Useful to determine why your processes may be consuming a + lot of CPU. + + heartbeat_interval: + type: int + default: 20 + required: false + desc: | + Control the period (in seconds) between dumps. Use -1 to disable. Regardless + of this setting, if use_heartbeat is enabled, you can send a Galaxy process + (unless running with uWSGI) SIGUSR1 (`kill -USR1`) to force a dump. + + heartbeat_log: + type: str + default: heartbeat_{server_name}.log + required: false + desc: | + Heartbeat log filename. Can accept the template variables {server_name} and + {pid} + + sentry_dsn: + type: str + default: null + required: false + desc: | + Log to Sentry + Sentry is an open source logging and error aggregation platform. Setting + sentry_dsn will enable the Sentry middleware and errors will be sent to the + indicated sentry instance. This connection string is available in your + sentry instance under -> Settings -> API Keys. + + statsd_host: + type: str + required: false + desc: | + Log to statsd + Statsd is an external statistics aggregator (https://github.com/etsy/statsd) + Enabling the following options will cause galaxy to log request timing and + other statistics to the configured statsd instance. The statsd_prefix is + useful if you are running multiple Galaxy instances and want to segment + statistics between them within the same aggregator. + + statsd_port: + type: int + default: 8125 + required: false + desc: | + Log to statsd + Statsd is an external statistics aggregator (https://github.com/etsy/statsd) + Enabling the following options will cause galaxy to log request timing and + other statistics to the configured statsd instance. The statsd_prefix is + useful if you are running multiple Galaxy instances and want to segment + statistics between them within the same aggregator. + + statsd_prefix: + type: str + default: galaxy + required: false + desc: | + Log to statsd + Statsd is an external statistics aggregator (https://github.com/etsy/statsd) + Enabling the following options will cause galaxy to log request timing and + other statistics to the configured statsd instance. The statsd_prefix is + useful if you are running multiple Galaxy instances and want to segment + statistics between them within the same aggregator. + + graphite_host: + type: str + required: false + desc: | + Log to graphite + Graphite is an external statistics aggregator (https://github.com/graphite-project/carbon) + Enabling the following options will cause galaxy to log request timing and + other statistics to the configured graphite instance. The graphite_prefix is + useful if you are running multiple Galaxy instances and want to segment + statistics between them within the same aggregator. + + graphite_port: + type: int + default: 2003 + required: false + desc: | + Log to graphite + Graphite is an external statistics aggregator (https://github.com/graphite-project/carbon) + Enabling the following options will cause galaxy to log request timing and + other statistics to the configured graphite instance. The graphite_prefix is + useful if you are running multiple Galaxy instances and want to segment + statistics between them within the same aggregator. + + graphite_prefix: + type: str + default: galaxy + required: false + desc: | + Log to graphite + Graphite is an external statistics aggregator (https://github.com/graphite-project/carbon) + Enabling the following options will cause galaxy to log request timing and + other statistics to the configured graphite instance. The graphite_prefix is + useful if you are running multiple Galaxy instances and want to segment + statistics between them within the same aggregator. + + library_import_dir: + type: str + default: null + required: false + desc: | + Add an option to the library upload form which allows administrators to + upload a directory of files. + + user_library_import_dir: + type: str + default: null + required: false + desc: | + Add an option to the library upload form which allows authorized + non-administrators to upload a directory of files. The configured directory + must contain sub-directories named the same as the non-admin user's Galaxy + login ( email ). The non-admin user is restricted to uploading files or + sub-directories of files contained in their directory. + + user_library_import_symlink_whitelist: + type: str + default: null + required: false + desc: | + For security reasons, users may not import any files that actually lie + outside of their `user_library_import_dir` (e.g. using symbolic links). A + list of directories can be allowed by setting the following option (the list + is comma-separated). Be aware that *any* user with library import permissions + can import from anywhere in these directories (assuming they are able to + create symlinks to them). + + allow_path_paste: + type: bool + default: false + required: false + desc: | + Allow admins to paste filesystem paths during upload. For libraries this + adds an option to the admin library upload tool allowing admins to paste + filesystem paths to files and directories in a box, and these paths will be + added to a library. For history uploads, this allows pasting in paths as URIs. + (i.e. prefixed with file://). Set to True to enable. Please note the security + implication that this will give Galaxy Admins access to anything your Galaxy + user has access to. + + disable_library_comptypes: + type: str + required: false + desc: | + Users may choose to download multiple files from a library in an archive. By + default, Galaxy allows users to select from a few different archive formats + if testing shows that Galaxy is able to create files using these formats. + Specific formats can be disabled with this option, separate more than one + format with commas. Available formats are currently 'zip', 'gz', and 'bz2'. + + transfer_manager_port: + type: int + default: 8163 + required: false + desc: | + Some sequencer integration features in beta allow you to automatically + transfer datasets. This is done using a lightweight transfer manager which + runs outside of Galaxy (but is spawned by it automatically). Galaxy will + communicate with this manager over the port specified here. + + tool_name_boost: + type: float + default: 9 + required: false + desc: | + Boosts are used to customize this instance's toolbox search. + The higher the boost, the more importance the scoring algorithm gives to the + given field. Section refers to the tool group in the tool panel. Rest of + the fields are tool's attributes. + + tool_section_boost: + type: float + default: 3 + required: false + desc: | + Boosts are used to customize this instance's toolbox search. + The higher the boost, the more importance the scoring algorithm gives to the + given field. Section refers to the tool group in the tool panel. Rest of + the fields are tool's attributes. + + tool_description_boost: + type: float + default: 2 + required: false + desc: | + Boosts are used to customize this instance's toolbox search. + The higher the boost, the more importance the scoring algorithm gives to the + given field. Section refers to the tool group in the tool panel. Rest of + the fields are tool's attributes. + + tool_label_boost: + type: float + default: 1 + required: false + desc: | + Boosts are used to customize this instance's toolbox search. + The higher the boost, the more importance the scoring algorithm gives to the + given field. Section refers to the tool group in the tool panel. Rest of + the fields are tool's attributes. + + tool_stub_boost: + type: float + default: 5 + required: false + desc: | + Boosts are used to customize this instance's toolbox search. + The higher the boost, the more importance the scoring algorithm gives to the + given field. Section refers to the tool group in the tool panel. Rest of + the fields are tool's attributes. + + tool_help_boost: + type: float + default: 0.5 + required: false + desc: | + Boosts are used to customize this instance's toolbox search. + The higher the boost, the more importance the scoring algorithm gives to the + given field. Section refers to the tool group in the tool panel. Rest of + the fields are tool's attributes. + + tool_search_limit: + type: int + default: 20 + required: false + desc: | + Limits the number of results in toolbox search. Can be used to tweak how many + results will appear. + + tool_enable_ngram_search: + type: bool + default: false + required: false + desc: | + Enable/ disable Ngram-search for tools. It makes tool + search results tolerant for spelling mistakes in the query + by dividing the query into multiple ngrams and search for + each ngram + + tool_ngram_minsize: + type: int + default: 3 + required: false + desc: | + Set minimum size of ngrams + + tool_ngram_maxsize: + type: int + default: 4 + required: false + desc: | + Set maximum size of ngrams + + id_secret: + type: str + default: USING THE DEFAULT IS NOT SECURE! + required: false + desc: | + Galaxy encodes various internal values when these values will be output in + some format (for example, in a URL or cookie). You should set a key to be + used by the algorithm that encodes and decodes these values. It can be any + string up to 448 bits long. + One simple way to generate a value for this is with the shell command: + python -c 'import time; print time.time()' | md5sum | cut -f 1 -d ' ' + + use_remote_user: + type: bool + default: false + required: false + desc: | + User authentication can be delegated to an upstream proxy server (usually + Apache). The upstream proxy should set a REMOTE_USER header in the request. + Enabling remote user disables regular logins. For more information, see: + https://galaxyproject.org/admin/config/apache-proxy + + remote_user_maildomain: + type: str + default: null + required: false + desc: | + If use_remote_user is enabled and your external authentication + method just returns bare usernames, set a default mail domain to be appended + to usernames, to become your Galaxy usernames (email addresses). + + remote_user_header: + type: str + default: HTTP_REMOTE_USER + required: false + desc: | + If use_remote_user is enabled, the header that the upstream proxy provides + the remote username in defaults to HTTP_REMOTE_USER (the 'HTTP_' is prepended + by WSGI). This option allows you to change the header. Note, you still need + to prepend 'HTTP_' to the header in this option, but your proxy server should + *not* include 'HTTP_' at the beginning of the header name. + + remote_user_secret: + type: str + default: USING THE DEFAULT IS NOT SECURE! + required: false + desc: | + If use_remote_user is enabled, anyone who can log in to the Galaxy host may + impersonate any other user by simply sending the appropriate header. Thus a + secret shared between the upstream proxy server, and Galaxy is required. + If anyone other than the Galaxy user is using the server, then apache/nginx + should pass a value in the header 'GX_SECRET' that is identical to the one + below. + + remote_user_logout_href: + type: str + default: null + required: false + desc: | + If use_remote_user is enabled, you can set this to a URL that will log your + users out. + + normalize_remote_user_email: + type: bool + default: false + required: false + desc: | + If your proxy and/or authentication source does not normalize e-mail + addresses or user names being passed to Galaxy - set the following option + to True to force these to lower case. + + single_user: + type: str + required: false + desc: | + If an e-mail address is specified here, it will hijack remote user mechanics + (``use_remote_user``) and have the webapp inject a single fixed user. This + has the effect of turning Galaxy into a single user application with no + login or external proxy required. Such applications should not be exposed to + the world. + + admin_users: + type: str + default: null + required: false + desc: | + Administrative users - set this to a comma-separated list of valid Galaxy + users (email addresses). These users will have access to the Admin section + of the server, and will have access to create users, groups, roles, + libraries, and more. For more information, see: + https://galaxyproject.org/admin/ + + require_login: + type: bool + default: false + required: false + desc: | + Force everyone to log in (disable anonymous access). + + show_welcome_with_login: + type: bool + default: false + required: false + desc: | + Show the site's welcome page (see welcome_url) alongside the login page + (even if require_login is True) + + allow_user_creation: + type: bool + default: true + required: false + desc: | + Allow unregistered users to create new accounts (otherwise, they will have to + be created by an admin). + + allow_user_deletion: + type: bool + default: false + required: false + desc: | + Allow administrators to delete accounts. + + allow_user_impersonation: + type: bool + default: false + required: false + desc: | + Allow administrators to log in as other users (useful for debugging) + + allow_user_dataset_purge: + type: bool + default: true + required: false + desc: | + Allow users to remove their datasets from disk immediately (otherwise, + datasets will be removed after a time period specified by an administrator in + the cleanup scripts run via cron) + + new_user_dataset_access_role_default_private: + type: bool + default: false + required: false + desc: | + By default, users' data will be public, but setting this to True will cause + it to be private. Does not affect existing users and data, only ones created + after this option is set. Users may still change their default back to + public. + + expose_user_name: + type: bool + default: false + required: false + desc: | + Expose user list. Setting this to True will expose the user list to + authenticated users. This makes sharing datasets in smaller galaxy instances + much easier as they can type a name/email and have the correct user show up. + This makes less sense on large public Galaxy instances where that data + shouldn't be exposed. For semi-public Galaxies, it may make sense to expose + just the username and not email, or vice versa. + + expose_user_email: + type: bool + default: false + required: false + desc: | + Expose user list. Setting this to True will expose the user list to + authenticated users. This makes sharing datasets in smaller galaxy instances + much easier as they can type a name/email and have the correct user show up. + This makes less sense on large public Galaxy instances where that data + shouldn't be exposed. For semi-public Galaxies, it may make sense to expose + just the username and not email, or vice versa. + + fetch_url_whitelist: + type: str + required: false + desc: | + Whitelist for local network addresses for "Upload from URL" dialog. + By default, Galaxy will deny access to the local network address space, to + prevent users making requests to services which the administrator did not + intend to expose. Previously, you could request any network service that + Galaxy might have had access to, even if the user could not normally access it. + It should be a comma separated list of IP addresses or IP address/mask, e.g. + 10.10.10.10,10.0.1.0/24,fd00::/8 + + enable_beta_ts_api_install: + type: bool + default: true + required: false + desc: | + Enable the new interface for installing tools from Tool Shed + via the API. Admin menu will list both if enabled. + + enable_beta_containers_interface: + type: bool + default: false + required: false + desc: | + Enable the new container interface for Interactive Environments + + tool_submission_burst_threads: + type: int + default: 1 + required: false + desc: | + Set the following to a number of threads greater than 1 to spawn + a Python task queue for dealing with large tool submissions (either + through the tool form or as part of an individual workflow step across + large collection). This affects workflow scheduling and web processes, + not job handlers. This is a beta option and should not be used in production. + + tool_submission_burst_at: + type: int + default: 10 + required: false + desc: | + If tool_submission_burst_threads is set to a number greater than 1, this + is the number of jobs to schedule at which the task queue will be created. + + enable_beta_workflow_modules: + type: bool + default: false + required: false + desc: | + Enable beta workflow modules that should not yet be considered part of Galaxy's + stable API. + + force_beta_workflow_scheduled_min_steps: + type: int + default: 250 + required: false + desc: | + Following options only apply to workflows scheduled using the legacy workflow + run API (running workflows via a POST to /api/workflows). + Force usage of Galaxy's beta workflow scheduler under certain circumstances - + this workflow scheduling forces Galaxy to schedule workflows in the background + so initial submission of the workflows is significantly sped up. This does + however force the user to refresh their history manually to see newly scheduled + steps (for "normal" workflows - steps are still scheduled far in advance of + them being queued and scheduling here doesn't refer to actual cluster job + scheduling). + Workflows containing more than the specified number of steps will always use + the Galaxy's beta workflow scheduling. + + force_beta_workflow_scheduled_for_collections: + type: bool + default: false + required: false + desc: | + Following options only apply to workflows scheduled using the legacy workflow + run API (running workflows via a POST to /api/workflows). + Force usage of Galaxy's beta workflow scheduler under certain circumstances - + this workflow scheduling forces Galaxy to schedule workflows in the background + so initial submission of the workflows is significantly sped up. This does + however force the user to refresh their history manually to see newly scheduled + steps (for "normal" workflows - steps are still scheduled far in advance of + them being queued and scheduling here doesn't refer to actual cluster job + scheduling). + Workflows containing more than the specified number of steps will always use + the Galaxy's beta workflow scheduling. + Switch to using Galaxy's beta workflow scheduling for all workflows involving + collections. + + parallelize_workflow_scheduling_within_histories: + type: bool + default: false + required: false + desc: | + If multiple job handlers are enabled, allow Galaxy to schedule workflow invocations + in multiple handlers simultaneously. This is discouraged because it results in a + less predictable order of workflow datasets within in histories. + + maximum_workflow_invocation_duration: + type: int + default: 2678400 + required: false + desc: | + This is the maximum amount of time a workflow invocation may stay in an active + scheduling state in seconds. Set to -1 to disable this maximum and allow any workflow + invocation to schedule indefinitely. The default corresponds to 1 month. + + maximum_workflow_jobs_per_scheduling_iteration: + type: str + default: -1 + required: false + desc: | + Specify a maximum number of jobs that any given workflow scheduling iteration can create. + Set this to a positive integer to prevent large collection jobs in a workflow from + preventing other jobs from executing. This may also mitigate memory issues associated with + scheduling workflows at the expense of increased total DB traffic because model objects + are expunged from the SQL alchemy session between workflow invocation scheduling iterations. + Set to -1 to disable any such maximum (the default). + + history_local_serial_workflow_scheduling: + type: bool + default: false + required: false + desc: | + Force serial scheduling of workflows within the context of a particular history + + enable_openid: + type: bool + default: false + required: false + desc: | + Enable authentication via OpenID. Allows users to log in to their Galaxy + account by authenticating with an OpenID provider. + + openid_config_file: + type: str + default: config/openid_conf.xml + required: false + desc: | + If OpenID is enabled, this configuration file specifies providers to use. + Falls back to the .sample variant in config if default does not exist. + + openid_consumer_cache_path: + type: str + default: database/openid_consumer_cache + required: false + desc: | + If OpenID is enabled, consumer cache directory to use. + + auth_config_file: + type: str + default: config/auth_conf.xml + required: false + desc: | + XML config file that allows the use of different authentication providers + (e.g. LDAP) instead or in addition to local authentication (.sample is used + if default does not exist). + + api_allow_run_as: + type: str + default: null + required: false + desc: | + Optional list of email addresses of API users who can make calls on behalf of + other users. + + master_api_key: + type: str + default: changethis + required: false + desc: | + Master key that allows many API admin actions to be used without actually + having a defined admin user in the database/config. Only set this if you + need to bootstrap Galaxy, you probably do not want to set this on public + servers. + + enable_tool_tags: + type: bool + default: false + required: false + desc: | + Enable tool tags (associating tools with tags). This has its own option + since its implementation has a few performance implications on startup for + large servers. + + enable_unique_workflow_defaults: + type: bool + default: false + required: false + desc: | + Enable a feature when running workflows. When enabled, default datasets + are selected for "Set at Runtime" inputs from the history such that the + same input will not be selected twice, unless there are more inputs than + compatible datasets in the history. + When False, the most recently added compatible item in the history will + be used for each "Set at Runtime" input, independent of others in the Workflow + + myexperiment_url: + type: str + default: www.myexperiment.org:80 + required: false + desc: | + The URL to the myExperiment instance being used (omit scheme but include port) + + ftp_upload_dir: + type: str + default: null + required: false + desc: | + Enable Galaxy's "Upload via FTP" interface. You'll need to install and + configure an FTP server (we've used ProFTPd since it can use Galaxy's + database for authentication) and set the following two options. + This should point to a directory containing subdirectories matching users' + identifier (defaults to e-mail), where Galaxy will look for files. + + ftp_upload_site: + type: str + default: null + required: false + desc: | + This should be the hostname of your FTP server, which will be provided to + users in the help text. + + ftp_upload_dir_identifier: + type: str + default: email + required: false + desc: | + User attribute to use as subdirectory in calculating default ftp_upload_dir + pattern. By default this will be email so a user's FTP upload directory will be + ${ftp_upload_dir}/${user.email}. Can set this to other attributes such as id or + username though. + + ftp_upload_dir_template: + type: str + default: ${ftp_upload_dir}/${ftp_upload_dir_identifier} + required: false + desc: | + Python string template used to determine an FTP upload directory for a + particular user. + + ftp_upload_purge: + type: bool + default: true + required: false + desc: | + This should be set to False to prevent Galaxy from deleting uploaded FTP files + as it imports them. + + enable_quotas: + type: bool + default: false + required: false + desc: | + Enable enforcement of quotas. Quotas can be set from the Admin interface. + + expose_dataset_path: + type: bool + default: false + required: false + desc: | + This option allows users to see the full path of datasets via the "View + Details" option in the history. This option also exposes the command line to + non-administrative users. Administrators can always see dataset paths. + + expose_potentially_sensitive_job_metrics: + type: bool + default: false + required: false + desc: | + This option allows users to see the job metrics (except for environment + variables). + + enable_legacy_sample_tracking_api: + type: bool + default: false + required: false + desc: | + Enable the API for sample tracking + + enable_data_manager_user_view: + type: bool + default: false + required: false + desc: | + Allow non-admin users to view available Data Manager options. + + data_manager_config_file: + type: str + default: config/data_manager_conf.xml + required: false + desc: | + File where Data Managers are configured (.sample used if default does not + exist). + + shed_data_manager_config_file: + type: str + default: config/shed_data_manager_conf.xml + required: false + desc: | + File where Tool Shed based Data Managers are configured. + + galaxy_data_manager_data_path: + type: str + default: tool-data + required: false + desc: | + Directory to store Data Manager based tool-data; defaults to tool_data_path. + + job_config_file: + type: str + default: config/job_conf.xml + required: false + desc: | + To increase performance of job execution and the web interface, you can + separate Galaxy into multiple processes. There are more than one way to do + this, and they are explained in detail in the documentation: + + https://galaxyproject.org/admin/config/performance/scaling + + By default, Galaxy manages and executes jobs from within a single process and + notifies itself of new jobs via in-memory queues. Jobs are run locally on + the system on which Galaxy is started. Advanced job running capabilities can + be configured through the job configuration file. + + default_job_resubmission_condition: + type: str + required: false + desc: | + When jobs fail due to job runner problems, Galaxy can be configured to retry + these or reroute the jobs to new destinations. Very fine control of this is + available with resubmit declarations in job_conf.xml. For simple deployments + of Galaxy though, the following attribute can define resubmission conditions + for all job destinations. If any job destination defines even one + resubmission condition explicitly in job_conf.xml - the condition described + by this option will not apply to that destination. For instance, the condition: + 'attempt < 3 and unknown_error and (time_running < 300 or time_since_queued < 300)' + would retry up to two times jobs that didn't fail due to detected memory or + walltime limits but did fail quickly (either while queueing or running). The + commented out default below results in no default job resubmission condition, + failing jobs are just failed outright. + + track_jobs_in_database: + type: bool + default: true + required: false + desc: | + In multiprocess configurations, notification between processes about new jobs + must be done via the database. In single process configurations, this can be + done in memory, which is a bit quicker. + + use_tasked_jobs: + type: bool + default: false + required: false + desc: | + This enables splitting of jobs into tasks, if specified by the particular tool + config. + This is a new feature and not recommended for production servers yet. + + local_task_queue_workers: + type: int + default: 2 + required: false + desc: | + This enables splitting of jobs into tasks, if specified by the particular tool + config. + This is a new feature and not recommended for production servers yet. + + enable_job_recovery: + type: bool + default: true + required: false + desc: | + Enable job recovery (if Galaxy is restarted while cluster jobs are running, + it can "recover" them when it starts). This is not safe to use if you are + running more than one Galaxy server using the same database. + + retry_metadata_internally: + type: bool + default: true + required: false + desc: | + Although it is fairly reliable, setting metadata can occasionally fail. In + these instances, you can choose to retry setting it internally or leave it in + a failed state (since retrying internally may cause the Galaxy process to be + unresponsive). If this option is set to False, the user will be given the + option to retry externally, or set metadata manually (when possible). + + max_metadata_value_size: + type: int + default: 5242880 + required: false + desc: | + Very large metadata values can cause Galaxy crashes. This will allow + limiting the maximum metadata key size (in bytes used in memory, not the end + result database value size) Galaxy will attempt to save with a dataset. Use + 0 to disable this feature. The default is 5MB, but as low as 1MB seems to be + a reasonable size. + + outputs_to_working_directory: + type: bool + default: false + required: false + desc: | + If (for example) you run on a cluster and your datasets (by default, + database/files/) are mounted read-only, this option will override tool output + paths to write outputs to the working directory instead, and the job manager + will move the outputs to their proper place in the dataset directory on the + Galaxy server after the job completes. + + retry_job_output_collection: + type: int + default: 0 + required: false + desc: | + If your network filesystem's caching prevents the Galaxy server from seeing + the job's stdout and stderr files when it completes, you can retry reading + these files. The job runner will retry the number of times specified below, + waiting 1 second between tries. For NFS, you may want to try the -noac mount + option (Linux) or -actimeo=0 (Solaris). + + preserve_python_environment: + type: str + default: legacy_only + required: false + desc: | + In the past Galaxy would preserve its Python environment when running jobs ( + and still does for internal tools packaged with Galaxy). This behavior exposes + Galaxy internals to tools and could result in problems when activating + Python environments for tools (such as with Conda packaging). The default + legacy_only will restrict this behavior to tools identified by the Galaxy + team as requiring this environment. Set this to "always" to restore the + previous behavior (and potentially break Conda dependency resolution for many + tools). Set this to legacy_and_local to preserve the environment for legacy + tools and locally managed tools (this might be useful for instance if you are + installing software into Galaxy's virtualenv for tool development). + + cleanup_job: + type: str + default: always + required: false + desc: | + Clean up various bits of jobs left on the filesystem after completion. These + bits include the job working directory, external metadata temporary files, + and DRM stdout and stderr files (if using a DRM). Possible values are: + always, onsuccess, never + + drmaa_external_runjob_script: + type: str + default: sudo -E scripts/drmaa_external_runner.py --assign_all_groups + required: false + desc: | + When running DRMAA jobs as the Galaxy user + (https://galaxyproject.org/admin/config/performance/cluster/#submitting-jobs-as-the-real-user) + this script is used to run the job script Galaxy generates for a tool execution. + + drmaa_external_killjob_script: + type: str + default: sudo -E scripts/drmaa_external_killer.py + required: false + desc: | + When running DRMAA jobs as the Galaxy user + (https://galaxyproject.org/admin/config/performance/cluster/#submitting-jobs-as-the-real-user) + this script is used to kill such jobs by Galaxy (e.g. if the user cancels + the job). + + external_chown_script: + type: str + default: sudo -E scripts/external_chown_script.py + required: false + desc: | + When running DRMAA jobs as the Galaxy user + (https://galaxyproject.org/admin/config/performance/cluster/#submitting-jobs-as-the-real-user) + this script is used transfer permissions back and forth between the Galaxy user + and the user that is running the job. + + real_system_username: + type: str + default: user_email + required: false + desc: | + When running DRMAA jobs as the Galaxy user + (https://galaxyproject.org/admin/config/performance/cluster/#submitting-jobs-as-the-real-user) + Galaxy can extract the user name from the email address (actually the local-part before the @) + or the username which are both stored in the Galaxy data base. + The latter option is particularly useful for installations that get the + authentication from LDAP. + Also, Galaxy can accept the name of a common system user (eg. galaxy_worker) + who can run every job being submitted. This user should not be the same user + running the galaxy system. + Possible values are user_email (default), username or + + environment_setup_file: + type: str + default: null + required: false + desc: | + File to source to set up the environment when running jobs. By default, the + environment in which the Galaxy server starts is used when running jobs + locally, and the environment set up per the DRM's submission method and + policy is used when running jobs on a cluster (try testing with `qsub` on the + command line). environment_setup_file can be set to the path of a file on + the cluster that should be sourced by the user to set up the environment + prior to running tools. This can be especially useful for running jobs as + the actual user, to remove the need to configure each user's environment + individually. + + job_resource_params_file: + type: str + default: config/job_resource_params_conf.xml + required: false + desc: | + Optional file containing job resource data entry fields definition. + These fields will be presented to users in the tool forms and allow them to + overwrite default job resources such as number of processors, memory and + walltime. + + cache_user_job_count: + type: bool + default: false + required: false + desc: | + If using job concurrency limits (configured in job_config_file), several + extra database queries must be performed to determine the number of jobs a + user has dispatched to a given destination. By default, these queries will + happen for every job that is waiting to run, but if cache_user_job_count is + set to True, it will only happen once per iteration of the handler queue. + Although better for performance due to reduced queries, the trade-off is a + greater possibility that jobs will be dispatched past the configured limits + if running many handlers. + + tool_filters: + type: str + required: false + desc: | + Define toolbox filters (https://galaxyproject.org/user-defined-toolbox-filters/) + that admins may use to restrict the tools to display. + + tool_label_filters: + type: str + required: false + desc: | + Define toolbox filters (https://galaxyproject.org/user-defined-toolbox-filters/) + that admins may use to restrict the tool labels to display. + + tool_section_filters: + type: str + required: false + desc: | + Define toolbox filters (https://galaxyproject.org/user-defined-toolbox-filters/) + that admins may use to restrict the tool sections to display. + + user_tool_filters: + type: str + default: examples:restrict_upload_to_admins, examples:restrict_encode + required: false + desc: | + Define toolbox filters (https://galaxyproject.org/user-defined-toolbox-filters/) + that users may use to restrict the tools to display. + + user_tool_section_filters: + type: str + default: examples:restrict_text + required: false + desc: | + Define toolbox filters (https://galaxyproject.org/user-defined-toolbox-filters/) + that users may use to restrict the tool sections to display. + + user_tool_label_filters: + type: str + default: examples:restrict_upload_to_admins, examples:restrict_encode + required: false + desc: | + Define toolbox filters (https://galaxyproject.org/user-defined-toolbox-filters/) + that users may use to restrict the tool labels to display. + + toolbox_filter_base_modules: + type: str + default: galaxy.tools.toolbox.filters,galaxy.tools.filters + required: false + desc: | + The base module(s) that are searched for modules for toolbox filtering + (https://galaxyproject.org/user-defined-toolbox-filters/) producedures. + + amqp_internal_connection: + type: str + default: sqlalchemy+sqlite:///./database/control.sqlite?isolation_level=IMMEDIATE + required: false + desc: | + Galaxy uses AMQP internally for communicating between processes. For + example, when reloading the toolbox or locking job execution, the process + that handled that particular request will tell all others to also reload, + lock jobs, etc. + For connection examples, see http://docs.celeryproject.org/projects/kombu/en/latest/userguide/connections.html + + Without specifying anything here, galaxy will first attempt to use your + specified database_connection above. If that's not specified either, Galaxy + will automatically create and use a separate sqlite database located in your + /database folder (indicated in the commented out line below). + + enable_communication_server: + type: bool + default: false + required: false + desc: | + Galaxy real time communication server settings + + communication_server_host: + type: str + default: http://localhost + required: false + desc: | + Galaxy real time communication server settings + + communication_server_port: + type: int + default: 7070 + required: false + desc: | + Galaxy real time communication server settings + + persistent_communication_rooms: + type: str + required: false + desc: | + persistent_communication_rooms is a comma-separated list of rooms that should be always available. + From 2b12d0b605732f918e075ae52ea3518e15e61598 Mon Sep 17 00:00:00 2001 From: John Chilton Date: Thu, 30 Nov 2017 15:14:52 -0500 Subject: [PATCH 016/112] convert_yaml - make sample a schema. --- .../galaxy/webapps/galaxy/config_schema.yml | 0 1 file changed, 0 insertions(+), 0 deletions(-) rename config/galaxy.ini.sample => lib/galaxy/webapps/galaxy/config_schema.yml (100%) diff --git a/config/galaxy.ini.sample b/lib/galaxy/webapps/galaxy/config_schema.yml similarity index 100% rename from config/galaxy.ini.sample rename to lib/galaxy/webapps/galaxy/config_schema.yml From 6901fa9371be28584957fe14a06c73c221ed223b Mon Sep 17 00:00:00 2001 From: John Chilton Date: Fri, 1 Dec 2017 14:32:53 -0500 Subject: [PATCH 017/112] convert_yaml - remove tmp directory for converting yaml. --- tmp_config_convert/convert.py | 81 -- tmp_config_convert/galaxy.ini.sample | 1327 -------------------------- 2 files changed, 1408 deletions(-) delete mode 100644 tmp_config_convert/convert.py delete mode 100644 tmp_config_convert/galaxy.ini.sample diff --git a/tmp_config_convert/convert.py b/tmp_config_convert/convert.py deleted file mode 100644 index ac541f126c1..00000000000 --- a/tmp_config_convert/convert.py +++ /dev/null @@ -1,81 +0,0 @@ - -import string - -HEADER = """ -type: map -desc: | - Galaxy is configured by default to be usable in a single-user development - environment. To tune the application for a multi-user production - environment, see the documentation at: - - http://usegalaxy.org/production - - Throughout this sample configuration file, except where stated otherwise, - uncommented values override the default if left unset, whereas commented - values are set to the default value. Relative paths are relative to the root - Galaxy directory. - - Examples of many of these options are explained in more detail in the Galaxy - Community Hub. - - https://galaxyproject.org/admin/config - - Config hackers are encouraged to check there before asking for help. -mapping: - uwsgi: !include uwsgi_schema.yml - galaxy: - type: map - required: true - mapping: -""" - -OPTION_TEMPLATE = string.Template(""" $name: - type: $type_guess -$default_line required: false - desc: | -$desc""") - -print(HEADER) -with open("galaxy.ini.sample", "r") as f: - lines = f.readlines() - - last_block = "" - for line in lines: - line = line.rstrip("\n") - if not line.strip(): - last_block = "" - continue - if line.startswith("# ") or line == "#": - last_block += line.lstrip("#") + "\n" - continue - elif line.startswith("#"): - assert "=" in line, line - name, value = line.split("=", 1) - name = name.lstrip("#").strip() - default = value.strip() - desc = "\n".join([" %s" % l for l in last_block.split("\n")]) - type_guess = "str" - if default: - # Python -> YAML - if default == "None": - default = "null" - if name.endswith("_boost"): - # boost search modifiers - only floats? - type_guess = "float" - elif default.isdigit(): - type_guess = "int" - elif default.lower() in ["true", "false"]: - type_guess = "bool" - default = default.lower() - default_line = " default: %s\n" % default - else: - default_line = "" - - print(OPTION_TEMPLATE.safe_substitute( - name=name, - default_line=default_line, - desc=desc, - type_guess=type_guess, - )) - else: - assert False, "[%s]" % line diff --git a/tmp_config_convert/galaxy.ini.sample b/tmp_config_convert/galaxy.ini.sample deleted file mode 100644 index 5adb4fc5029..00000000000 --- a/tmp_config_convert/galaxy.ini.sample +++ /dev/null @@ -1,1327 +0,0 @@ - -# If not running behind a proxy server, you may want to enable gzip compression -# to decrease the size of data transferred over the network. If using a proxy -# server, please enable gzip compression there instead. -#filter-with = gzip - -# If running behind a proxy server and Galaxy is served from a subdirectory, -# enable the proxy-prefix filter and set the prefix in the -# [filter:proxy-prefix] section above. -#filter-with = proxy-prefix - -# If proxy-prefix is enabled and you're running more than one Galaxy instance -# behind one hostname, you will want to set this to the same path as the prefix -# in the filter above. This value becomes the "path" attribute set in the -# cookie so the cookies from each instance will not clobber each other. -#cookie_path = None - -# By default, Galaxy uses a SQLite database at 'database/universe.sqlite'. You -# may use a SQLAlchemy connection string to specify an external database -# instead. This string takes many options which are explained in detail in the -# config file documentation. -#database_connection = sqlite:///./database/universe.sqlite?isolation_level=IMMEDIATE - -# If the server logs errors about not having enough database pool connections, -# you will want to increase these values, or consider running more Galaxy -# processes. -#database_engine_option_pool_size = 5 -#database_engine_option_max_overflow = 10 - -# If using MySQL and the server logs the error "MySQL server has gone away", -# you will want to set this to some positive value (7200 should work). -#database_engine_option_pool_recycle = -1 - -# If large database query results are causing memory or response time issues in -# the Galaxy process, leave the result on the server instead. This option is -# only available for PostgreSQL and is highly recommended. -#database_engine_option_server_side_cursors = False - -# Log all database transactions, can be useful for debugging and performance -# profiling. Logging is done via Python's 'logging' module under the qualname -# 'galaxy.model.orm.logging_connection_proxy' -#database_query_profiling_proxy = False - -# If auto-creating a postgres database on startup - it can be based on an existing -# template database. This will set that. This is probably only useful for testing but -# documentation is included here for completeness. -#database_template = None - -# Slow query logging. Queries slower than the threshold indicated below will -# be logged to debug. A value of '0' is disabled. For example, you would set -# this to .005 to log all queries taking longer than 5 milliseconds. -#slow_query_log_threshold = 0 - -# By default, Galaxy will use the same database to track user data and -# tool shed install data. There are many situations in which it is -# valuable to separate these - for instance bootstrapping fresh Galaxy -# instances with pretested installs. The following option can be used to -# separate the tool shed install database (all other options listed above -# but prefixed with install_ are also available). -#install_database_connection = sqlite:///./database/universe.sqlite?isolation_level=IMMEDIATE - -# Setting the following option to true will cause Galaxy to automatically -# migrate the database forward after updates. This is not recommended for production -# use. -#database_auto_migrate = False - -# Dataset files are stored in this directory. -#file_path = database/files - -# Temporary files are stored in this directory. -#new_file_path = database/tmp - -# Tool config files, defines what tools are available in Galaxy. -# Tools can be locally developed or installed from Galaxy tool sheds. -# (config/tool_conf.xml.sample will be used if left unset and -# config/tool_conf.xml does not exist). -#tool_config_file = config/tool_conf.xml,config/shed_tool_conf.xml - -# Enable / disable checking if any tools defined in the above non-shed -# tool_config_files (i.e., tool_conf.xml) have been migrated from the Galaxy -# code distribution to the Tool Shed. This setting should generally be set to -# False only for development Galaxy environments that are often rebuilt from -# scratch where migrated tools do not need to be available in the Galaxy tool -# panel. If the following setting remains commented, the default setting will -# be True. -#check_migrate_tools = True - -# Tool config maintained by tool migration scripts. If you use the migration -# scripts to install tools that have been migrated to the tool shed upon a new -# release, they will be added to this tool config file. -#migrated_tools_config = config/migrated_tools_conf.xml - -# File that contains the XML section and tool tags from all tool panel config -# files integrated into a single file that defines the tool panel layout. This -# file can be changed by the Galaxy administrator to alter the layout of the -# tool panel. If not present, Galaxy will create it. -#integrated_tool_panel_config = integrated_tool_panel.xml - -# Default path to the directory containing the tools defined in tool_conf.xml. -# Other tool config files must include the tool_path as an attribute in the -# tag. -#tool_path = tools - -# Path to the directory in which tool dependencies are placed. This is used by -# the Tool Shed to install dependencies and can also be used by administrators -# to manually install or link to dependencies. For details, see: -# https://galaxyproject.org/admin/config/tool-dependencies -# Set the string to None to explicitly disable tool dependency handling. -# If this option is set to none or an invalid path, installing tools with dependencies -# from the Tool Shed will fail. -#tool_dependency_dir = database/dependencies - -# The dependency resolvers config file specifies an ordering and options for how -# Galaxy resolves tool dependencies (requirement tags in Tool XML). The default -# ordering is to the use the Tool Shed for tools installed that way, use local -# Galaxy packages, and then use Conda if available. -# See https://github.com/galaxyproject/galaxy/blob/dev/doc/source/admin/dependency_resolvers.rst -# for more information on these options. -#dependency_resolvers_config_file = config/dependency_resolvers_conf.xml - -# The following Conda dependency resolution options will change the defaults for -# all Conda resolvers, but multiple resolvers can be configured independently -# in dependency_resolvers_config_file and these options overridden. -# Location on the filesystem where Conda packages are installed - -# conda_prefix is the location on the filesystem where Conda packages and environments are installed -# IMPORTANT: Due to a current limitation in conda, the total length of the -# conda_prefix and the job_working_directory path should be less than 50 characters! -#conda_prefix = /_conda - -# Override the Conda executable to use, it will default to the one on the -# PATH (if available) and then to /bin/conda -#conda_exec = - -# Pass debug flag to conda commands. -#conda_debug = False - -# conda channels to enable by default (http://conda.pydata.org/docs/custom-channels.html) -#conda_ensure_channels = iuc,bioconda,conda-forge,defaults,r - -# Set to True to instruct Galaxy to look for and install missing tool -# dependencies before each job runs. -#conda_auto_install = False - -# Set to True to instruct Galaxy to install Conda from the web automatically -# if it cannot find a local copy and conda_exec is not configured. -#conda_auto_init = True - -# You must set this to True if conda_prefix and job_working_directory are not on the same -# volume, or some conda dependencies will fail to execute at job runtime. -# Conda will copy packages content instead of creating hardlinks or symlinks. -# This will prevent problems with some specific packages (perl, R), at the cost -# of extra disk space usage and extra time spent copying packages. -#conda_copy_dependencies = False - -# Certain dependency resolvers (namely Conda) take a considerable amount of -# time to build an isolated job environment in the job_working_directory if the -# job working directory is on a network share. Set the following option to True -# to cache the dependencies in a folder. This option is beta and should only be -# used if you experience long waiting times before a job is actually submitted -# to your cluster. -#use_cached_dependency_manager = False - -# By default the tool_dependency_cache_dir is the _cache directory -# of the tool dependency directory -#tool_dependency_cache_dir = /_cache - -# By default, when using a cached dependency manager, the dependencies are cached -# when installing new tools and when using tools for the first time. -# Set this to False if you prefer dependencies to be cached only when installing new tools. -#precache_dependencies = True - -# File containing the Galaxy Tool Sheds that should be made available to -# install from in the admin interface (.sample used if default does not exist). -#tool_sheds_config_file = config/tool_sheds_conf.xml - -# Set to True to enable monitoring of tools and tool directories -# listed in any tool config file specified in tool_config_file option. -# If changes are found, tools are automatically reloaded. Watchdog ( -# https://pypi.python.org/pypi/watchdog ) must be installed and -# available to Galaxy to use this option. Other options include 'auto' -# which will attempt to watch tools if the watchdog library is available -# but won't fail to load Galaxy if it is not and 'polling' which will use -# a less efficient monitoring scheme that may work in wider range of scenarios -# than the watchdog default. -#watch_tools = False - -# Enable Galaxy to fetch Docker containers registered with quay.io generated -# from tool requirements resolved through conda. These containers (when -# available) have been generated using mulled - https://github.com/mulled. -# These containers are highly beta and availability will vary by tool. -# This option will additionally only be used for job destinations with -# Docker enabled. -#enable_beta_mulled_containers = False - -# Container resolvers configuration (beta). Setup a file describing container -# resolvers to use when discovering containers for Galaxy. If this is set to -# None, the default containers loaded is determined by -# enable_beta_mulled_containers. -#containers_resolvers_config_file = None - -# involucro is a tool used to build Docker containers for tools from Conda -# dependencies referenced in tools as `requirement`s. The following path is -# the location of involucro on the Galaxy host. This is ignored if the relevant -# container resolver isn't enabled, and will install on demand unless -# involucro_auto_init is set to False. -#involucro_path = database/dependencies/involucro - -# Install involucro as needed to build Docker containers for tools. Ignored if -# relevant container resolver is not used. -#involucro_auto_init = True - -# Enable automatic polling of relative tool sheds to see if any updates -# are available for installed repositories. Ideally only one Galaxy -# server process should be able to check for repository updates. The -# setting for hours_between_check should be an integer between 1 and 24. -#enable_tool_shed_check = False -#hours_between_check = 12 - -# Enable use of an in-memory registry with bi-directional relationships between -# repositories (i.e., in addition to lists of dependencies for a repository, -# keep an in-memory registry of dependent items for each repository. -#manage_dependency_relationships = False - -# XML config file that contains data table entries for the -# ToolDataTableManager. This file is manually # maintained by the Galaxy -# administrator (.sample used if default does not exist). -#tool_data_table_config_path = config/tool_data_table_conf.xml - -# XML config file that contains additional data table entries for the -# ToolDataTableManager. This file is automatically generated based on the -# current installed tool shed repositories that contain valid -# tool_data_table_conf.xml.sample files. At the time of installation, these -# entries are automatically added to the following file, which is parsed and -# applied to the ToolDataTableManager at server start up. -#shed_tool_data_table_config = config/shed_tool_data_table_conf.xml - -# Directory where data used by tools is located. See the samples in that -# directory and the Galaxy Community Hub for help: -# https://galaxyproject.org/admin/data-integration -#tool_data_path = tool-data - -# Directory where Tool Data Table related files will be placed -# when installed from a ToolShed. Defaults to tool_data_path. -#shed_tool_data_path = tool-data - -# Set to True to enable monitoring of the tool_data and shed_tool_data_path -# directories. If changes in tool data table files are found, the tool data -# tables for that data manager are automatically reloaded. -# Watchdog ( https://pypi.python.org/pypi/watchdog ) must be installed and -# available to Galaxy to use this option. Other options include 'auto' -# which will attempt to use the watchdog library if it is available but won't -# fail to load Galaxy if it is not and 'polling' which will use a less -# efficient monitoring scheme that may work in wider range of scenarios -# than the watchdog default. -#watch_tool_data_dir = False - -# File containing old-style genome builds -#builds_file_path = tool-data/shared/ucsc/builds.txt - -# Directory where chrom len files are kept, currently mainly used by trackster -#len_file_path = tool-data/shared/ucsc/chrom - -# Datatypes config file(s), defines what data (file) types are available in -# Galaxy (.sample is used if default does not exist). If a datatype appears in -# multiple files, the last definition is used (though the first sniffer is used -# so limit sniffer definitions to one file). -#datatypes_config_file = config/datatypes_conf.xml - -# Disable the 'Auto-detect' option for file uploads -#datatypes_disable_auto = False - -# Visualizations config directory: where to look for individual visualization -# plugins. The path is relative to the Galaxy root dir. To use an absolute -# path begin the path with '/'. This is a comma separated list. -# Defaults to "config/plugins/visualizations". -#visualization_plugins_directory = config/plugins/visualizations - -# Interactive environment plugins root directory: where to look for interactive -# environment plugins. By default none will be loaded. Set to -# config/plugins/interactive_environments to load Galaxy's stock plugins. -# These will require Docker to be configured and have security considerations, -# so proceed with caution. The path is relative to the Galaxy root dir. To use -# an absolute path begin the path with '/'. This is a comma -# separated list. -#interactive_environment_plugins_directory = - -# To run interactive environment containers in Docker Swarm mode (on an -# existing swarm), set this option to True and set `docker_connect_port` in the -# IE plugin config (ini) file(s) of any IE plugins you have enabled and ensure -# that you are not using any `docker run`-specific options in your plugins' -# `command_inject` options (swarm mode services run using `docker service -# create`, which has a different and more limited set of options). This option -# can be overridden on a per-plugin basis by using the `swarm_mode` option in -# the plugin's ini config file. -#interactive_environment_swarm_mode = False - -# Galaxy can run a "swarm manager" service that will monitor utilization of the -# swarm and provision/deprovision worker nodes as necessary. The service has -# its own configuration file. -#swarm_manager_config_file = config/swarm_manager_conf.yml - -# Interactive tour directory: where to store interactive tour definition files. -# Galaxy ships with several basic interface tours enabled, though a different -# directory with custom tours can be specified here. The path is relative to the -# Galaxy root dir. To use an absolute path begin the path with '/'. This is a comma -# separated list. -#tour_config_dir = config/plugins/tours - -# Webhooks directory: where to store webhooks - plugins to extend the Galaxy UI. -# By default none will be loaded. Set to config/plugins/webhooks/demo to load Galaxy's -# demo webhooks. To use an absolute path begin the path with '/'. This is a comma -# separated list. Add test/functional/webhooks to this list to include the demo webhooks -# used to test the webhook framework. -#webhooks_dir = config/plugins/webhooks - -# Each job is given a unique empty directory as its current working directory. -# This option defines in what parent directory those directories will be -# created. -#job_working_directory = database/jobs_directory - -# If using a cluster, Galaxy will write job scripts and stdout/stderr to this -# directory. -#cluster_files_directory = database/pbs - -# Mako templates are compiled as needed and cached for reuse, this directory is -# used for the cache -#template_cache_path = database/compiled_templates - -# Set to false to disable various checks Galaxy will do to ensure it -# can run job scripts before attempting to execute or submit them. -#check_job_script_integrity = True - -# Number of checks to execute if check_job_script_integrity is enabled. -#check_job_script_integrity_count = 35 - -# Time to sleep between checks if check_job_script_integrity is enabled (in seconds). -#check_job_script_integrity_sleep = .25 - -# Set the default shell used by non-containerized jobs Galaxy-wide. This -# defaults to bash for all jobs and can be overridden at the destination -# level for heterogeneous clusters. conda job resolution requires bash or zsh -# so if this is switched to /bin/sh for instance - conda resolution -# should be disabled. Containerized jobs always use /bin/sh - so more maximum -# portability tool authors should assume generated commands run in sh. -#default_job_shell = /bin/bash - -# Citation related caching. Tool citations information maybe fetched from -# external sources such as http://dx.doi.org/ by Galaxy - the following -# parameters can be used to control the caching used to store this information. -#citation_cache_type = file -#citation_cache_data_dir = database/citations/data -#citation_cache_lock_dir = database/citations/lock - -# Tools with a number of outputs not known until runtime can write these -# outputs to a directory for collection by Galaxy when the job is done. -# Previously, this directory was new_file_path, but using one global directory -# can cause performance problems, so using job_working_directory ('.' or cwd -# when a job is run) is encouraged. By default, both are checked to avoid -# breaking existing tools. -#collect_outputs_from = new_file_path,job_working_directory - -# Configuration file for the object store -# If this is set and exists, it overrides any other objectstore settings. -#object_store_config_file = config/object_store_conf.xml - -# Galaxy sends mail for various things: subscribing users to the mailing list -# if they request it, password resets, reporting dataset errors, and sending -# activation emails. To do this, it needs to send mail through an SMTP server, -# which you may define here (host:port). -# Galaxy will automatically try STARTTLS but will continue upon failure. -#smtp_server = None - -# If your SMTP server requires a username and password, you can provide them -# here (password in cleartext here, but if your server supports STARTTLS it -# will be sent over the network encrypted). -#smtp_username = None -#smtp_password = None - -# If your SMTP server requires SSL from the beginning of the connection -#smtp_ssl = False - -# On the user registration form, users may choose to join a mailing list. This -# is the address used to subscribe to the list. Uncomment and leave empty if you -# want to remove this option from the user registration form. -#mailing_join_addr = galaxy-announce-join@bx.psu.edu - -# Datasets in an error state include a link to report the error. Those reports -# will be sent to this address. Error reports are disabled if no address is -# set. Also this email is shown as a contact to user in case of Galaxy -# misconfiguration and other events user may encounter. -#error_email_to = None - -# Email address to use in the 'From' field when sending emails for -# account activations, workflow step notifications and password resets. -# We recommend using string in the following format: -# Galaxy Project -# If not configured, '' will be used. -#email_from = None - -# URL of the support resource for the galaxy instance. Used in activation -# emails. -#instance_resource_url = https://galaxyproject.org/ - -# E-mail domains blacklist is used for filtering out users that are using -# disposable email address during the registration. If their address domain -# matches any domain in the blacklist, they are refused the registration. -#blacklist_file = config/disposable_email_blacklist.conf - -# Registration warning message is used to discourage people from registering -# multiple accounts. Applies mostly for the main Galaxy instance. -# If no message specified the warning box will not be shown. -#registration_warning_message = Please register only one account - we provide this service free of charge and have limited computational resources. Multi-accounts are tracked and will be subjected to account termination and data deletion. - -# User account activation feature global flag. If set to "False", the rest of -# the Account activation configuration is ignored and user activation is -# disabled (i.e. accounts are active since registration). -# The activation is also not working in case the SMTP server is not defined. -#user_activation_on = False - -# Activation grace period (in hours). Activation is not forced (login is not -# disabled) until grace period has passed. Users under grace period can't run -# jobs. Enter 0 to disable grace period. -# Users with OpenID logins have grace period forever. -#activation_grace_period = 3 - -# Shown in warning box to users that were not activated yet. -# In use only if activation_grace_period is set. -#inactivity_box_content = Your account has not been activated yet. Feel free to browse around and see what's available, but you won't be able to upload data or run jobs until you have verified your email address. - -# Password expiration period (in days). Users are required to change their -# password every x days. Users will be redirected to the change password -# screen when they log in after their password expires. Enter 0 to disable -# password expiration. -#password_expiration_period = 0 - -# Galaxy Session Timeout -# This provides a timeout (in minutes) after which a user will have to log back in. -# A duration of 0 disables this feature. -#session_duration = 0 - - -# You can enter tracking code here to track visitor's behavior -# through your Google Analytics account. Example: UA-XXXXXXXX-Y -#ga_code = None - -# Galaxy can display data at various external browsers. These options specify -# which browsers should be available. URLs and builds available at these -# browsers are defined in the specifield files. -# -# If use_remote_user = True, display application servers will be denied access -# to Galaxy and so displaying datasets in these sites will fail. -# display_servers contains a list of hostnames which should be allowed to -# bypass security to display datasets. Please be aware that there are security -# implications if this is allowed. More details (including required changes to -# the proxy server config) are available in the Apache proxy documentation on -# the Galaxy Community Hub. -# -# The list of servers in this sample config are for the UCSC Main, Test and -# Archaea browsers, but the default if left commented is to not allow any -# display sites to bypass security (you must uncomment the line below to allow -# them). -#display_servers = hgw1.cse.ucsc.edu,hgw2.cse.ucsc.edu,hgw3.cse.ucsc.edu,hgw4.cse.ucsc.edu,hgw5.cse.ucsc.edu,hgw6.cse.ucsc.edu,hgw7.cse.ucsc.edu,hgw8.cse.ucsc.edu,lowepub.cse.ucsc.edu - -# To disable the old-style display applications that are hardcoded into -# datatype classes, set enable_old_display_applications = False. -# This may be desirable due to using the new-style, XML-defined, display -# applications that have been defined for many of the datatypes that have the -# old-style. -# There is also a potential security concern with the old-style applications, -# where a malicious party could provide a link that appears to reference the -# Galaxy server, but contains a redirect to a third-party server, tricking a -# Galaxy user to access said site. -#enable_old_display_applications = True - -# Next gen LIMS interface on top of existing Galaxy Sample/Request -# management code. -# -# use_nglims = False -# nglims_config_file = tool-data/nglims.yaml - -# Show a message box under the masthead. -#message_box_visible = False -#message_box_content = None -#message_box_class = info - -# Append "/{brand}" to the "Galaxy" text in the masthead. -#brand = None - -# Format string used when showing date and time information. -# The string may contain: -# - the directives used by Python time.strftime() function (see -# https://docs.python.org/2/library/time.html#time.strftime ), -# - $locale (complete format string for the server locale), -# - $iso8601 (complete format string as specified by ISO 8601 international -# standard). -#pretty_datetime_format = $locale (UTC) - -# URL (with schema http/https) of the Galaxy instance as accessible within your -# local network - if specified used as a default by pulsar file staging and -# Jupyter Docker container for communicating back with Galaxy via the API. -# -# If you are attempting to setup GIEs on Mac OS X with Docker for Mac - this -# should likely be the IP address of your machine on the virtualbox network (vboxnet0) -# setup for the Docker host VM. This can found by running ifconfig and using the -# IP address of the network vboxnet0. -#galaxy_infrastructure_url = http://localhost:8080 - -# If the above URL cannot be determined ahead of time in dynamic environments -# but the port which should be used to access Galaxy can be - this should be -# set to prevent Galaxy from having to guess. For example if Galaxy is sitting -# behind a proxy with REMOTE_USER enabled - infrastructure shouldn't talk to -# Python processes directly and this should be set to 80 or 443, etc... If -# unset this file will be read for a server block defining a port corresponding -# to the webapp. -#galaxy_infrastructure_web_port = 8080 - -# The URL of the page to display in Galaxy's middle pane when loaded. This can -# be an absolute or relative URL. -#welcome_url = /static/welcome.html - -# The URL linked by the "Galaxy/brand" text. -#logo_url = / - -# The URL linked by the "Wiki" link in the "Help" menu. -#wiki_url = https://galaxyproject.org/ - -# The URL linked by the "Support" link in the "Help" menu. -#support_url = https://galaxyproject.org/support - -# The URL linked by the "How to Cite Galaxy" link in the "Help" menu. -#citation_url = https://galaxyproject.org/citing-galaxy - -# The URL linked by the "Search" link in the "Help" menu. -#search_url = https://galaxyproject.org/search/ - -# The URL linked by the "Mailing Lists" link in the "Help" menu. -#mailing_lists_url = https://galaxyproject.org/mailing-lists - -# The URL linked by the "Videos" link in the "Help" menu. -#screencasts_url = https://vimeo.com/galaxyproject - -# Points to the GenomeSpace UI service which will be used by -# the GenomeSpace importer and exporter tools -#genomespace_ui_url = https://gsui.genomespace.org/jsui/ - -# The URL linked by the "Terms and Conditions" link in the "Help" menu, as well -# as on the user registration and login forms and in the activation emails. -#terms_url = None - -# The URL linked by the "Galaxy Q&A" link in the "Help" menu -# The Galaxy Q&A site is under development; when the site is done, this URL -# will be set and uncommented. -#qa_url = - -# Serve static content, which must be enabled if you're not serving it via a -# proxy server. These options should be self explanatory and so are not -# documented individually. You can use these paths (or ones in the proxy -# server) to point to your own styles. -#static_enabled = True -#static_cache_time = 360 -#static_dir = static/ -#static_images_dir = static/images -#static_favicon_dir = static/favicon.ico -#static_scripts_dir = static/scripts/ -#static_style_dir = static/june_2007_style/blue -#static_robots_txt = static/robots.txt - -# Incremental Display Options -#display_chunk_size = 65536 - -# For help on configuring the Advanced proxy features, see: -# http://usegalaxy.org/production -# -# Apache can handle file downloads (Galaxy-to-user) via mod_xsendfile. Set -# this to True to inform Galaxy that mod_xsendfile is enabled upstream. -#apache_xsendfile = False - -# The same download handling can be done by nginx using X-Accel-Redirect. This -# should be set to the path defined in the nginx config as an internal redirect -# with access to Galaxy's data files (see documentation linked above). -#nginx_x_accel_redirect_base = False - -# nginx can make use of mod_zip to create zip files containing multiple library -# files. If using X-Accel-Redirect, this can be the same value as that option. -#nginx_x_archive_files_base = False - -# If using compression in the upstream proxy server, use this option to disable -# gzipping of library .tar.gz and .zip archives, since the proxy server will do -# it faster on the fly. -#upstream_gzip = False - -# The following default adds a header to web request responses that -# will cause modern web browsers to not allow Galaxy to be embedded in -# the frames of web applications hosted at other hosts - this can help -# prevent a class of attack called clickjacking -# (https://www.owasp.org/index.php/Clickjacking). If you configure a -# proxy in front of Galaxy - please ensure this header remains intact -# to protect your users. Uncomment and leave empty to not set the -# `X-Frame-Options` header. -#x_frame_options = SAMEORIGIN - -# nginx can also handle file uploads (user-to-Galaxy) via nginx_upload_module. -# Configuration for this is complex and explained in detail in the -# documentation linked above. The upload store is a temporary directory in -# which files uploaded by the upload module will be placed. -#nginx_upload_store = False - -# This value overrides the action set on the file upload form, e.g. the web -# path where the nginx_upload_module has been configured to intercept upload -# requests. -#nginx_upload_path = False - -# Galaxy can also use nginx_upload_module to receive files staged out upon job -# completion by remote job runners (i.e. Pulsar) that initiate staging -# operations on the remote end. See the Galaxy nginx documentation for the -# corresponding nginx configuration. -#nginx_upload_job_files_store = False -#nginx_upload_job_files_path = False - -# Have Galaxy manage dynamic proxy component for routing requests to other -# services based on Galaxy's session cookie. It will attempt to do this by -# default though you do need to install node+npm and do an npm install from -# `lib/galaxy/web/proxy/js`. It is generally more robust to configure this -# externally, managing it however Galaxy is managed. If True, Galaxy will only -# launch the proxy if it is actually going to be used (e.g. for Jupyter). -#dynamic_proxy_manage=True - -# As of 16.04 Galaxy supports multiple proxy types. The original NodeJS -# implementation, alongside a new Golang single-binary-no-dependencies -# version. Valid values are (node, golang) -#dynamic_proxy=node - -# The NodeJS dynamic proxy can use an SQLite database or a JSON file for IPC, -# set that here. -#dynamic_proxy_session_map=database/session_map.sqlite - -# Set the port and IP for the the dynamic proxy to bind to, this must match -# the external configuration if dynamic_proxy_manage is False. -#dynamic_proxy_bind_port=8800 -#dynamic_proxy_bind_ip=0.0.0.0 - -# Enable verbose debugging of Galaxy-managed dynamic proxy. -#dynamic_proxy_debug=False - -# The dynamic proxy is proxied by an external proxy (e.g. apache frontend to -# nodejs to wrap connections in SSL). -#dynamic_proxy_external_proxy=False - -# Additionally, when the dynamic proxy is proxied by an upstream server, you'll -# want to specify a prefixed URL so both Galaxy and the proxy reside under the -# same path that your cookies are under. This will result in a url like -# https://FQDN/galaxy-prefix/gie_proxy for proxying -#dynamic_proxy_prefix=gie_proxy - -# The Golang proxy also manages the docker containers more closely than the -# NodeJS proxy, so is able to expose more container management related options - -# This attribute governs the minimum length of time between consecutive HTTP/WS -# requests through the proxy, before the proxy considers a container as being -# inactive and kills it. -#dynamic_proxy_golang_noaccess = 60 - -# In order to kill containers, the golang proxy has to check at some interval -# for possibly dead containers. This is exposed as a configurable parameter, -# but the default value is probably fine. -#dynamic_proxy_golang_clean_interval = 10 - -# The golang proxy needs to know how to talk to your docker daemon. Currently -# TLS is not supported, that will come in an update. -#dynamic_proxy_golang_docker_address = unix:///var/run/docker.sock - -# The golang proxy uses a RESTful HTTP API for communication with Galaxy -# instead of a JSON or SQLite file for IPC. If you do not specify this, it will -# be set randomly for you. You should set this if you are managing the proxy -# manually. -#dynamic_proxy_golang_api_key = None - -# If True, Galaxy will attempt to configure a simple root logger if a -# "loggers" section does not appear in this configuration file. -#auto_configure_logging = True - -# Verbosity of console log messages. Acceptable values can be found here: -# https://docs.python.org/2/library/logging.html#logging-levels -# A custom debug level of "TRACE" is available for even more verbosity. -#log_level = DEBUG - -# Print database operations to the server log (warning, quite verbose!). -#database_engine_option_echo = False - -# Print database pool operations to the server log (warning, quite verbose!). -#database_engine_option_echo_pool = False - -# Turn on logging of application events and some user events to the database. -#log_events = True - -# Turn on logging of user actions to the database. Actions currently logged -# are grid views, tool searches, and use of "recently" used tools menu. The -# log_events and log_actions functionality will eventually be merged. -#log_actions = True - -# Fluentd configuration. Various events can be logged to the fluentd instance -# configured below by enabling fluent_log. -#fluent_log = False -#fluent_host = localhost -#fluent_port = 24224 - -# Sanitize all HTML tool output. By default, all tool output served as -# 'text/html' will be sanitized thoroughly. This can be disabled if you have -# special tools that require unaltered output. WARNING: disabling this does -# make the Galaxy instance susceptible to XSS attacks initiated by your users. -#sanitize_all_html = True - -# Whitelist sanitization file. -# Datasets created by tools listed in this file are trusted and will not have -# their HTML sanitized on display. This can be manually edited or manipulated -# through the Admin control panel -- see "Manage Display Whitelist" -#sanitize_whitelist_file = config/sanitize_whitelist.txt - -# By default Galaxy will serve non-HTML tool output that may potentially -# contain browser executable JavaScript content as plain text. This will for -# instance cause SVG datasets to not render properly and so may be disabled -# by setting the following option to True. -#serve_xss_vulnerable_mimetypes = False - -# Return a Access-Control-Allow-Origin response header that matches the Origin -# header of the request if that Origin hostname matches one of the strings or -# regular expressions listed here. This is a comma separated list of hostname -# strings or regular expressions beginning and ending with /. -# E.g. mysite.com,google.com,usegalaxy.org,/^[\w\.]*example\.com/ -# See: https://developer.mozilla.org/en-US/docs/Web/HTTP/Access_control_CORS -#allowed_origin_hostnames = None - -# Set the following to True to use Jupyter nbconvert to build HTML from Jupyter -# notebooks in Galaxy histories. This process may allow users to execute -# arbitrary code or serve arbitrary HTML. If enabled, Jupyter must be -# available and on Galaxy's PATH, to do this run -# `pip install jinja2 pygments jupyter` in Galaxy's virtualenv. -#trust_jupyter_notebook_conversion = False - -# Debug enables access to various config options useful for development and -# debugging: use_lint, use_profile, use_printdebug and use_interactive. It -# also causes the files used by PBS/SGE (submission script, output, and error) -# to remain on disk after the job is complete. -#debug = False - -# Check for WSGI compliance. -#use_lint = False - -# Run the Python profiler on each request. -#use_profile = False - -# Intercept print statements and show them on the returned page. -#use_printdebug = True - -# Enable live debugging in your browser. This should NEVER be enabled on a -# public site. Enabled in the sample config for development. -#use_interactive = True - -# When stopping Galaxy cleanly, how much time to give various monitoring/polling -# threads to finish before giving up on joining them. Set to 0 to disable this and -# restore the pre-18.01 default behavior. -#monitor_thread_join_timeout = 5 - -# Write thread status periodically to 'heartbeat.log', (careful, uses disk -# space rapidly!). Useful to determine why your processes may be consuming a -# lot of CPU. -#use_heartbeat = False - -# Control the period (in seconds) between dumps. Use -1 to disable. Regardless -# of this setting, if use_heartbeat is enabled, you can send a Galaxy process -# (unless running with uWSGI) SIGUSR1 (`kill -USR1`) to force a dump. -#heartbeat_interval = 20 - -# Heartbeat log filename. Can accept the template variables {server_name} and -# {pid} -#heartbeat_log = heartbeat_{server_name}.log - -# Log to Sentry -# Sentry is an open source logging and error aggregation platform. Setting -# sentry_dsn will enable the Sentry middleware and errors will be sent to the -# indicated sentry instance. This connection string is available in your -# sentry instance under -> Settings -> API Keys. -#sentry_dsn = None - -# Log to statsd -# Statsd is an external statistics aggregator (https://github.com/etsy/statsd) -# Enabling the following options will cause galaxy to log request timing and -# other statistics to the configured statsd instance. The statsd_prefix is -# useful if you are running multiple Galaxy instances and want to segment -# statistics between them within the same aggregator. -#statsd_host= -#statsd_port=8125 -#statsd_prefix=galaxy - -# Log to graphite -# Graphite is an external statistics aggregator (https://github.com/graphite-project/carbon) -# Enabling the following options will cause galaxy to log request timing and -# other statistics to the configured graphite instance. The graphite_prefix is -# useful if you are running multiple Galaxy instances and want to segment -# statistics between them within the same aggregator. -#graphite_host= -#graphite_port=2003 -#graphite_prefix=galaxy - -# -- Data Libraries - -# These library upload options are described in much more detail in the Galaxy -# Community Hub: -# https://galaxyproject.org/data-libraries/ - -# Add an option to the library upload form which allows administrators to -# upload a directory of files. -#library_import_dir = None - -# Add an option to the library upload form which allows authorized -# non-administrators to upload a directory of files. The configured directory -# must contain sub-directories named the same as the non-admin user's Galaxy -# login ( email ). The non-admin user is restricted to uploading files or -# sub-directories of files contained in their directory. -#user_library_import_dir = None - -# For security reasons, users may not import any files that actually lie -# outside of their `user_library_import_dir` (e.g. using symbolic links). A -# list of directories can be allowed by setting the following option (the list -# is comma-separated). Be aware that *any* user with library import permissions -# can import from anywhere in these directories (assuming they are able to -# create symlinks to them). -#user_library_import_symlink_whitelist = None - -# Allow admins to paste filesystem paths during upload. For libraries this -# adds an option to the admin library upload tool allowing admins to paste -# filesystem paths to files and directories in a box, and these paths will be -# added to a library. For history uploads, this allows pasting in paths as URIs. -# (i.e. prefixed with file://). Set to True to enable. Please note the security -# implication that this will give Galaxy Admins access to anything your Galaxy -# user has access to. -#allow_path_paste = False - -# Users may choose to download multiple files from a library in an archive. By -# default, Galaxy allows users to select from a few different archive formats -# if testing shows that Galaxy is able to create files using these formats. -# Specific formats can be disabled with this option, separate more than one -# format with commas. Available formats are currently 'zip', 'gz', and 'bz2'. -#disable_library_comptypes = - -# Some sequencer integration features in beta allow you to automatically -# transfer datasets. This is done using a lightweight transfer manager which -# runs outside of Galaxy (but is spawned by it automatically). Galaxy will -# communicate with this manager over the port specified here. -#transfer_manager_port = 8163 - -# Boosts are used to customize this instance's toolbox search. -# The higher the boost, the more importance the scoring algorithm gives to the -# given field. Section refers to the tool group in the tool panel. Rest of -# the fields are tool's attributes. -#tool_name_boost = 9 -#tool_section_boost = 3 -#tool_description_boost = 2 -#tool_label_boost = 1 -#tool_stub_boost = 5 -#tool_help_boost = 0.5 - -# Limits the number of results in toolbox search. Can be used to tweak how many -# results will appear. -#tool_search_limit = 20 - -# Enable/ disable Ngram-search for tools. It makes tool -# search results tolerant for spelling mistakes in the query -# by dividing the query into multiple ngrams and search for -# each ngram -#tool_enable_ngram_search = False - -# Set minimum size of ngrams -#tool_ngram_minsize = 3 - -# Set maximum size of ngrams -#tool_ngram_maxsize = 4 - -# Galaxy encodes various internal values when these values will be output in -# some format (for example, in a URL or cookie). You should set a key to be -# used by the algorithm that encodes and decodes these values. It can be any -# string up to 448 bits long. -# One simple way to generate a value for this is with the shell command: -# python -c 'import time; print time.time()' | md5sum | cut -f 1 -d ' ' -#id_secret = USING THE DEFAULT IS NOT SECURE! - -# User authentication can be delegated to an upstream proxy server (usually -# Apache). The upstream proxy should set a REMOTE_USER header in the request. -# Enabling remote user disables regular logins. For more information, see: -# https://galaxyproject.org/admin/config/apache-proxy -#use_remote_user = False - -# If use_remote_user is enabled and your external authentication -# method just returns bare usernames, set a default mail domain to be appended -# to usernames, to become your Galaxy usernames (email addresses). -#remote_user_maildomain = None - -# If use_remote_user is enabled, the header that the upstream proxy provides -# the remote username in defaults to HTTP_REMOTE_USER (the 'HTTP_' is prepended -# by WSGI). This option allows you to change the header. Note, you still need -# to prepend 'HTTP_' to the header in this option, but your proxy server should -# *not* include 'HTTP_' at the beginning of the header name. -#remote_user_header = HTTP_REMOTE_USER - -# If use_remote_user is enabled, anyone who can log in to the Galaxy host may -# impersonate any other user by simply sending the appropriate header. Thus a -# secret shared between the upstream proxy server, and Galaxy is required. -# If anyone other than the Galaxy user is using the server, then apache/nginx -# should pass a value in the header 'GX_SECRET' that is identical to the one -# below. -#remote_user_secret = USING THE DEFAULT IS NOT SECURE! - -# If use_remote_user is enabled, you can set this to a URL that will log your -# users out. -#remote_user_logout_href = None - -# If your proxy and/or authentication source does not normalize e-mail -# addresses or user names being passed to Galaxy - set the following option -# to True to force these to lower case. -#normalize_remote_user_email = False - -# If an e-mail address is specified here, it will hijack remote user mechanics -# (``use_remote_user``) and have the webapp inject a single fixed user. This -# has the effect of turning Galaxy into a single user application with no -# login or external proxy required. Such applications should not be exposed to -# the world. -#single_user = - -# Administrative users - set this to a comma-separated list of valid Galaxy -# users (email addresses). These users will have access to the Admin section -# of the server, and will have access to create users, groups, roles, -# libraries, and more. For more information, see: -# https://galaxyproject.org/admin/ -#admin_users = None - -# Force everyone to log in (disable anonymous access). -#require_login = False - -# Show the site's welcome page (see welcome_url) alongside the login page -# (even if require_login is True) -#show_welcome_with_login = False - -# Allow unregistered users to create new accounts (otherwise, they will have to -# be created by an admin). -#allow_user_creation = True - -# Allow administrators to delete accounts. -#allow_user_deletion = False - -# Allow administrators to log in as other users (useful for debugging) -#allow_user_impersonation = False - -# Allow users to remove their datasets from disk immediately (otherwise, -# datasets will be removed after a time period specified by an administrator in -# the cleanup scripts run via cron) -#allow_user_dataset_purge = True - -# By default, users' data will be public, but setting this to True will cause -# it to be private. Does not affect existing users and data, only ones created -# after this option is set. Users may still change their default back to -# public. -#new_user_dataset_access_role_default_private = False - -# Expose user list. Setting this to True will expose the user list to -# authenticated users. This makes sharing datasets in smaller galaxy instances -# much easier as they can type a name/email and have the correct user show up. -# This makes less sense on large public Galaxy instances where that data -# shouldn't be exposed. For semi-public Galaxies, it may make sense to expose -# just the username and not email, or vice versa. -#expose_user_name = False -#expose_user_email = False - -# Whitelist for local network addresses for "Upload from URL" dialog. -# By default, Galaxy will deny access to the local network address space, to -# prevent users making requests to services which the administrator did not -# intend to expose. Previously, you could request any network service that -# Galaxy might have had access to, even if the user could not normally access it. -# It should be a comma separated list of IP addresses or IP address/mask, e.g. -# 10.10.10.10,10.0.1.0/24,fd00::/8 -#fetch_url_whitelist= - -# Enable the new interface for installing tools from Tool Shed -# via the API. Admin menu will list both if enabled. -#enable_beta_ts_api_install = True - -# Enable the new container interface for Interactive Environments -#enable_beta_containers_interface = False - -# Set the following to a number of threads greater than 1 to spawn -# a Python task queue for dealing with large tool submissions (either -# through the tool form or as part of an individual workflow step across -# large collection). This affects workflow scheduling and web processes, -# not job handlers. This is a beta option and should not be used in production. -#tool_submission_burst_threads = 1 - -# If tool_submission_burst_threads is set to a number greater than 1, this -# is the number of jobs to schedule at which the task queue will be created. -#tool_submission_burst_at = 10 - -# Enable beta workflow modules that should not yet be considered part of Galaxy's -# stable API. -#enable_beta_workflow_modules = False - -# Following options only apply to workflows scheduled using the legacy workflow -# run API (running workflows via a POST to /api/workflows). -# Force usage of Galaxy's beta workflow scheduler under certain circumstances - -# this workflow scheduling forces Galaxy to schedule workflows in the background -# so initial submission of the workflows is significantly sped up. This does -# however force the user to refresh their history manually to see newly scheduled -# steps (for "normal" workflows - steps are still scheduled far in advance of -# them being queued and scheduling here doesn't refer to actual cluster job -# scheduling). -# Workflows containing more than the specified number of steps will always use -# the Galaxy's beta workflow scheduling. -#force_beta_workflow_scheduled_min_steps=250 -# Switch to using Galaxy's beta workflow scheduling for all workflows involving -# collections. -#force_beta_workflow_scheduled_for_collections=False - -# If multiple job handlers are enabled, allow Galaxy to schedule workflow invocations -# in multiple handlers simultaneously. This is discouraged because it results in a -# less predictable order of workflow datasets within in histories. -#parallelize_workflow_scheduling_within_histories = False - -# This is the maximum amount of time a workflow invocation may stay in an active -# scheduling state in seconds. Set to -1 to disable this maximum and allow any workflow -# invocation to schedule indefinitely. The default corresponds to 1 month. -#maximum_workflow_invocation_duration = 2678400 - -# Specify a maximum number of jobs that any given workflow scheduling iteration can create. -# Set this to a positive integer to prevent large collection jobs in a workflow from -# preventing other jobs from executing. This may also mitigate memory issues associated with -# scheduling workflows at the expense of increased total DB traffic because model objects -# are expunged from the SQL alchemy session between workflow invocation scheduling iterations. -# Set to -1 to disable any such maximum (the default). -#maximum_workflow_jobs_per_scheduling_iteration = -1 - -# Force serial scheduling of workflows within the context of a particular history -#history_local_serial_workflow_scheduling=False - -# Enable authentication via OpenID. Allows users to log in to their Galaxy -# account by authenticating with an OpenID provider. -#enable_openid = False - -# If OpenID is enabled, this configuration file specifies providers to use. -# Falls back to the .sample variant in config if default does not exist. -#openid_config_file = config/openid_conf.xml - -# If OpenID is enabled, consumer cache directory to use. -#openid_consumer_cache_path = database/openid_consumer_cache - -# XML config file that allows the use of different authentication providers -# (e.g. LDAP) instead or in addition to local authentication (.sample is used -# if default does not exist). -#auth_config_file = config/auth_conf.xml - -# Optional list of email addresses of API users who can make calls on behalf of -# other users. -#api_allow_run_as = None - -# Master key that allows many API admin actions to be used without actually -# having a defined admin user in the database/config. Only set this if you -# need to bootstrap Galaxy, you probably do not want to set this on public -# servers. -#master_api_key = changethis - -# Enable tool tags (associating tools with tags). This has its own option -# since its implementation has a few performance implications on startup for -# large servers. -#enable_tool_tags = False - -# Enable a feature when running workflows. When enabled, default datasets -# are selected for "Set at Runtime" inputs from the history such that the -# same input will not be selected twice, unless there are more inputs than -# compatible datasets in the history. -# When False, the most recently added compatible item in the history will -# be used for each "Set at Runtime" input, independent of others in the Workflow -#enable_unique_workflow_defaults = False - -# The URL to the myExperiment instance being used (omit scheme but include port) -#myexperiment_url = www.myexperiment.org:80 - -# Enable Galaxy's "Upload via FTP" interface. You'll need to install and -# configure an FTP server (we've used ProFTPd since it can use Galaxy's -# database for authentication) and set the following two options. -# This should point to a directory containing subdirectories matching users' -# identifier (defaults to e-mail), where Galaxy will look for files. -#ftp_upload_dir = None - -# This should be the hostname of your FTP server, which will be provided to -# users in the help text. -#ftp_upload_site = None - -# User attribute to use as subdirectory in calculating default ftp_upload_dir -# pattern. By default this will be email so a user's FTP upload directory will be -# ${ftp_upload_dir}/${user.email}. Can set this to other attributes such as id or -# username though. -#ftp_upload_dir_identifier = email - -# Python string template used to determine an FTP upload directory for a -# particular user. -#ftp_upload_dir_template = ${ftp_upload_dir}/${ftp_upload_dir_identifier} - -# This should be set to False to prevent Galaxy from deleting uploaded FTP files -# as it imports them. -#ftp_upload_purge = True - -# Enable enforcement of quotas. Quotas can be set from the Admin interface. -#enable_quotas = False - -# This option allows users to see the full path of datasets via the "View -# Details" option in the history. This option also exposes the command line to -# non-administrative users. Administrators can always see dataset paths. -#expose_dataset_path = False - -# This option allows users to see the job metrics (except for environment -# variables). -#expose_potentially_sensitive_job_metrics = False - -# Enable the API for sample tracking -#enable_legacy_sample_tracking_api = False - -# Allow non-admin users to view available Data Manager options. -#enable_data_manager_user_view = False - -# File where Data Managers are configured (.sample used if default does not -# exist). -#data_manager_config_file = config/data_manager_conf.xml - -# File where Tool Shed based Data Managers are configured. -#shed_data_manager_config_file = config/shed_data_manager_conf.xml - -# Directory to store Data Manager based tool-data; defaults to tool_data_path. -#galaxy_data_manager_data_path = tool-data - -# To increase performance of job execution and the web interface, you can -# separate Galaxy into multiple processes. There are more than one way to do -# this, and they are explained in detail in the documentation: -# -# https://galaxyproject.org/admin/config/performance/scaling -# -# By default, Galaxy manages and executes jobs from within a single process and -# notifies itself of new jobs via in-memory queues. Jobs are run locally on -# the system on which Galaxy is started. Advanced job running capabilities can -# be configured through the job configuration file. -#job_config_file = config/job_conf.xml - -# When jobs fail due to job runner problems, Galaxy can be configured to retry -# these or reroute the jobs to new destinations. Very fine control of this is -# available with resubmit declarations in job_conf.xml. For simple deployments -# of Galaxy though, the following attribute can define resubmission conditions -# for all job destinations. If any job destination defines even one -# resubmission condition explicitly in job_conf.xml - the condition described -# by this option will not apply to that destination. For instance, the condition: -# 'attempt < 3 and unknown_error and (time_running < 300 or time_since_queued < 300)' -# would retry up to two times jobs that didn't fail due to detected memory or -# walltime limits but did fail quickly (either while queueing or running). The -# commented out default below results in no default job resubmission condition, -# failing jobs are just failed outright. -#default_job_resubmission_condition = - -# In multiprocess configurations, notification between processes about new jobs -# must be done via the database. In single process configurations, this can be -# done in memory, which is a bit quicker. -#track_jobs_in_database = True - -# This enables splitting of jobs into tasks, if specified by the particular tool -# config. -# This is a new feature and not recommended for production servers yet. -#use_tasked_jobs = False -#local_task_queue_workers = 2 - -# Enable job recovery (if Galaxy is restarted while cluster jobs are running, -# it can "recover" them when it starts). This is not safe to use if you are -# running more than one Galaxy server using the same database. -#enable_job_recovery = True - -# Although it is fairly reliable, setting metadata can occasionally fail. In -# these instances, you can choose to retry setting it internally or leave it in -# a failed state (since retrying internally may cause the Galaxy process to be -# unresponsive). If this option is set to False, the user will be given the -# option to retry externally, or set metadata manually (when possible). -#retry_metadata_internally = True - -# Very large metadata values can cause Galaxy crashes. This will allow -# limiting the maximum metadata key size (in bytes used in memory, not the end -# result database value size) Galaxy will attempt to save with a dataset. Use -# 0 to disable this feature. The default is 5MB, but as low as 1MB seems to be -# a reasonable size. -#max_metadata_value_size = 5242880 - -# If (for example) you run on a cluster and your datasets (by default, -# database/files/) are mounted read-only, this option will override tool output -# paths to write outputs to the working directory instead, and the job manager -# will move the outputs to their proper place in the dataset directory on the -# Galaxy server after the job completes. -#outputs_to_working_directory = False - -# If your network filesystem's caching prevents the Galaxy server from seeing -# the job's stdout and stderr files when it completes, you can retry reading -# these files. The job runner will retry the number of times specified below, -# waiting 1 second between tries. For NFS, you may want to try the -noac mount -# option (Linux) or -actimeo=0 (Solaris). -#retry_job_output_collection = 0 - -# In the past Galaxy would preserve its Python environment when running jobs ( -# and still does for internal tools packaged with Galaxy). This behavior exposes -# Galaxy internals to tools and could result in problems when activating -# Python environments for tools (such as with Conda packaging). The default -# legacy_only will restrict this behavior to tools identified by the Galaxy -# team as requiring this environment. Set this to "always" to restore the -# previous behavior (and potentially break Conda dependency resolution for many -# tools). Set this to legacy_and_local to preserve the environment for legacy -# tools and locally managed tools (this might be useful for instance if you are -# installing software into Galaxy's virtualenv for tool development). -#preserve_python_environment = legacy_only - -# Clean up various bits of jobs left on the filesystem after completion. These -# bits include the job working directory, external metadata temporary files, -# and DRM stdout and stderr files (if using a DRM). Possible values are: -# always, onsuccess, never -#cleanup_job = always - -# When running DRMAA jobs as the Galaxy user -# (https://galaxyproject.org/admin/config/performance/cluster/#submitting-jobs-as-the-real-user) -# this script is used to run the job script Galaxy generates for a tool execution. -#drmaa_external_runjob_script = sudo -E scripts/drmaa_external_runner.py --assign_all_groups - -# When running DRMAA jobs as the Galaxy user -# (https://galaxyproject.org/admin/config/performance/cluster/#submitting-jobs-as-the-real-user) -# this script is used to kill such jobs by Galaxy (e.g. if the user cancels -# the job). -#drmaa_external_killjob_script = sudo -E scripts/drmaa_external_killer.py - -# When running DRMAA jobs as the Galaxy user -# (https://galaxyproject.org/admin/config/performance/cluster/#submitting-jobs-as-the-real-user) -# this script is used transfer permissions back and forth between the Galaxy user -# and the user that is running the job. -#external_chown_script = sudo -E scripts/external_chown_script.py - -# When running DRMAA jobs as the Galaxy user -# (https://galaxyproject.org/admin/config/performance/cluster/#submitting-jobs-as-the-real-user) -# Galaxy can extract the user name from the email address (actually the local-part before the @) -# or the username which are both stored in the Galaxy data base. -# The latter option is particularly useful for installations that get the -# authentication from LDAP. -# Also, Galaxy can accept the name of a common system user (eg. galaxy_worker) -# who can run every job being submitted. This user should not be the same user -# running the galaxy system. -# Possible values are user_email (default), username or -#real_system_username = user_email - -# File to source to set up the environment when running jobs. By default, the -# environment in which the Galaxy server starts is used when running jobs -# locally, and the environment set up per the DRM's submission method and -# policy is used when running jobs on a cluster (try testing with `qsub` on the -# command line). environment_setup_file can be set to the path of a file on -# the cluster that should be sourced by the user to set up the environment -# prior to running tools. This can be especially useful for running jobs as -# the actual user, to remove the need to configure each user's environment -# individually. -#environment_setup_file = None - -# Optional file containing job resource data entry fields definition. -# These fields will be presented to users in the tool forms and allow them to -# overwrite default job resources such as number of processors, memory and -# walltime. -#job_resource_params_file = config/job_resource_params_conf.xml - -# If using job concurrency limits (configured in job_config_file), several -# extra database queries must be performed to determine the number of jobs a -# user has dispatched to a given destination. By default, these queries will -# happen for every job that is waiting to run, but if cache_user_job_count is -# set to True, it will only happen once per iteration of the handler queue. -# Although better for performance due to reduced queries, the trade-off is a -# greater possibility that jobs will be dispatched past the configured limits -# if running many handlers. -#cache_user_job_count = False - -# Define toolbox filters (https://galaxyproject.org/user-defined-toolbox-filters/) -# that admins may use to restrict the tools to display. -#tool_filters = - -# Define toolbox filters (https://galaxyproject.org/user-defined-toolbox-filters/) -# that admins may use to restrict the tool labels to display. -#tool_label_filters = - -# Define toolbox filters (https://galaxyproject.org/user-defined-toolbox-filters/) -# that admins may use to restrict the tool sections to display. -#tool_section_filters = - -# Define toolbox filters (https://galaxyproject.org/user-defined-toolbox-filters/) -# that users may use to restrict the tools to display. -#user_tool_filters = examples:restrict_upload_to_admins, examples:restrict_encode - -# Define toolbox filters (https://galaxyproject.org/user-defined-toolbox-filters/) -# that users may use to restrict the tool sections to display. -#user_tool_section_filters = examples:restrict_text - -# Define toolbox filters (https://galaxyproject.org/user-defined-toolbox-filters/) -# that users may use to restrict the tool labels to display. -#user_tool_label_filters = examples:restrict_upload_to_admins, examples:restrict_encode - -# The base module(s) that are searched for modules for toolbox filtering -# (https://galaxyproject.org/user-defined-toolbox-filters/) producedures. -#toolbox_filter_base_modules = galaxy.tools.toolbox.filters,galaxy.tools.filters - -# Galaxy uses AMQP internally for communicating between processes. For -# example, when reloading the toolbox or locking job execution, the process -# that handled that particular request will tell all others to also reload, -# lock jobs, etc. -# For connection examples, see http://docs.celeryproject.org/projects/kombu/en/latest/userguide/connections.html -# -# Without specifying anything here, galaxy will first attempt to use your -# specified database_connection above. If that's not specified either, Galaxy -# will automatically create and use a separate sqlite database located in your -# /database folder (indicated in the commented out line below). -#amqp_internal_connection = sqlalchemy+sqlite:///./database/control.sqlite?isolation_level=IMMEDIATE - -# Galaxy real time communication server settings -#enable_communication_server = False -#communication_server_host = http://localhost -#communication_server_port = 7070 - -# persistent_communication_rooms is a comma-separated list of rooms that should be always available. -#persistent_communication_rooms = From 8a9dc5907d377819989d9c0165929c0f378d0559 Mon Sep 17 00:00:00 2001 From: John Chilton Date: Thu, 30 Nov 2017 08:31:13 -0500 Subject: [PATCH 018/112] yaml_config - Add entry points (e.g. Makefile) for dealing with Galaxy YAML configs. --- Makefile | 18 ++++++++++++++++++ lib/galaxy/webapps/galaxy/uwsgi_schema.yml | 1 + 2 files changed, 19 insertions(+) create mode 120000 lib/galaxy/webapps/galaxy/uwsgi_schema.yml diff --git a/Makefile b/Makefile index d8855493085..f9c10581296 100644 --- a/Makefile +++ b/Makefile @@ -92,6 +92,24 @@ reports-config-lint: ## lint reports YAML configuration file reports-config-rebuild-rst: ## Rebuild sample reports RST docs $(CONFIG_MANAGE) build_rst reports > doc/source/admin/reports_options.rst +config-validate: ## validate galaxy YAML configuration file + $(CONFIG_MANAGE) validate galaxy + +config-convert-dry-run: ## convert old style galaxy ini to yaml (dry run) + $(CONFIG_MANAGE) convert galaxy --dry-run + +config-convert: ## convert old style galaxy ini to yaml + $(CONFIG_MANAGE) convert galaxy + +config-rebuild-sample: ## Rebuild sample galaxy yaml file from schema + $(CONFIG_MANAGE) build_sample_yaml galaxy --add-comments + +config-lint: ## lint galaxy YAML configuration file + $(CONFIG_MANAGE) lint galaxy + +config-rebuild-rst: ## Rebuild sample galaxy RST docs + $(CONFIG_MANAGE) build_rst galaxy > doc/source/admin/galaxy_options.rst + release-ensure-upstream: ## Ensure upstream branch for release commands setup ifeq (shell git remote -v | grep $(RELEASE_UPSTREAM), ) git remote add $(RELEASE_UPSTREAM) git@github.com:galaxyproject/galaxy.git diff --git a/lib/galaxy/webapps/galaxy/uwsgi_schema.yml b/lib/galaxy/webapps/galaxy/uwsgi_schema.yml new file mode 120000 index 00000000000..7d0729284c9 --- /dev/null +++ b/lib/galaxy/webapps/galaxy/uwsgi_schema.yml @@ -0,0 +1 @@ +../uwsgi_schema.yml \ No newline at end of file From d08dc05d9588e24a31de3a4a1ba9a07b42ae2e2e Mon Sep 17 00:00:00 2001 From: John Chilton Date: Thu, 30 Nov 2017 13:04:59 -0500 Subject: [PATCH 019/112] yaml_config - Generate Galaxy yaml sample. --- config/galaxy.yml.sample | 1590 ++++++++++++++++++++++++++++++++++++++ 1 file changed, 1590 insertions(+) create mode 100644 config/galaxy.yml.sample diff --git a/config/galaxy.yml.sample b/config/galaxy.yml.sample new file mode 100644 index 00000000000..011d98383ee --- /dev/null +++ b/config/galaxy.yml.sample @@ -0,0 +1,1590 @@ +# Galaxy is configured by default to be usable in a single-user development +# environment. To tune the application for a multi-user production +# environment, see the documentation at: +# +# http://usegalaxy.org/production +# +# Throughout this sample configuration file, except where stated otherwise, +# uncommented values override the default if left unset, whereas commented +# values are set to the default value. Relative paths are relative to the root +# Galaxy directory. +# +# Examples of many of these options are explained in more detail in the Galaxy +# Community Hub. +# +# https://galaxyproject.org/admin/config +# +# Config hackers are encouraged to check there before asking for help. +# +uwsgi: + + # The address and port on which to listen. By default, only listen to + # localhost (galaxy will not be accessible over the network). Use + # '0.0.0.0' to listen on all available network interfaces. + http: 127.0.0.1:8080 + + threads: 8 + + http-raw-body: True + + offload-threads: 8 + + module: galaxy.webapps.galaxy.buildapp:uwsgi_app() + +galaxy: + + # If running behind a proxy server and Galaxy is served from a + # subdirectory, enable the proxy-prefix filter and set the prefix in + # the [filter:proxy-prefix] section above. + #filter-with: proxy-prefix + + # If proxy-prefix is enabled and you're running more than one Galaxy + # instance behind one hostname, you will want to set this to the same + # path as the prefix in the filter above. This value becomes the + # "path" attribute set in the cookie so the cookies from each instance + # will not clobber each other. + #cookie_path: null + + # By default, Galaxy uses a SQLite database at + # 'database/universe.sqlite'. You may use a SQLAlchemy connection + # string to specify an external database instead. This string takes + # many options which are explained in detail in the config file + # documentation. + #database_connection: 'sqlite:///./database/universe.sqlite?isolation_level=IMMEDIATE' + + # If the server logs errors about not having enough database pool + # connections, you will want to increase these values, or consider + # running more Galaxy processes. + #database_engine_option_pool_size: 5 + + # If the server logs errors about not having enough database pool + # connections, you will want to increase these values, or consider + # running more Galaxy processes. + #database_engine_option_max_overflow: 10 + + # If using MySQL and the server logs the error "MySQL server has gone + # away", you will want to set this to some positive value (7200 should + # work). + #database_engine_option_pool_recycle: -1 + + # If large database query results are causing memory or response time + # issues in the Galaxy process, leave the result on the server + # instead. This option is only available for PostgreSQL and is highly + # recommended. + #database_engine_option_server_side_cursors: false + + # Log all database transactions, can be useful for debugging and + # performance profiling. Logging is done via Python's 'logging' + # module under the qualname + # 'galaxy.model.orm.logging_connection_proxy' + #database_query_profiling_proxy: false + + # If auto-creating a postgres database on startup - it can be based on + # an existing template database. This will set that. This is probably + # only useful for testing but documentation is included here for + # completeness. + #database_template: null + + # Slow query logging. Queries slower than the threshold indicated + # below will be logged to debug. A value of '0' is disabled. For + # example, you would set this to .005 to log all queries taking longer + # than 5 milliseconds. + #slow_query_log_threshold: 0 + + # By default, Galaxy will use the same database to track user data and + # tool shed install data. There are many situations in which it is + # valuable to separate these - for instance bootstrapping fresh Galaxy + # instances with pretested installs. The following option can be used + # to separate the tool shed install database (all other options listed + # above but prefixed with install_ are also available). + #install_database_connection: 'sqlite:///./database/universe.sqlite?isolation_level=IMMEDIATE' + + # Setting the following option to true will cause Galaxy to + # automatically migrate the database forward after updates. This is + # not recommended for production use. + #database_auto_migrate: false + + # Dataset files are stored in this directory. + #file_path: database/files + + # Temporary files are stored in this directory. + #new_file_path: database/tmp + + # Tool config files, defines what tools are available in Galaxy. Tools + # can be locally developed or installed from Galaxy tool sheds. + # (config/tool_conf.xml.sample will be used if left unset and + # config/tool_conf.xml does not exist). + #tool_config_file: 'config/tool_conf.xml,config/shed_tool_conf.xml' + + # Enable / disable checking if any tools defined in the above non-shed + # tool_config_files (i.e., tool_conf.xml) have been migrated from the + # Galaxy code distribution to the Tool Shed. This setting should + # generally be set to False only for development Galaxy environments + # that are often rebuilt from scratch where migrated tools do not need + # to be available in the Galaxy tool panel. If the following setting + # remains commented, the default setting will be True. + #check_migrate_tools: true + + # Tool config maintained by tool migration scripts. If you use the + # migration scripts to install tools that have been migrated to the + # tool shed upon a new release, they will be added to this tool config + # file. + #migrated_tools_config: config/migrated_tools_conf.xml + + # File that contains the XML section and tool tags from all tool panel + # config files integrated into a single file that defines the tool + # panel layout. This file can be changed by the Galaxy administrator + # to alter the layout of the tool panel. If not present, Galaxy will + # create it. + #integrated_tool_panel_config: integrated_tool_panel.xml + + # Default path to the directory containing the tools defined in + # tool_conf.xml. Other tool config files must include the tool_path as + # an attribute in the tag. + #tool_path: tools + + # Path to the directory in which tool dependencies are placed. This + # is used by the Tool Shed to install dependencies and can also be + # used by administrators to manually install or link to dependencies. + # For details, see: https://galaxyproject.org/admin/config/tool- + # dependencies Set the string to None to explicitly disable tool + # dependency handling. If this option is set to none or an invalid + # path, installing tools with dependencies from the Tool Shed will + # fail. + #tool_dependency_dir: database/dependencies + + # The dependency resolvers config file specifies an ordering and + # options for how Galaxy resolves tool dependencies (requirement tags + # in Tool XML). The default ordering is to the use the Tool Shed for + # tools installed that way, use local Galaxy packages, and then use + # Conda if available. See https://github.com/galaxyproject/galaxy/blob + # /dev/doc/source/admin/dependency_resolvers.rst for more information + # on these options. + #dependency_resolvers_config_file: config/dependency_resolvers_conf.xml + + # conda_prefix is the location on the filesystem where Conda packages + # and environments are installed IMPORTANT: Due to a current + # limitation in conda, the total length of the conda_prefix and the + # job_working_directory path should be less than 50 characters! + #conda_prefix: /_conda + + # Override the Conda executable to use, it will default to the one on + # the PATH (if available) and then to /bin/conda + #conda_exec: null + + # Pass debug flag to conda commands. + #conda_debug: false + + # conda channels to enable by default (http://conda.pydata.org/docs + # /custom-channels.html) + #conda_ensure_channels: 'iuc,bioconda,conda-forge,defaults,r' + + # Set to True to instruct Galaxy to look for and install missing tool + # dependencies before each job runs. + #conda_auto_install: false + + # Set to True to instruct Galaxy to install Conda from the web + # automatically if it cannot find a local copy and conda_exec is not + # configured. + #conda_auto_init: true + + # You must set this to True if conda_prefix and job_working_directory + # are not on the same volume, or some conda dependencies will fail to + # execute at job runtime. Conda will copy packages content instead of + # creating hardlinks or symlinks. This will prevent problems with some + # specific packages (perl, R), at the cost of extra disk space usage + # and extra time spent copying packages. + #conda_copy_dependencies: false + + # Certain dependency resolvers (namely Conda) take a considerable + # amount of time to build an isolated job environment in the + # job_working_directory if the job working directory is on a network + # share. Set the following option to True to cache the dependencies + # in a folder. This option is beta and should only be used if you + # experience long waiting times before a job is actually submitted to + # your cluster. + #use_cached_dependency_manager: false + + # By default the tool_dependency_cache_dir is the _cache directory of + # the tool dependency directory + #tool_dependency_cache_dir: /_cache + + # By default, when using a cached dependency manager, the dependencies + # are cached when installing new tools and when using tools for the + # first time. Set this to False if you prefer dependencies to be + # cached only when installing new tools. + #precache_dependencies: true + + # File containing the Galaxy Tool Sheds that should be made available + # to install from in the admin interface (.sample used if default does + # not exist). + #tool_sheds_config_file: config/tool_sheds_conf.xml + + # Set to True to enable monitoring of tools and tool directories + # listed in any tool config file specified in tool_config_file option. + # If changes are found, tools are automatically reloaded. Watchdog ( + # https://pypi.python.org/pypi/watchdog ) must be installed and + # available to Galaxy to use this option. Other options include 'auto' + # which will attempt to watch tools if the watchdog library is + # available but won't fail to load Galaxy if it is not and 'polling' + # which will use a less efficient monitoring scheme that may work in + # wider range of scenarios than the watchdog default. + #watch_tools: false + + # Enable Galaxy to fetch Docker containers registered with quay.io + # generated from tool requirements resolved through conda. These + # containers (when available) have been generated using mulled - + # https://github.com/mulled. These containers are highly beta and + # availability will vary by tool. This option will additionally only + # be used for job destinations with Docker enabled. + #enable_beta_mulled_containers: false + + # Container resolvers configuration (beta). Setup a file describing + # container resolvers to use when discovering containers for Galaxy. + # If this is set to None, the default containers loaded is determined + # by enable_beta_mulled_containers. + #containers_resolvers_config_file: null + + # involucro is a tool used to build Docker containers for tools from + # Conda dependencies referenced in tools as `requirement`s. The + # following path is the location of involucro on the Galaxy host. This + # is ignored if the relevant container resolver isn't enabled, and + # will install on demand unless involucro_auto_init is set to False. + #involucro_path: database/dependencies/involucro + + # Install involucro as needed to build Docker containers for tools. + # Ignored if relevant container resolver is not used. + #involucro_auto_init: true + + # Enable automatic polling of relative tool sheds to see if any + # updates are available for installed repositories. Ideally only one + # Galaxy server process should be able to check for repository + # updates. The setting for hours_between_check should be an integer + # between 1 and 24. + #enable_tool_shed_check: false + + # Enable automatic polling of relative tool sheds to see if any + # updates are available for installed repositories. Ideally only one + # Galaxy server process should be able to check for repository + # updates. The setting for hours_between_check should be an integer + # between 1 and 24. + #hours_between_check: 12 + + # Enable use of an in-memory registry with bi-directional + # relationships between repositories (i.e., in addition to lists of + # dependencies for a repository, keep an in-memory registry of + # dependent items for each repository. + #manage_dependency_relationships: false + + # XML config file that contains data table entries for the + # ToolDataTableManager. This file is manually # maintained by the + # Galaxy administrator (.sample used if default does not exist). + #tool_data_table_config_path: config/tool_data_table_conf.xml + + # XML config file that contains additional data table entries for the + # ToolDataTableManager. This file is automatically generated based on + # the current installed tool shed repositories that contain valid + # tool_data_table_conf.xml.sample files. At the time of installation, + # these entries are automatically added to the following file, which + # is parsed and applied to the ToolDataTableManager at server start + # up. + #shed_tool_data_table_config: config/shed_tool_data_table_conf.xml + + # Directory where data used by tools is located. See the samples in + # that directory and the Galaxy Community Hub for help: + # https://galaxyproject.org/admin/data-integration + #tool_data_path: tool-data + + # Directory where Tool Data Table related files will be placed when + # installed from a ToolShed. Defaults to tool_data_path. + #shed_tool_data_path: tool-data + + # Set to True to enable monitoring of the tool_data and + # shed_tool_data_path directories. If changes in tool data table files + # are found, the tool data tables for that data manager are + # automatically reloaded. Watchdog ( + # https://pypi.python.org/pypi/watchdog ) must be installed and + # available to Galaxy to use this option. Other options include 'auto' + # which will attempt to use the watchdog library if it is available + # but won't fail to load Galaxy if it is not and 'polling' which will + # use a less efficient monitoring scheme that may work in wider range + # of scenarios than the watchdog default. + #watch_tool_data_dir: false + + # File containing old-style genome builds + #builds_file_path: tool-data/shared/ucsc/builds.txt + + # Directory where chrom len files are kept, currently mainly used by + # trackster + #len_file_path: tool-data/shared/ucsc/chrom + + # Datatypes config file(s), defines what data (file) types are + # available in Galaxy (.sample is used if default does not exist). If + # a datatype appears in multiple files, the last definition is used + # (though the first sniffer is used so limit sniffer definitions to + # one file). + #datatypes_config_file: config/datatypes_conf.xml + + # Disable the 'Auto-detect' option for file uploads + #datatypes_disable_auto: false + + # Visualizations config directory: where to look for individual + # visualization plugins. The path is relative to the Galaxy root dir. + # To use an absolute path begin the path with '/'. This is a comma + # separated list. Defaults to "config/plugins/visualizations". + #visualization_plugins_directory: config/plugins/visualizations + + # Interactive environment plugins root directory: where to look for + # interactive environment plugins. By default none will be loaded. + # Set to config/plugins/interactive_environments to load Galaxy's + # stock plugins. These will require Docker to be configured and have + # security considerations, so proceed with caution. The path is + # relative to the Galaxy root dir. To use an absolute path begin the + # path with '/'. This is a comma separated list. + #interactive_environment_plugins_directory: null + + # To run interactive environment containers in Docker Swarm mode (on + # an existing swarm), set this option to True and set + # `docker_connect_port` in the IE plugin config (ini) file(s) of any + # IE plugins you have enabled and ensure that you are not using any + # `docker run`-specific options in your plugins' `command_inject` + # options (swarm mode services run using `docker service create`, + # which has a different and more limited set of options). This option + # can be overridden on a per-plugin basis by using the `swarm_mode` + # option in the plugin's ini config file. + #interactive_environment_swarm_mode: false + + # Galaxy can run a "swarm manager" service that will monitor + # utilization of the swarm and provision/deprovision worker nodes as + # necessary. The service has its own configuration file. + #swarm_manager_config_file: config/swarm_manager_conf.yml + + # Interactive tour directory: where to store interactive tour + # definition files. Galaxy ships with several basic interface tours + # enabled, though a different directory with custom tours can be + # specified here. The path is relative to the Galaxy root dir. To use + # an absolute path begin the path with '/'. This is a comma separated + # list. + #tour_config_dir: config/plugins/tours + + # Webhooks directory: where to store webhooks - plugins to extend the + # Galaxy UI. By default none will be loaded. Set to + # config/plugins/webhooks/demo to load Galaxy's demo webhooks. To use + # an absolute path begin the path with '/'. This is a comma separated + # list. Add test/functional/webhooks to this list to include the demo + # webhooks used to test the webhook framework. + #webhooks_dir: config/plugins/webhooks + + # Each job is given a unique empty directory as its current working + # directory. This option defines in what parent directory those + # directories will be created. + #job_working_directory: database/jobs_directory + + # If using a cluster, Galaxy will write job scripts and stdout/stderr + # to this directory. + #cluster_files_directory: database/pbs + + # Mako templates are compiled as needed and cached for reuse, this + # directory is used for the cache + #template_cache_path: database/compiled_templates + + # Set to false to disable various checks Galaxy will do to ensure it + # can run job scripts before attempting to execute or submit them. + #check_job_script_integrity: true + + # Number of checks to execute if check_job_script_integrity is + # enabled. + #check_job_script_integrity_count: 35 + + # Time to sleep between checks if check_job_script_integrity is + # enabled (in seconds). + #check_job_script_integrity_sleep: 0.25 + + # Set the default shell used by non-containerized jobs Galaxy-wide. + # This defaults to bash for all jobs and can be overridden at the + # destination level for heterogeneous clusters. conda job resolution + # requires bash or zsh so if this is switched to /bin/sh for instance + # - conda resolution should be disabled. Containerized jobs always use + # /bin/sh - so more maximum portability tool authors should assume + # generated commands run in sh. + #default_job_shell: /bin/bash + + # Citation related caching. Tool citations information maybe fetched + # from external sources such as http://dx.doi.org/ by Galaxy - the + # following parameters can be used to control the caching used to + # store this information. + #citation_cache_type: file + + # Citation related caching. Tool citations information maybe fetched + # from external sources such as http://dx.doi.org/ by Galaxy - the + # following parameters can be used to control the caching used to + # store this information. + #citation_cache_data_dir: database/citations/data + + # Citation related caching. Tool citations information maybe fetched + # from external sources such as http://dx.doi.org/ by Galaxy - the + # following parameters can be used to control the caching used to + # store this information. + #citation_cache_lock_dir: database/citations/lock + + # Tools with a number of outputs not known until runtime can write + # these outputs to a directory for collection by Galaxy when the job + # is done. Previously, this directory was new_file_path, but using one + # global directory can cause performance problems, so using + # job_working_directory ('.' or cwd when a job is run) is encouraged. + # By default, both are checked to avoid breaking existing tools. + #collect_outputs_from: 'new_file_path,job_working_directory' + + # Configuration file for the object store If this is set and exists, + # it overrides any other objectstore settings. + #object_store_config_file: config/object_store_conf.xml + + # Galaxy sends mail for various things: subscribing users to the + # mailing list if they request it, password resets, reporting dataset + # errors, and sending activation emails. To do this, it needs to send + # mail through an SMTP server, which you may define here (host:port). + # Galaxy will automatically try STARTTLS but will continue upon + # failure. + #smtp_server: null + + # If your SMTP server requires a username and password, you can + # provide them here (password in cleartext here, but if your server + # supports STARTTLS it will be sent over the network encrypted). + #smtp_username: null + + # If your SMTP server requires a username and password, you can + # provide them here (password in cleartext here, but if your server + # supports STARTTLS it will be sent over the network encrypted). + #smtp_password: null + + # If your SMTP server requires SSL from the beginning of the + # connection + #smtp_ssl: false + + # On the user registration form, users may choose to join a mailing + # list. This is the address used to subscribe to the list. Uncomment + # and leave empty if you want to remove this option from the user + # registration form. + #mailing_join_addr: galaxy-announce-join@bx.psu.edu + + # Datasets in an error state include a link to report the error. + # Those reports will be sent to this address. Error reports are + # disabled if no address is set. Also this email is shown as a + # contact to user in case of Galaxy misconfiguration and other events + # user may encounter. + #error_email_to: null + + # Email address to use in the 'From' field when sending emails for + # account activations, workflow step notifications and password + # resets. We recommend using string in the following format: Galaxy + # Project If not configured, '' will be used. + #email_from: null + + # URL of the support resource for the galaxy instance. Used in + # activation emails. + #instance_resource_url: 'https://galaxyproject.org/' + + # E-mail domains blacklist is used for filtering out users that are + # using disposable email address during the registration. If their + # address domain matches any domain in the blacklist, they are refused + # the registration. + #blacklist_file: config/disposable_email_blacklist.conf + + # Registration warning message is used to discourage people from + # registering multiple accounts. Applies mostly for the main Galaxy + # instance. If no message specified the warning box will not be shown. + #registration_warning_message: Please register only one account - we provide this service free of charge and have limited computational resources. Multi-accounts are tracked and will be subjected to account termination and data deletion. + + # User account activation feature global flag. If set to "False", the + # rest of the Account activation configuration is ignored and user + # activation is disabled (i.e. accounts are active since + # registration). The activation is also not working in case the SMTP + # server is not defined. + #user_activation_on: false + + # Activation grace period (in hours). Activation is not forced (login + # is not disabled) until grace period has passed. Users under grace + # period can't run jobs. Enter 0 to disable grace period. Users with + # OpenID logins have grace period forever. + #activation_grace_period: 3 + + # Shown in warning box to users that were not activated yet. In use + # only if activation_grace_period is set. + #inactivity_box_content: 'Your account has not been activated yet. Feel free to browse around and see what''s available, but you won''t be able to upload data or run jobs until you have verified your email address.' + + # Password expiration period (in days). Users are required to change + # their password every x days. Users will be redirected to the change + # password screen when they log in after their password expires. Enter + # 0 to disable password expiration. + #password_expiration_period: 0 + + # Galaxy Session Timeout This provides a timeout (in minutes) after + # which a user will have to log back in. A duration of 0 disables this + # feature. + #session_duration: 0 + + # You can enter tracking code here to track visitor's behavior through + # your Google Analytics account. Example: UA-XXXXXXXX-Y + #ga_code: null + + # Galaxy can display data at various external browsers. These options + # specify which browsers should be available. URLs and builds + # available at these browsers are defined in the specifield files. If + # use_remote_user = True, display application servers will be denied + # access to Galaxy and so displaying datasets in these sites will + # fail. display_servers contains a list of hostnames which should be + # allowed to bypass security to display datasets. Please be aware + # that there are security implications if this is allowed. More + # details (including required changes to the proxy server config) are + # available in the Apache proxy documentation on the Galaxy Community + # Hub. The list of servers in this sample config are for the UCSC + # Main, Test and Archaea browsers, but the default if left commented + # is to not allow any display sites to bypass security (you must + # uncomment the line below to allow them). + #display_servers: 'hgw1.cse.ucsc.edu,hgw2.cse.ucsc.edu,hgw3.cse.ucsc.edu,hgw4.cse.ucsc.edu,hgw5.cse.ucsc.edu,hgw6.cse.ucsc.edu,hgw7.cse.ucsc.edu,hgw8.cse.ucsc.edu,lowepub.cse.ucsc.edu' + + # To disable the old-style display applications that are hardcoded + # into datatype classes, set enable_old_display_applications = False. + # This may be desirable due to using the new-style, XML-defined, + # display applications that have been defined for many of the + # datatypes that have the old-style. There is also a potential + # security concern with the old-style applications, where a malicious + # party could provide a link that appears to reference the Galaxy + # server, but contains a redirect to a third-party server, tricking a + # Galaxy user to access said site. + #enable_old_display_applications: true + + # Show a message box under the masthead. + #message_box_visible: false + + # Show a message box under the masthead. + #message_box_content: null + + # Show a message box under the masthead. + #message_box_class: info + + # Append "/{brand}" to the "Galaxy" text in the masthead. + #brand: null + + # Format string used when showing date and time information. The + # string may contain: - the directives used by Python time.strftime() + # function (see + # https://docs.python.org/2/library/time.html#time.strftime ), - + # $locale (complete format string for the server locale), - $iso8601 + # (complete format string as specified by ISO 8601 international + # standard). + #pretty_datetime_format: $locale (UTC) + + # URL (with schema http/https) of the Galaxy instance as accessible + # within your local network - if specified used as a default by pulsar + # file staging and Jupyter Docker container for communicating back + # with Galaxy via the API. If you are attempting to setup GIEs on Mac + # OS X with Docker for Mac - this should likely be the IP address of + # your machine on the virtualbox network (vboxnet0) setup for the + # Docker host VM. This can found by running ifconfig and using the IP + # address of the network vboxnet0. + #galaxy_infrastructure_url: 'http://localhost:8080' + + # If the above URL cannot be determined ahead of time in dynamic + # environments but the port which should be used to access Galaxy can + # be - this should be set to prevent Galaxy from having to guess. For + # example if Galaxy is sitting behind a proxy with REMOTE_USER enabled + # - infrastructure shouldn't talk to Python processes directly and + # this should be set to 80 or 443, etc... If unset this file will be + # read for a server block defining a port corresponding to the webapp. + #galaxy_infrastructure_web_port: 8080 + + # The URL of the page to display in Galaxy's middle pane when loaded. + # This can be an absolute or relative URL. + #welcome_url: /static/welcome.html + + # The URL linked by the "Galaxy/brand" text. + #logo_url: / + + # The URL linked by the "Wiki" link in the "Help" menu. + #wiki_url: 'https://galaxyproject.org/' + + # The URL linked by the "Support" link in the "Help" menu. + #support_url: 'https://galaxyproject.org/support' + + # The URL linked by the "How to Cite Galaxy" link in the "Help" menu. + #citation_url: 'https://galaxyproject.org/citing-galaxy' + + # The URL linked by the "Search" link in the "Help" menu. + #search_url: 'https://galaxyproject.org/search/' + + # The URL linked by the "Mailing Lists" link in the "Help" menu. + #mailing_lists_url: 'https://galaxyproject.org/mailing-lists' + + # The URL linked by the "Videos" link in the "Help" menu. + #screencasts_url: 'https://vimeo.com/galaxyproject' + + # Points to the GenomeSpace UI service which will be used by the + # GenomeSpace importer and exporter tools + #genomespace_ui_url: 'https://gsui.genomespace.org/jsui/' + + # The URL linked by the "Terms and Conditions" link in the "Help" + # menu, as well as on the user registration and login forms and in the + # activation emails. + #terms_url: null + + # The URL linked by the "Galaxy Q&A" link in the "Help" menu The + # Galaxy Q&A site is under development; when the site is done, this + # URL will be set and uncommented. + #qa_url: null + + # Serve static content, which must be enabled if you're not serving it + # via a proxy server. These options should be self explanatory and so + # are not documented individually. You can use these paths (or ones + # in the proxy server) to point to your own styles. + #static_enabled: true + + # Serve static content, which must be enabled if you're not serving it + # via a proxy server. These options should be self explanatory and so + # are not documented individually. You can use these paths (or ones + # in the proxy server) to point to your own styles. + #static_cache_time: 360 + + # Serve static content, which must be enabled if you're not serving it + # via a proxy server. These options should be self explanatory and so + # are not documented individually. You can use these paths (or ones + # in the proxy server) to point to your own styles. + #static_dir: static/ + + # Serve static content, which must be enabled if you're not serving it + # via a proxy server. These options should be self explanatory and so + # are not documented individually. You can use these paths (or ones + # in the proxy server) to point to your own styles. + #static_images_dir: static/images + + # Serve static content, which must be enabled if you're not serving it + # via a proxy server. These options should be self explanatory and so + # are not documented individually. You can use these paths (or ones + # in the proxy server) to point to your own styles. + #static_favicon_dir: static/favicon.ico + + # Serve static content, which must be enabled if you're not serving it + # via a proxy server. These options should be self explanatory and so + # are not documented individually. You can use these paths (or ones + # in the proxy server) to point to your own styles. + #static_scripts_dir: static/scripts/ + + # Serve static content, which must be enabled if you're not serving it + # via a proxy server. These options should be self explanatory and so + # are not documented individually. You can use these paths (or ones + # in the proxy server) to point to your own styles. + #static_style_dir: static/june_2007_style/blue + + # Serve static content, which must be enabled if you're not serving it + # via a proxy server. These options should be self explanatory and so + # are not documented individually. You can use these paths (or ones + # in the proxy server) to point to your own styles. + #static_robots_txt: static/robots.txt + + # Incremental Display Options + #display_chunk_size: 65536 + + # For help on configuring the Advanced proxy features, see: + # http://usegalaxy.org/production Apache can handle file downloads + # (Galaxy-to-user) via mod_xsendfile. Set this to True to inform + # Galaxy that mod_xsendfile is enabled upstream. + #apache_xsendfile: false + + # The same download handling can be done by nginx using X-Accel- + # Redirect. This should be set to the path defined in the nginx + # config as an internal redirect with access to Galaxy's data files + # (see documentation linked above). + #nginx_x_accel_redirect_base: false + + # nginx can make use of mod_zip to create zip files containing + # multiple library files. If using X-Accel-Redirect, this can be the + # same value as that option. + #nginx_x_archive_files_base: false + + # If using compression in the upstream proxy server, use this option + # to disable gzipping of library .tar.gz and .zip archives, since the + # proxy server will do it faster on the fly. + #upstream_gzip: false + + # The following default adds a header to web request responses that + # will cause modern web browsers to not allow Galaxy to be embedded in + # the frames of web applications hosted at other hosts - this can help + # prevent a class of attack called clickjacking + # (https://www.owasp.org/index.php/Clickjacking). If you configure a + # proxy in front of Galaxy - please ensure this header remains intact + # to protect your users. Uncomment and leave empty to not set the `X + # -Frame-Options` header. + #x_frame_options: SAMEORIGIN + + # nginx can also handle file uploads (user-to-Galaxy) via + # nginx_upload_module. Configuration for this is complex and explained + # in detail in the documentation linked above. The upload store is a + # temporary directory in which files uploaded by the upload module + # will be placed. + #nginx_upload_store: false + + # This value overrides the action set on the file upload form, e.g. + # the web path where the nginx_upload_module has been configured to + # intercept upload requests. + #nginx_upload_path: false + + # Galaxy can also use nginx_upload_module to receive files staged out + # upon job completion by remote job runners (i.e. Pulsar) that + # initiate staging operations on the remote end. See the Galaxy nginx + # documentation for the corresponding nginx configuration. + #nginx_upload_job_files_store: false + + # Galaxy can also use nginx_upload_module to receive files staged out + # upon job completion by remote job runners (i.e. Pulsar) that + # initiate staging operations on the remote end. See the Galaxy nginx + # documentation for the corresponding nginx configuration. + #nginx_upload_job_files_path: false + + # Have Galaxy manage dynamic proxy component for routing requests to + # other services based on Galaxy's session cookie. It will attempt to + # do this by default though you do need to install node+npm and do an + # npm install from `lib/galaxy/web/proxy/js`. It is generally more + # robust to configure this externally, managing it however Galaxy is + # managed. If True, Galaxy will only launch the proxy if it is + # actually going to be used (e.g. for Jupyter). + #dynamic_proxy_manage: true + + # As of 16.04 Galaxy supports multiple proxy types. The original + # NodeJS implementation, alongside a new Golang single-binary-no- + # dependencies version. Valid values are (node, golang) + #dynamic_proxy: node + + # The NodeJS dynamic proxy can use an SQLite database or a JSON file + # for IPC, set that here. + #dynamic_proxy_session_map: database/session_map.sqlite + + # Set the port and IP for the the dynamic proxy to bind to, this must + # match the external configuration if dynamic_proxy_manage is False. + #dynamic_proxy_bind_port: 8800 + + # Set the port and IP for the the dynamic proxy to bind to, this must + # match the external configuration if dynamic_proxy_manage is False. + #dynamic_proxy_bind_ip: 0.0.0.0 + + # Enable verbose debugging of Galaxy-managed dynamic proxy. + #dynamic_proxy_debug: false + + # The dynamic proxy is proxied by an external proxy (e.g. apache + # frontend to nodejs to wrap connections in SSL). + #dynamic_proxy_external_proxy: false + + # Additionally, when the dynamic proxy is proxied by an upstream + # server, you'll want to specify a prefixed URL so both Galaxy and the + # proxy reside under the same path that your cookies are under. This + # will result in a url like https://FQDN/galaxy-prefix/gie_proxy for + # proxying + #dynamic_proxy_prefix: gie_proxy + + # This attribute governs the minimum length of time between + # consecutive HTTP/WS requests through the proxy, before the proxy + # considers a container as being inactive and kills it. + #dynamic_proxy_golang_noaccess: 60 + + # In order to kill containers, the golang proxy has to check at some + # interval for possibly dead containers. This is exposed as a + # configurable parameter, but the default value is probably fine. + #dynamic_proxy_golang_clean_interval: 10 + + # The golang proxy needs to know how to talk to your docker daemon. + # Currently TLS is not supported, that will come in an update. + #dynamic_proxy_golang_docker_address: 'unix:///var/run/docker.sock' + + # The golang proxy uses a RESTful HTTP API for communication with + # Galaxy instead of a JSON or SQLite file for IPC. If you do not + # specify this, it will be set randomly for you. You should set this + # if you are managing the proxy manually. + #dynamic_proxy_golang_api_key: null + + # If True, Galaxy will attempt to configure a simple root logger if a + # "loggers" section does not appear in this configuration file. + #auto_configure_logging: true + + # Verbosity of console log messages. Acceptable values can be found + # here: https://docs.python.org/2/library/logging.html#logging-levels + # A custom debug level of "TRACE" is available for even more + # verbosity. + #log_level: DEBUG + + # Print database operations to the server log (warning, quite + # verbose!). + #database_engine_option_echo: false + + # Print database pool operations to the server log (warning, quite + # verbose!). + #database_engine_option_echo_pool: false + + # Turn on logging of application events and some user events to the + # database. + #log_events: true + + # Turn on logging of user actions to the database. Actions currently + # logged are grid views, tool searches, and use of "recently" used + # tools menu. The log_events and log_actions functionality will + # eventually be merged. + #log_actions: true + + # Fluentd configuration. Various events can be logged to the fluentd + # instance configured below by enabling fluent_log. + #fluent_log: false + + # Fluentd configuration. Various events can be logged to the fluentd + # instance configured below by enabling fluent_log. + #fluent_host: localhost + + # Fluentd configuration. Various events can be logged to the fluentd + # instance configured below by enabling fluent_log. + #fluent_port: 24224 + + # Sanitize all HTML tool output. By default, all tool output served + # as 'text/html' will be sanitized thoroughly. This can be disabled + # if you have special tools that require unaltered output. WARNING: + # disabling this does make the Galaxy instance susceptible to XSS + # attacks initiated by your users. + #sanitize_all_html: true + + # Whitelist sanitization file. Datasets created by tools listed in + # this file are trusted and will not have their HTML sanitized on + # display. This can be manually edited or manipulated through the + # Admin control panel -- see "Manage Display Whitelist" + #sanitize_whitelist_file: config/sanitize_whitelist.txt + + # By default Galaxy will serve non-HTML tool output that may + # potentially contain browser executable JavaScript content as plain + # text. This will for instance cause SVG datasets to not render + # properly and so may be disabled by setting the following option to + # True. + #serve_xss_vulnerable_mimetypes: false + + # Return a Access-Control-Allow-Origin response header that matches + # the Origin header of the request if that Origin hostname matches one + # of the strings or regular expressions listed here. This is a comma + # separated list of hostname strings or regular expressions beginning + # and ending with /. E.g. + # mysite.com,google.com,usegalaxy.org,/^[\w\.]*example\.com/ See: + # https://developer.mozilla.org/en- + # US/docs/Web/HTTP/Access_control_CORS + #allowed_origin_hostnames: null + + # Set the following to True to use Jupyter nbconvert to build HTML + # from Jupyter notebooks in Galaxy histories. This process may allow + # users to execute arbitrary code or serve arbitrary HTML. If + # enabled, Jupyter must be available and on Galaxy's PATH, to do this + # run `pip install jinja2 pygments jupyter` in Galaxy's virtualenv. + #trust_jupyter_notebook_conversion: false + + # Debug enables access to various config options useful for + # development and debugging: use_lint, use_profile, use_printdebug and + # use_interactive. It also causes the files used by PBS/SGE + # (submission script, output, and error) to remain on disk after the + # job is complete. + #debug: false + + # Check for WSGI compliance. + #use_lint: false + + # Run the Python profiler on each request. + #use_profile: false + + # Intercept print statements and show them on the returned page. + #use_printdebug: true + + # Enable live debugging in your browser. This should NEVER be enabled + # on a public site. Enabled in the sample config for development. + #use_interactive: true + + # When stopping Galaxy cleanly, how much time to give various + # monitoring/polling threads to finish before giving up on joining + # them. Set to 0 to disable this and restore the pre-18.01 default + # behavior. + #monitor_thread_join_timeout: 5 + + # Write thread status periodically to 'heartbeat.log', (careful, uses + # disk space rapidly!). Useful to determine why your processes may be + # consuming a lot of CPU. + #use_heartbeat: false + + # Control the period (in seconds) between dumps. Use -1 to disable. + # Regardless of this setting, if use_heartbeat is enabled, you can + # send a Galaxy process (unless running with uWSGI) SIGUSR1 (`kill + # -USR1`) to force a dump. + #heartbeat_interval: 20 + + # Heartbeat log filename. Can accept the template variables + # {server_name} and {pid} + #heartbeat_log: 'heartbeat_{server_name}.log' + + # Log to Sentry Sentry is an open source logging and error aggregation + # platform. Setting sentry_dsn will enable the Sentry middleware and + # errors will be sent to the indicated sentry instance. This + # connection string is available in your sentry instance under + # -> Settings -> API Keys. + #sentry_dsn: null + + # Log to statsd Statsd is an external statistics aggregator + # (https://github.com/etsy/statsd) Enabling the following options will + # cause galaxy to log request timing and other statistics to the + # configured statsd instance. The statsd_prefix is useful if you are + # running multiple Galaxy instances and want to segment statistics + # between them within the same aggregator. + #statsd_host: null + + # Log to statsd Statsd is an external statistics aggregator + # (https://github.com/etsy/statsd) Enabling the following options will + # cause galaxy to log request timing and other statistics to the + # configured statsd instance. The statsd_prefix is useful if you are + # running multiple Galaxy instances and want to segment statistics + # between them within the same aggregator. + #statsd_port: 8125 + + # Log to statsd Statsd is an external statistics aggregator + # (https://github.com/etsy/statsd) Enabling the following options will + # cause galaxy to log request timing and other statistics to the + # configured statsd instance. The statsd_prefix is useful if you are + # running multiple Galaxy instances and want to segment statistics + # between them within the same aggregator. + #statsd_prefix: galaxy + + # Log to graphite Graphite is an external statistics aggregator + # (https://github.com/graphite-project/carbon) Enabling the following + # options will cause galaxy to log request timing and other statistics + # to the configured graphite instance. The graphite_prefix is useful + # if you are running multiple Galaxy instances and want to segment + # statistics between them within the same aggregator. + #graphite_host: null + + # Log to graphite Graphite is an external statistics aggregator + # (https://github.com/graphite-project/carbon) Enabling the following + # options will cause galaxy to log request timing and other statistics + # to the configured graphite instance. The graphite_prefix is useful + # if you are running multiple Galaxy instances and want to segment + # statistics between them within the same aggregator. + #graphite_port: 2003 + + # Log to graphite Graphite is an external statistics aggregator + # (https://github.com/graphite-project/carbon) Enabling the following + # options will cause galaxy to log request timing and other statistics + # to the configured graphite instance. The graphite_prefix is useful + # if you are running multiple Galaxy instances and want to segment + # statistics between them within the same aggregator. + #graphite_prefix: galaxy + + # Add an option to the library upload form which allows administrators + # to upload a directory of files. + #library_import_dir: null + + # Add an option to the library upload form which allows authorized + # non-administrators to upload a directory of files. The configured + # directory must contain sub-directories named the same as the non- + # admin user's Galaxy login ( email ). The non-admin user is + # restricted to uploading files or sub-directories of files contained + # in their directory. + #user_library_import_dir: null + + # For security reasons, users may not import any files that actually + # lie outside of their `user_library_import_dir` (e.g. using symbolic + # links). A list of directories can be allowed by setting the + # following option (the list is comma-separated). Be aware that *any* + # user with library import permissions can import from anywhere in + # these directories (assuming they are able to create symlinks to + # them). + #user_library_import_symlink_whitelist: null + + # Allow admins to paste filesystem paths during upload. For libraries + # this adds an option to the admin library upload tool allowing admins + # to paste filesystem paths to files and directories in a box, and + # these paths will be added to a library. For history uploads, this + # allows pasting in paths as URIs. (i.e. prefixed with file://). Set + # to True to enable. Please note the security implication that this + # will give Galaxy Admins access to anything your Galaxy user has + # access to. + #allow_path_paste: false + + # Users may choose to download multiple files from a library in an + # archive. By default, Galaxy allows users to select from a few + # different archive formats if testing shows that Galaxy is able to + # create files using these formats. Specific formats can be disabled + # with this option, separate more than one format with commas. + # Available formats are currently 'zip', 'gz', and 'bz2'. + #disable_library_comptypes: null + + # Some sequencer integration features in beta allow you to + # automatically transfer datasets. This is done using a lightweight + # transfer manager which runs outside of Galaxy (but is spawned by it + # automatically). Galaxy will communicate with this manager over the + # port specified here. + #transfer_manager_port: 8163 + + # Boosts are used to customize this instance's toolbox search. The + # higher the boost, the more importance the scoring algorithm gives to + # the given field. Section refers to the tool group in the tool + # panel. Rest of the fields are tool's attributes. + #tool_name_boost: 9 + + # Boosts are used to customize this instance's toolbox search. The + # higher the boost, the more importance the scoring algorithm gives to + # the given field. Section refers to the tool group in the tool + # panel. Rest of the fields are tool's attributes. + #tool_section_boost: 3 + + # Boosts are used to customize this instance's toolbox search. The + # higher the boost, the more importance the scoring algorithm gives to + # the given field. Section refers to the tool group in the tool + # panel. Rest of the fields are tool's attributes. + #tool_description_boost: 2 + + # Boosts are used to customize this instance's toolbox search. The + # higher the boost, the more importance the scoring algorithm gives to + # the given field. Section refers to the tool group in the tool + # panel. Rest of the fields are tool's attributes. + #tool_label_boost: 1 + + # Boosts are used to customize this instance's toolbox search. The + # higher the boost, the more importance the scoring algorithm gives to + # the given field. Section refers to the tool group in the tool + # panel. Rest of the fields are tool's attributes. + #tool_stub_boost: 5 + + # Boosts are used to customize this instance's toolbox search. The + # higher the boost, the more importance the scoring algorithm gives to + # the given field. Section refers to the tool group in the tool + # panel. Rest of the fields are tool's attributes. + #tool_help_boost: 0.5 + + # Limits the number of results in toolbox search. Can be used to + # tweak how many results will appear. + #tool_search_limit: 20 + + # Enable/ disable Ngram-search for tools. It makes tool search results + # tolerant for spelling mistakes in the query by dividing the query + # into multiple ngrams and search for each ngram + #tool_enable_ngram_search: false + + # Set minimum size of ngrams + #tool_ngram_minsize: 3 + + # Set maximum size of ngrams + #tool_ngram_maxsize: 4 + + # Galaxy encodes various internal values when these values will be + # output in some format (for example, in a URL or cookie). You should + # set a key to be used by the algorithm that encodes and decodes these + # values. It can be any string up to 448 bits long. One simple way to + # generate a value for this is with the shell command: python -c + # 'import time; print time.time()' | md5sum | cut -f 1 -d ' ' + #id_secret: USING THE DEFAULT IS NOT SECURE! + + # User authentication can be delegated to an upstream proxy server + # (usually Apache). The upstream proxy should set a REMOTE_USER + # header in the request. Enabling remote user disables regular logins. + # For more information, see: https://galaxyproject.org/admin/config + # /apache-proxy + #use_remote_user: false + + # If use_remote_user is enabled and your external authentication + # method just returns bare usernames, set a default mail domain to be + # appended to usernames, to become your Galaxy usernames (email + # addresses). + #remote_user_maildomain: null + + # If use_remote_user is enabled, the header that the upstream proxy + # provides the remote username in defaults to HTTP_REMOTE_USER (the + # 'HTTP_' is prepended by WSGI). This option allows you to change the + # header. Note, you still need to prepend 'HTTP_' to the header in + # this option, but your proxy server should *not* include 'HTTP_' at + # the beginning of the header name. + #remote_user_header: HTTP_REMOTE_USER + + # If use_remote_user is enabled, anyone who can log in to the Galaxy + # host may impersonate any other user by simply sending the + # appropriate header. Thus a secret shared between the upstream proxy + # server, and Galaxy is required. If anyone other than the Galaxy user + # is using the server, then apache/nginx should pass a value in the + # header 'GX_SECRET' that is identical to the one below. + #remote_user_secret: USING THE DEFAULT IS NOT SECURE! + + # If use_remote_user is enabled, you can set this to a URL that will + # log your users out. + #remote_user_logout_href: null + + # If your proxy and/or authentication source does not normalize e-mail + # addresses or user names being passed to Galaxy - set the following + # option to True to force these to lower case. + #normalize_remote_user_email: false + + # If an e-mail address is specified here, it will hijack remote user + # mechanics (``use_remote_user``) and have the webapp inject a single + # fixed user. This has the effect of turning Galaxy into a single user + # application with no login or external proxy required. Such + # applications should not be exposed to the world. + #single_user: null + + # Administrative users - set this to a comma-separated list of valid + # Galaxy users (email addresses). These users will have access to the + # Admin section of the server, and will have access to create users, + # groups, roles, libraries, and more. For more information, see: + # https://galaxyproject.org/admin/ + #admin_users: null + + # Force everyone to log in (disable anonymous access). + #require_login: false + + # Show the site's welcome page (see welcome_url) alongside the login + # page (even if require_login is True) + #show_welcome_with_login: false + + # Allow unregistered users to create new accounts (otherwise, they + # will have to be created by an admin). + #allow_user_creation: true + + # Allow administrators to delete accounts. + #allow_user_deletion: false + + # Allow administrators to log in as other users (useful for debugging) + #allow_user_impersonation: false + + # Allow users to remove their datasets from disk immediately + # (otherwise, datasets will be removed after a time period specified + # by an administrator in the cleanup scripts run via cron) + #allow_user_dataset_purge: true + + # By default, users' data will be public, but setting this to True + # will cause it to be private. Does not affect existing users and + # data, only ones created after this option is set. Users may still + # change their default back to public. + #new_user_dataset_access_role_default_private: false + + # Expose user list. Setting this to True will expose the user list to + # authenticated users. This makes sharing datasets in smaller galaxy + # instances much easier as they can type a name/email and have the + # correct user show up. This makes less sense on large public Galaxy + # instances where that data shouldn't be exposed. For semi-public + # Galaxies, it may make sense to expose just the username and not + # email, or vice versa. + #expose_user_name: false + + # Expose user list. Setting this to True will expose the user list to + # authenticated users. This makes sharing datasets in smaller galaxy + # instances much easier as they can type a name/email and have the + # correct user show up. This makes less sense on large public Galaxy + # instances where that data shouldn't be exposed. For semi-public + # Galaxies, it may make sense to expose just the username and not + # email, or vice versa. + #expose_user_email: false + + # Whitelist for local network addresses for "Upload from URL" dialog. + # By default, Galaxy will deny access to the local network address + # space, to prevent users making requests to services which the + # administrator did not intend to expose. Previously, you could + # request any network service that Galaxy might have had access to, + # even if the user could not normally access it. It should be a comma + # separated list of IP addresses or IP address/mask, e.g. + # 10.10.10.10,10.0.1.0/24,fd00::/8 + #fetch_url_whitelist: null + + # Enable the new interface for installing tools from Tool Shed via the + # API. Admin menu will list both if enabled. + #enable_beta_ts_api_install: true + + # Enable the new container interface for Interactive Environments + #enable_beta_containers_interface: false + + # Set the following to a number of threads greater than 1 to spawn a + # Python task queue for dealing with large tool submissions (either + # through the tool form or as part of an individual workflow step + # across large collection). This affects workflow scheduling and web + # processes, not job handlers. This is a beta option and should not be + # used in production. + #tool_submission_burst_threads: 1 + + # If tool_submission_burst_threads is set to a number greater than 1, + # this is the number of jobs to schedule at which the task queue will + # be created. + #tool_submission_burst_at: 10 + + # Enable beta workflow modules that should not yet be considered part + # of Galaxy's stable API. + #enable_beta_workflow_modules: false + + # Following options only apply to workflows scheduled using the legacy + # workflow run API (running workflows via a POST to /api/workflows). + # Force usage of Galaxy's beta workflow scheduler under certain + # circumstances - this workflow scheduling forces Galaxy to schedule + # workflows in the background so initial submission of the workflows + # is significantly sped up. This does however force the user to + # refresh their history manually to see newly scheduled steps (for + # "normal" workflows - steps are still scheduled far in advance of + # them being queued and scheduling here doesn't refer to actual + # cluster job scheduling). Workflows containing more than the + # specified number of steps will always use the Galaxy's beta workflow + # scheduling. + #force_beta_workflow_scheduled_min_steps: 250 + + # Following options only apply to workflows scheduled using the legacy + # workflow run API (running workflows via a POST to /api/workflows). + # Force usage of Galaxy's beta workflow scheduler under certain + # circumstances - this workflow scheduling forces Galaxy to schedule + # workflows in the background so initial submission of the workflows + # is significantly sped up. This does however force the user to + # refresh their history manually to see newly scheduled steps (for + # "normal" workflows - steps are still scheduled far in advance of + # them being queued and scheduling here doesn't refer to actual + # cluster job scheduling). Workflows containing more than the + # specified number of steps will always use the Galaxy's beta workflow + # scheduling. Switch to using Galaxy's beta workflow scheduling for + # all workflows involving collections. + #force_beta_workflow_scheduled_for_collections: false + + # If multiple job handlers are enabled, allow Galaxy to schedule + # workflow invocations in multiple handlers simultaneously. This is + # discouraged because it results in a less predictable order of + # workflow datasets within in histories. + #parallelize_workflow_scheduling_within_histories: false + + # This is the maximum amount of time a workflow invocation may stay in + # an active scheduling state in seconds. Set to -1 to disable this + # maximum and allow any workflow invocation to schedule indefinitely. + # The default corresponds to 1 month. + #maximum_workflow_invocation_duration: 2678400 + + # Specify a maximum number of jobs that any given workflow scheduling + # iteration can create. Set this to a positive integer to prevent + # large collection jobs in a workflow from preventing other jobs from + # executing. This may also mitigate memory issues associated with + # scheduling workflows at the expense of increased total DB traffic + # because model objects are expunged from the SQL alchemy session + # between workflow invocation scheduling iterations. Set to -1 to + # disable any such maximum (the default). + #maximum_workflow_jobs_per_scheduling_iteration: -1 + + # Force serial scheduling of workflows within the context of a + # particular history + #history_local_serial_workflow_scheduling: false + + # Enable authentication via OpenID. Allows users to log in to their + # Galaxy account by authenticating with an OpenID provider. + #enable_openid: false + + # If OpenID is enabled, this configuration file specifies providers to + # use. Falls back to the .sample variant in config if default does not + # exist. + #openid_config_file: config/openid_conf.xml + + # If OpenID is enabled, consumer cache directory to use. + #openid_consumer_cache_path: database/openid_consumer_cache + + # XML config file that allows the use of different authentication + # providers (e.g. LDAP) instead or in addition to local authentication + # (.sample is used if default does not exist). + #auth_config_file: config/auth_conf.xml + + # Optional list of email addresses of API users who can make calls on + # behalf of other users. + #api_allow_run_as: null + + # Master key that allows many API admin actions to be used without + # actually having a defined admin user in the database/config. Only + # set this if you need to bootstrap Galaxy, you probably do not want + # to set this on public servers. + #master_api_key: changethis + + # Enable tool tags (associating tools with tags). This has its own + # option since its implementation has a few performance implications + # on startup for large servers. + #enable_tool_tags: false + + # Enable a feature when running workflows. When enabled, default + # datasets are selected for "Set at Runtime" inputs from the history + # such that the same input will not be selected twice, unless there + # are more inputs than compatible datasets in the history. When False, + # the most recently added compatible item in the history will be used + # for each "Set at Runtime" input, independent of others in the + # Workflow + #enable_unique_workflow_defaults: false + + # The URL to the myExperiment instance being used (omit scheme but + # include port) + #myexperiment_url: 'www.myexperiment.org:80' + + # Enable Galaxy's "Upload via FTP" interface. You'll need to install + # and configure an FTP server (we've used ProFTPd since it can use + # Galaxy's database for authentication) and set the following two + # options. This should point to a directory containing subdirectories + # matching users' identifier (defaults to e-mail), where Galaxy will + # look for files. + #ftp_upload_dir: null + + # This should be the hostname of your FTP server, which will be + # provided to users in the help text. + #ftp_upload_site: null + + # User attribute to use as subdirectory in calculating default + # ftp_upload_dir pattern. By default this will be email so a user's + # FTP upload directory will be ${ftp_upload_dir}/${user.email}. Can + # set this to other attributes such as id or username though. + #ftp_upload_dir_identifier: email + + # Python string template used to determine an FTP upload directory for + # a particular user. + #ftp_upload_dir_template: '${ftp_upload_dir}/${ftp_upload_dir_identifier}' + + # This should be set to False to prevent Galaxy from deleting uploaded + # FTP files as it imports them. + #ftp_upload_purge: true + + # Enable enforcement of quotas. Quotas can be set from the Admin + # interface. + #enable_quotas: false + + # This option allows users to see the full path of datasets via the + # "View Details" option in the history. This option also exposes the + # command line to non-administrative users. Administrators can always + # see dataset paths. + #expose_dataset_path: false + + # This option allows users to see the job metrics (except for + # environment variables). + #expose_potentially_sensitive_job_metrics: false + + # Enable the API for sample tracking + #enable_legacy_sample_tracking_api: false + + # Allow non-admin users to view available Data Manager options. + #enable_data_manager_user_view: false + + # File where Data Managers are configured (.sample used if default + # does not exist). + #data_manager_config_file: config/data_manager_conf.xml + + # File where Tool Shed based Data Managers are configured. + #shed_data_manager_config_file: config/shed_data_manager_conf.xml + + # Directory to store Data Manager based tool-data; defaults to + # tool_data_path. + #galaxy_data_manager_data_path: tool-data + + # To increase performance of job execution and the web interface, you + # can separate Galaxy into multiple processes. There are more than + # one way to do this, and they are explained in detail in the + # documentation: + # https://galaxyproject.org/admin/config/performance/scaling By + # default, Galaxy manages and executes jobs from within a single + # process and notifies itself of new jobs via in-memory queues. Jobs + # are run locally on the system on which Galaxy is started. Advanced + # job running capabilities can be configured through the job + # configuration file. + #job_config_file: config/job_conf.xml + + # When jobs fail due to job runner problems, Galaxy can be configured + # to retry these or reroute the jobs to new destinations. Very fine + # control of this is available with resubmit declarations in + # job_conf.xml. For simple deployments of Galaxy though, the following + # attribute can define resubmission conditions for all job + # destinations. If any job destination defines even one resubmission + # condition explicitly in job_conf.xml - the condition described by + # this option will not apply to that destination. For instance, the + # condition: 'attempt < 3 and unknown_error and (time_running < 300 or + # time_since_queued < 300)' would retry up to two times jobs that + # didn't fail due to detected memory or walltime limits but did fail + # quickly (either while queueing or running). The commented out + # default below results in no default job resubmission condition, + # failing jobs are just failed outright. + #default_job_resubmission_condition: null + + # In multiprocess configurations, notification between processes about + # new jobs must be done via the database. In single process + # configurations, this can be done in memory, which is a bit quicker. + #track_jobs_in_database: true + + # This enables splitting of jobs into tasks, if specified by the + # particular tool config. This is a new feature and not recommended + # for production servers yet. + #use_tasked_jobs: false + + # This enables splitting of jobs into tasks, if specified by the + # particular tool config. This is a new feature and not recommended + # for production servers yet. + #local_task_queue_workers: 2 + + # Enable job recovery (if Galaxy is restarted while cluster jobs are + # running, it can "recover" them when it starts). This is not safe to + # use if you are running more than one Galaxy server using the same + # database. + #enable_job_recovery: true + + # Although it is fairly reliable, setting metadata can occasionally + # fail. In these instances, you can choose to retry setting it + # internally or leave it in a failed state (since retrying internally + # may cause the Galaxy process to be unresponsive). If this option is + # set to False, the user will be given the option to retry externally, + # or set metadata manually (when possible). + #retry_metadata_internally: true + + # Very large metadata values can cause Galaxy crashes. This will + # allow limiting the maximum metadata key size (in bytes used in + # memory, not the end result database value size) Galaxy will attempt + # to save with a dataset. Use 0 to disable this feature. The default + # is 5MB, but as low as 1MB seems to be a reasonable size. + #max_metadata_value_size: 5242880 + + # If (for example) you run on a cluster and your datasets (by default, + # database/files/) are mounted read-only, this option will override + # tool output paths to write outputs to the working directory instead, + # and the job manager will move the outputs to their proper place in + # the dataset directory on the Galaxy server after the job completes. + #outputs_to_working_directory: false + + # If your network filesystem's caching prevents the Galaxy server from + # seeing the job's stdout and stderr files when it completes, you can + # retry reading these files. The job runner will retry the number of + # times specified below, waiting 1 second between tries. For NFS, you + # may want to try the -noac mount option (Linux) or -actimeo=0 + # (Solaris). + #retry_job_output_collection: 0 + + # In the past Galaxy would preserve its Python environment when + # running jobs ( and still does for internal tools packaged with + # Galaxy). This behavior exposes Galaxy internals to tools and could + # result in problems when activating Python environments for tools + # (such as with Conda packaging). The default legacy_only will + # restrict this behavior to tools identified by the Galaxy team as + # requiring this environment. Set this to "always" to restore the + # previous behavior (and potentially break Conda dependency resolution + # for many tools). Set this to legacy_and_local to preserve the + # environment for legacy tools and locally managed tools (this might + # be useful for instance if you are installing software into Galaxy's + # virtualenv for tool development). + #preserve_python_environment: legacy_only + + # Clean up various bits of jobs left on the filesystem after + # completion. These bits include the job working directory, external + # metadata temporary files, and DRM stdout and stderr files (if using + # a DRM). Possible values are: always, onsuccess, never + #cleanup_job: always + + # When running DRMAA jobs as the Galaxy user + # (https://galaxyproject.org/admin/config/performance/cluster + # /#submitting-jobs-as-the-real-user) this script is used to run the + # job script Galaxy generates for a tool execution. + #drmaa_external_runjob_script: sudo -E scripts/drmaa_external_runner.py --assign_all_groups + + # When running DRMAA jobs as the Galaxy user + # (https://galaxyproject.org/admin/config/performance/cluster + # /#submitting-jobs-as-the-real-user) this script is used to kill such + # jobs by Galaxy (e.g. if the user cancels the job). + #drmaa_external_killjob_script: sudo -E scripts/drmaa_external_killer.py + + # When running DRMAA jobs as the Galaxy user + # (https://galaxyproject.org/admin/config/performance/cluster + # /#submitting-jobs-as-the-real-user) this script is used transfer + # permissions back and forth between the Galaxy user and the user that + # is running the job. + #external_chown_script: sudo -E scripts/external_chown_script.py + + # When running DRMAA jobs as the Galaxy user + # (https://galaxyproject.org/admin/config/performance/cluster + # /#submitting-jobs-as-the-real-user) Galaxy can extract the user name + # from the email address (actually the local-part before the @) or the + # username which are both stored in the Galaxy data base. The latter + # option is particularly useful for installations that get the + # authentication from LDAP. Also, Galaxy can accept the name of a + # common system user (eg. galaxy_worker) who can run every job being + # submitted. This user should not be the same user running the galaxy + # system. Possible values are user_email (default), username or + # + #real_system_username: user_email + + # File to source to set up the environment when running jobs. By + # default, the environment in which the Galaxy server starts is used + # when running jobs locally, and the environment set up per the DRM's + # submission method and policy is used when running jobs on a cluster + # (try testing with `qsub` on the command line). + # environment_setup_file can be set to the path of a file on the + # cluster that should be sourced by the user to set up the environment + # prior to running tools. This can be especially useful for running + # jobs as the actual user, to remove the need to configure each user's + # environment individually. + #environment_setup_file: null + + # Optional file containing job resource data entry fields definition. + # These fields will be presented to users in the tool forms and allow + # them to overwrite default job resources such as number of + # processors, memory and walltime. + #job_resource_params_file: config/job_resource_params_conf.xml + + # If using job concurrency limits (configured in job_config_file), + # several extra database queries must be performed to determine the + # number of jobs a user has dispatched to a given destination. By + # default, these queries will happen for every job that is waiting to + # run, but if cache_user_job_count is set to True, it will only happen + # once per iteration of the handler queue. Although better for + # performance due to reduced queries, the trade-off is a greater + # possibility that jobs will be dispatched past the configured limits + # if running many handlers. + #cache_user_job_count: false + + # Define toolbox filters (https://galaxyproject.org/user-defined- + # toolbox-filters/) that admins may use to restrict the tools to + # display. + #tool_filters: null + + # Define toolbox filters (https://galaxyproject.org/user-defined- + # toolbox-filters/) that admins may use to restrict the tool labels to + # display. + #tool_label_filters: null + + # Define toolbox filters (https://galaxyproject.org/user-defined- + # toolbox-filters/) that admins may use to restrict the tool sections + # to display. + #tool_section_filters: null + + # Define toolbox filters (https://galaxyproject.org/user-defined- + # toolbox-filters/) that users may use to restrict the tools to + # display. + #user_tool_filters: 'examples:restrict_upload_to_admins, examples:restrict_encode' + + # Define toolbox filters (https://galaxyproject.org/user-defined- + # toolbox-filters/) that users may use to restrict the tool sections + # to display. + #user_tool_section_filters: 'examples:restrict_text' + + # Define toolbox filters (https://galaxyproject.org/user-defined- + # toolbox-filters/) that users may use to restrict the tool labels to + # display. + #user_tool_label_filters: 'examples:restrict_upload_to_admins, examples:restrict_encode' + + # The base module(s) that are searched for modules for toolbox + # filtering (https://galaxyproject.org/user-defined-toolbox-filters/) + # producedures. + #toolbox_filter_base_modules: 'galaxy.tools.toolbox.filters,galaxy.tools.filters' + + # Galaxy uses AMQP internally for communicating between processes. + # For example, when reloading the toolbox or locking job execution, + # the process that handled that particular request will tell all + # others to also reload, lock jobs, etc. For connection examples, see + # http://docs.celeryproject.org/projects/kombu/en/latest/userguide/con + # nections.html Without specifying anything here, galaxy will first + # attempt to use your specified database_connection above. If that's + # not specified either, Galaxy will automatically create and use a + # separate sqlite database located in your /database folder + # (indicated in the commented out line below). + #amqp_internal_connection: 'sqlalchemy+sqlite:///./database/control.sqlite?isolation_level=IMMEDIATE' + + # Galaxy real time communication server settings + #enable_communication_server: false + + # Galaxy real time communication server settings + #communication_server_host: 'http://localhost' + + # Galaxy real time communication server settings + #communication_server_port: 7070 + + # persistent_communication_rooms is a comma-separated list of rooms + # that should be always available. + #persistent_communication_rooms: null + From 4f4928b38677475fd3d70b0435bc9910154ccaba Mon Sep 17 00:00:00 2001 From: John Chilton Date: Thu, 30 Nov 2017 13:30:55 -0500 Subject: [PATCH 020/112] yaml_config - Add RST docs for Galaxy options. Automatically generated from the new specification. --- doc/source/admin/galaxy_options.rst | 3414 +++++++++++++++++++++++++++ doc/source/admin/index.rst | 1 + doc/source/admin/options.rst | 5 + lib/galaxy/webapps/config_manage.py | 4 + 4 files changed, 3424 insertions(+) create mode 100644 doc/source/admin/galaxy_options.rst create mode 100644 doc/source/admin/options.rst diff --git a/doc/source/admin/galaxy_options.rst b/doc/source/admin/galaxy_options.rst new file mode 100644 index 00000000000..a5b8a34899c --- /dev/null +++ b/doc/source/admin/galaxy_options.rst @@ -0,0 +1,3414 @@ +~~~~~~~~~~~~~~~ +``filter-with`` +~~~~~~~~~~~~~~~ + +:Description: + If running behind a proxy server and Galaxy is served from a + subdirectory, enable the proxy-prefix filter and set the prefix in + the [filter:proxy-prefix] section above. +:Default: ``proxy-prefix`` +:Type: str + + +~~~~~~~~~~~~~~~ +``cookie_path`` +~~~~~~~~~~~~~~~ + +:Description: + If proxy-prefix is enabled and you're running more than one Galaxy + instance behind one hostname, you will want to set this to the + same path as the prefix in the filter above. This value becomes + the "path" attribute set in the cookie so the cookies from each + instance will not clobber each other. +:Default: ``None`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~~~~ +``database_connection`` +~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + By default, Galaxy uses a SQLite database at + 'database/universe.sqlite'. You may use a SQLAlchemy connection + string to specify an external database instead. This string takes + many options which are explained in detail in the config file + documentation. +:Default: ``sqlite:///./database/universe.sqlite?isolation_level=IMMEDIATE`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``database_engine_option_pool_size`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + If the server logs errors about not having enough database pool + connections, you will want to increase these values, or consider + running more Galaxy processes. +:Default: ``5`` +:Type: int + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``database_engine_option_max_overflow`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + If the server logs errors about not having enough database pool + connections, you will want to increase these values, or consider + running more Galaxy processes. +:Default: ``10`` +:Type: int + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``database_engine_option_pool_recycle`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + If using MySQL and the server logs the error "MySQL server has + gone away", you will want to set this to some positive value (7200 + should work). +:Default: ``-1`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``database_engine_option_server_side_cursors`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + If large database query results are causing memory or response + time issues in the Galaxy process, leave the result on the server + instead. This option is only available for PostgreSQL and is + highly recommended. +:Default: ``false`` +:Type: bool + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``database_query_profiling_proxy`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Log all database transactions, can be useful for debugging and + performance profiling. Logging is done via Python's 'logging' + module under the qualname + 'galaxy.model.orm.logging_connection_proxy' +:Default: ``false`` +:Type: bool + + +~~~~~~~~~~~~~~~~~~~~~ +``database_template`` +~~~~~~~~~~~~~~~~~~~~~ + +:Description: + If auto-creating a postgres database on startup - it can be based + on an existing template database. This will set that. This is + probably only useful for testing but documentation is included + here for completeness. +:Default: ``None`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``slow_query_log_threshold`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Slow query logging. Queries slower than the threshold indicated + below will be logged to debug. A value of '0' is disabled. For + example, you would set this to .005 to log all queries taking + longer than 5 milliseconds. +:Default: ``0`` +:Type: int + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``install_database_connection`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + By default, Galaxy will use the same database to track user data + and tool shed install data. There are many situations in which it + is valuable to separate these - for instance bootstrapping fresh + Galaxy instances with pretested installs. The following option + can be used to separate the tool shed install database (all other + options listed above but prefixed with install_ are also + available). +:Default: ``sqlite:///./database/universe.sqlite?isolation_level=IMMEDIATE`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~~~~~~ +``database_auto_migrate`` +~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Setting the following option to true will cause Galaxy to + automatically migrate the database forward after updates. This is + not recommended for production use. +:Default: ``false`` +:Type: bool + + +~~~~~~~~~~~~~ +``file_path`` +~~~~~~~~~~~~~ + +:Description: + Dataset files are stored in this directory. +:Default: ``database/files`` +:Type: str + + +~~~~~~~~~~~~~~~~~ +``new_file_path`` +~~~~~~~~~~~~~~~~~ + +:Description: + Temporary files are stored in this directory. +:Default: ``database/tmp`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~ +``tool_config_file`` +~~~~~~~~~~~~~~~~~~~~ + +:Description: + Tool config files, defines what tools are available in Galaxy. + Tools can be locally developed or installed from Galaxy tool + sheds. (config/tool_conf.xml.sample will be used if left unset and + config/tool_conf.xml does not exist). +:Default: ``config/tool_conf.xml,config/shed_tool_conf.xml`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~~~~ +``check_migrate_tools`` +~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Enable / disable checking if any tools defined in the above non- + shed tool_config_files (i.e., tool_conf.xml) have been migrated + from the Galaxy code distribution to the Tool Shed. This setting + should generally be set to False only for development Galaxy + environments that are often rebuilt from scratch where migrated + tools do not need to be available in the Galaxy tool panel. If + the following setting remains commented, the default setting will + be True. +:Default: ``true`` +:Type: bool + + +~~~~~~~~~~~~~~~~~~~~~~~~~ +``migrated_tools_config`` +~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Tool config maintained by tool migration scripts. If you use the + migration scripts to install tools that have been migrated to the + tool shed upon a new release, they will be added to this tool + config file. +:Default: ``config/migrated_tools_conf.xml`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``integrated_tool_panel_config`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + File that contains the XML section and tool tags from all tool + panel config files integrated into a single file that defines the + tool panel layout. This file can be changed by the Galaxy + administrator to alter the layout of the tool panel. If not + present, Galaxy will create it. +:Default: ``integrated_tool_panel.xml`` +:Type: str + + +~~~~~~~~~~~~~ +``tool_path`` +~~~~~~~~~~~~~ + +:Description: + Default path to the directory containing the tools defined in + tool_conf.xml. Other tool config files must include the tool_path + as an attribute in the tag. +:Default: ``tools`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~~~~ +``tool_dependency_dir`` +~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Path to the directory in which tool dependencies are placed. This + is used by the Tool Shed to install dependencies and can also be + used by administrators to manually install or link to + dependencies. For details, see: + https://galaxyproject.org/admin/config/tool-dependencies Set the + string to None to explicitly disable tool dependency handling. If + this option is set to none or an invalid path, installing tools + with dependencies from the Tool Shed will fail. +:Default: ``database/dependencies`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``dependency_resolvers_config_file`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + The dependency resolvers config file specifies an ordering and + options for how Galaxy resolves tool dependencies (requirement + tags in Tool XML). The default ordering is to the use the Tool + Shed for tools installed that way, use local Galaxy packages, and + then use Conda if available. See https://github.com/galaxyproject/ + galaxy/blob/dev/doc/source/admin/dependency_resolvers.rst for more + information on these options. +:Default: ``config/dependency_resolvers_conf.xml`` +:Type: str + + +~~~~~~~~~~~~~~~~ +``conda_prefix`` +~~~~~~~~~~~~~~~~ + +:Description: + conda_prefix is the location on the filesystem where Conda + packages and environments are installed IMPORTANT: Due to a + current limitation in conda, the total length of the conda_prefix + and the job_working_directory path should be less than 50 + characters! +:Default: ``/_conda`` +:Type: str + + +~~~~~~~~~~~~~~ +``conda_exec`` +~~~~~~~~~~~~~~ + +:Description: + Override the Conda executable to use, it will default to the one + on the PATH (if available) and then to /bin/conda +:Default: ``None`` +:Type: str + + +~~~~~~~~~~~~~~~ +``conda_debug`` +~~~~~~~~~~~~~~~ + +:Description: + Pass debug flag to conda commands. +:Default: ``false`` +:Type: bool + + +~~~~~~~~~~~~~~~~~~~~~~~~~ +``conda_ensure_channels`` +~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + conda channels to enable by default (http://conda.pydata.org/docs + /custom-channels.html) +:Default: ``iuc,bioconda,conda-forge,defaults,r`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~~~ +``conda_auto_install`` +~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Set to True to instruct Galaxy to look for and install missing + tool dependencies before each job runs. +:Default: ``false`` +:Type: bool + + +~~~~~~~~~~~~~~~~~~~ +``conda_auto_init`` +~~~~~~~~~~~~~~~~~~~ + +:Description: + Set to True to instruct Galaxy to install Conda from the web + automatically if it cannot find a local copy and conda_exec is not + configured. +:Default: ``true`` +:Type: bool + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``conda_copy_dependencies`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + You must set this to True if conda_prefix and + job_working_directory are not on the same volume, or some conda + dependencies will fail to execute at job runtime. Conda will copy + packages content instead of creating hardlinks or symlinks. This + will prevent problems with some specific packages (perl, R), at + the cost of extra disk space usage and extra time spent copying + packages. +:Default: ``false`` +:Type: bool + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``use_cached_dependency_manager`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Certain dependency resolvers (namely Conda) take a considerable + amount of time to build an isolated job environment in the + job_working_directory if the job working directory is on a network + share. Set the following option to True to cache the dependencies + in a folder. This option is beta and should only be used if you + experience long waiting times before a job is actually submitted + to your cluster. +:Default: ``false`` +:Type: bool + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``tool_dependency_cache_dir`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + By default the tool_dependency_cache_dir is the _cache directory + of the tool dependency directory +:Default: ``/_cache`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~~~~~~ +``precache_dependencies`` +~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + By default, when using a cached dependency manager, the + dependencies are cached when installing new tools and when using + tools for the first time. Set this to False if you prefer + dependencies to be cached only when installing new tools. +:Default: ``true`` +:Type: bool + + +~~~~~~~~~~~~~~~~~~~~~~~~~~ +``tool_sheds_config_file`` +~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + File containing the Galaxy Tool Sheds that should be made + available to install from in the admin interface (.sample used if + default does not exist). +:Default: ``config/tool_sheds_conf.xml`` +:Type: str + + +~~~~~~~~~~~~~~~ +``watch_tools`` +~~~~~~~~~~~~~~~ + +:Description: + Set to True to enable monitoring of tools and tool directories + listed in any tool config file specified in tool_config_file + option. If changes are found, tools are automatically reloaded. + Watchdog ( https://pypi.python.org/pypi/watchdog ) must be + installed and available to Galaxy to use this option. Other + options include 'auto' which will attempt to watch tools if the + watchdog library is available but won't fail to load Galaxy if it + is not and 'polling' which will use a less efficient monitoring + scheme that may work in wider range of scenarios than the watchdog + default. +:Default: ``false`` +:Type: bool + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``enable_beta_mulled_containers`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Enable Galaxy to fetch Docker containers registered with quay.io + generated from tool requirements resolved through conda. These + containers (when available) have been generated using mulled - + https://github.com/mulled. These containers are highly beta and + availability will vary by tool. This option will additionally only + be used for job destinations with Docker enabled. +:Default: ``false`` +:Type: bool + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``containers_resolvers_config_file`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Container resolvers configuration (beta). Setup a file describing + container resolvers to use when discovering containers for Galaxy. + If this is set to None, the default containers loaded is + determined by enable_beta_mulled_containers. +:Default: ``None`` +:Type: str + + +~~~~~~~~~~~~~~~~~~ +``involucro_path`` +~~~~~~~~~~~~~~~~~~ + +:Description: + involucro is a tool used to build Docker containers for tools from + Conda dependencies referenced in tools as `requirement`s. The + following path is the location of involucro on the Galaxy host. + This is ignored if the relevant container resolver isn't enabled, + and will install on demand unless involucro_auto_init is set to + False. +:Default: ``database/dependencies/involucro`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~~~~ +``involucro_auto_init`` +~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Install involucro as needed to build Docker containers for tools. + Ignored if relevant container resolver is not used. +:Default: ``true`` +:Type: bool + + +~~~~~~~~~~~~~~~~~~~~~~~~~~ +``enable_tool_shed_check`` +~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Enable automatic polling of relative tool sheds to see if any + updates are available for installed repositories. Ideally only + one Galaxy server process should be able to check for repository + updates. The setting for hours_between_check should be an integer + between 1 and 24. +:Default: ``false`` +:Type: bool + + +~~~~~~~~~~~~~~~~~~~~~~~ +``hours_between_check`` +~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Enable automatic polling of relative tool sheds to see if any + updates are available for installed repositories. Ideally only + one Galaxy server process should be able to check for repository + updates. The setting for hours_between_check should be an integer + between 1 and 24. +:Default: ``12`` +:Type: int + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``manage_dependency_relationships`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Enable use of an in-memory registry with bi-directional + relationships between repositories (i.e., in addition to lists of + dependencies for a repository, keep an in-memory registry of + dependent items for each repository. +:Default: ``false`` +:Type: bool + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``tool_data_table_config_path`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + XML config file that contains data table entries for the + ToolDataTableManager. This file is manually # maintained by the + Galaxy administrator (.sample used if default does not exist). +:Default: ``config/tool_data_table_conf.xml`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``shed_tool_data_table_config`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + XML config file that contains additional data table entries for + the ToolDataTableManager. This file is automatically generated + based on the current installed tool shed repositories that contain + valid tool_data_table_conf.xml.sample files. At the time of + installation, these entries are automatically added to the + following file, which is parsed and applied to the + ToolDataTableManager at server start up. +:Default: ``config/shed_tool_data_table_conf.xml`` +:Type: str + + +~~~~~~~~~~~~~~~~~~ +``tool_data_path`` +~~~~~~~~~~~~~~~~~~ + +:Description: + Directory where data used by tools is located. See the samples in + that directory and the Galaxy Community Hub for help: + https://galaxyproject.org/admin/data-integration +:Default: ``tool-data`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~~~~ +``shed_tool_data_path`` +~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Directory where Tool Data Table related files will be placed when + installed from a ToolShed. Defaults to tool_data_path. +:Default: ``tool-data`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~~~~ +``watch_tool_data_dir`` +~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Set to True to enable monitoring of the tool_data and + shed_tool_data_path directories. If changes in tool data table + files are found, the tool data tables for that data manager are + automatically reloaded. Watchdog ( + https://pypi.python.org/pypi/watchdog ) must be installed and + available to Galaxy to use this option. Other options include + 'auto' which will attempt to use the watchdog library if it is + available but won't fail to load Galaxy if it is not and 'polling' + which will use a less efficient monitoring scheme that may work in + wider range of scenarios than the watchdog default. +:Default: ``false`` +:Type: bool + + +~~~~~~~~~~~~~~~~~~~~ +``builds_file_path`` +~~~~~~~~~~~~~~~~~~~~ + +:Description: + File containing old-style genome builds +:Default: ``tool-data/shared/ucsc/builds.txt`` +:Type: str + + +~~~~~~~~~~~~~~~~~ +``len_file_path`` +~~~~~~~~~~~~~~~~~ + +:Description: + Directory where chrom len files are kept, currently mainly used by + trackster +:Default: ``tool-data/shared/ucsc/chrom`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~~~~~~ +``datatypes_config_file`` +~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Datatypes config file(s), defines what data (file) types are + available in Galaxy (.sample is used if default does not exist). + If a datatype appears in multiple files, the last definition is + used (though the first sniffer is used so limit sniffer + definitions to one file). +:Default: ``config/datatypes_conf.xml`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~~~~~~~ +``datatypes_disable_auto`` +~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Disable the 'Auto-detect' option for file uploads +:Default: ``false`` +:Type: bool + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``visualization_plugins_directory`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Visualizations config directory: where to look for individual + visualization plugins. The path is relative to the Galaxy root + dir. To use an absolute path begin the path with '/'. This is a + comma separated list. Defaults to "config/plugins/visualizations". +:Default: ``config/plugins/visualizations`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``interactive_environment_plugins_directory`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Interactive environment plugins root directory: where to look for + interactive environment plugins. By default none will be loaded. + Set to config/plugins/interactive_environments to load Galaxy's + stock plugins. These will require Docker to be configured and have + security considerations, so proceed with caution. The path is + relative to the Galaxy root dir. To use an absolute path begin + the path with '/'. This is a comma separated list. +:Default: ``None`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``interactive_environment_swarm_mode`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + To run interactive environment containers in Docker Swarm mode (on + an existing swarm), set this option to True and set + `docker_connect_port` in the IE plugin config (ini) file(s) of any + IE plugins you have enabled and ensure that you are not using any + `docker run`-specific options in your plugins' `command_inject` + options (swarm mode services run using `docker service create`, + which has a different and more limited set of options). This + option can be overridden on a per-plugin basis by using the + `swarm_mode` option in the plugin's ini config file. +:Default: ``false`` +:Type: bool + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``swarm_manager_config_file`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Galaxy can run a "swarm manager" service that will monitor + utilization of the swarm and provision/deprovision worker nodes as + necessary. The service has its own configuration file. +:Default: ``config/swarm_manager_conf.yml`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~ +``tour_config_dir`` +~~~~~~~~~~~~~~~~~~~ + +:Description: + Interactive tour directory: where to store interactive tour + definition files. Galaxy ships with several basic interface tours + enabled, though a different directory with custom tours can be + specified here. The path is relative to the Galaxy root dir. To + use an absolute path begin the path with '/'. This is a comma + separated list. +:Default: ``config/plugins/tours`` +:Type: str + + +~~~~~~~~~~~~~~~~ +``webhooks_dir`` +~~~~~~~~~~~~~~~~ + +:Description: + Webhooks directory: where to store webhooks - plugins to extend + the Galaxy UI. By default none will be loaded. Set to + config/plugins/webhooks/demo to load Galaxy's demo webhooks. To + use an absolute path begin the path with '/'. This is a comma + separated list. Add test/functional/webhooks to this list to + include the demo webhooks used to test the webhook framework. +:Default: ``config/plugins/webhooks`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~~~~~~ +``job_working_directory`` +~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Each job is given a unique empty directory as its current working + directory. This option defines in what parent directory those + directories will be created. +:Default: ``database/jobs_directory`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``cluster_files_directory`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + If using a cluster, Galaxy will write job scripts and + stdout/stderr to this directory. +:Default: ``database/pbs`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~~~~ +``template_cache_path`` +~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Mako templates are compiled as needed and cached for reuse, this + directory is used for the cache +:Default: ``database/compiled_templates`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``check_job_script_integrity`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Set to false to disable various checks Galaxy will do to ensure it + can run job scripts before attempting to execute or submit them. +:Default: ``true`` +:Type: bool + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``check_job_script_integrity_count`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Number of checks to execute if check_job_script_integrity is + enabled. +:Default: ``35`` +:Type: int + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``check_job_script_integrity_sleep`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Time to sleep between checks if check_job_script_integrity is + enabled (in seconds). +:Default: ``0.25`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~~ +``default_job_shell`` +~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Set the default shell used by non-containerized jobs Galaxy-wide. + This defaults to bash for all jobs and can be overridden at the + destination level for heterogeneous clusters. conda job resolution + requires bash or zsh so if this is switched to /bin/sh for + instance - conda resolution should be disabled. Containerized jobs + always use /bin/sh - so more maximum portability tool authors + should assume generated commands run in sh. +:Default: ``/bin/bash`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~~~~ +``citation_cache_type`` +~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Citation related caching. Tool citations information maybe + fetched from external sources such as http://dx.doi.org/ by Galaxy + - the following parameters can be used to control the caching used + to store this information. +:Default: ``file`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``citation_cache_data_dir`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Citation related caching. Tool citations information maybe + fetched from external sources such as http://dx.doi.org/ by Galaxy + - the following parameters can be used to control the caching used + to store this information. +:Default: ``database/citations/data`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``citation_cache_lock_dir`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Citation related caching. Tool citations information maybe + fetched from external sources such as http://dx.doi.org/ by Galaxy + - the following parameters can be used to control the caching used + to store this information. +:Default: ``database/citations/lock`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~~~~~ +``collect_outputs_from`` +~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Tools with a number of outputs not known until runtime can write + these outputs to a directory for collection by Galaxy when the job + is done. Previously, this directory was new_file_path, but using + one global directory can cause performance problems, so using + job_working_directory ('.' or cwd when a job is run) is + encouraged. By default, both are checked to avoid breaking + existing tools. +:Default: ``new_file_path,job_working_directory`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``object_store_config_file`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Configuration file for the object store If this is set and exists, + it overrides any other objectstore settings. +:Default: ``config/object_store_conf.xml`` +:Type: str + + +~~~~~~~~~~~~~~~ +``smtp_server`` +~~~~~~~~~~~~~~~ + +:Description: + Galaxy sends mail for various things: subscribing users to the + mailing list if they request it, password resets, reporting + dataset errors, and sending activation emails. To do this, it + needs to send mail through an SMTP server, which you may define + here (host:port). Galaxy will automatically try STARTTLS but will + continue upon failure. +:Default: ``None`` +:Type: str + + +~~~~~~~~~~~~~~~~~ +``smtp_username`` +~~~~~~~~~~~~~~~~~ + +:Description: + If your SMTP server requires a username and password, you can + provide them here (password in cleartext here, but if your server + supports STARTTLS it will be sent over the network encrypted). +:Default: ``None`` +:Type: str + + +~~~~~~~~~~~~~~~~~ +``smtp_password`` +~~~~~~~~~~~~~~~~~ + +:Description: + If your SMTP server requires a username and password, you can + provide them here (password in cleartext here, but if your server + supports STARTTLS it will be sent over the network encrypted). +:Default: ``None`` +:Type: str + + +~~~~~~~~~~~~ +``smtp_ssl`` +~~~~~~~~~~~~ + +:Description: + If your SMTP server requires SSL from the beginning of the + connection +:Default: ``false`` +:Type: bool + + +~~~~~~~~~~~~~~~~~~~~~ +``mailing_join_addr`` +~~~~~~~~~~~~~~~~~~~~~ + +:Description: + On the user registration form, users may choose to join a mailing + list. This is the address used to subscribe to the list. Uncomment + and leave empty if you want to remove this option from the user + registration form. +:Default: ``galaxy-announce-join@bx.psu.edu`` +:Type: str + + +~~~~~~~~~~~~~~~~~~ +``error_email_to`` +~~~~~~~~~~~~~~~~~~ + +:Description: + Datasets in an error state include a link to report the error. + Those reports will be sent to this address. Error reports are + disabled if no address is set. Also this email is shown as a + contact to user in case of Galaxy misconfiguration and other + events user may encounter. +:Default: ``None`` +:Type: str + + +~~~~~~~~~~~~~~ +``email_from`` +~~~~~~~~~~~~~~ + +:Description: + Email address to use in the 'From' field when sending emails for + account activations, workflow step notifications and password + resets. We recommend using string in the following format: Galaxy + Project If not configured, '' will be used. +:Default: ``None`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~~~~~~ +``instance_resource_url`` +~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + URL of the support resource for the galaxy instance. Used in + activation emails. +:Default: ``https://galaxyproject.org/`` +:Type: str + + +~~~~~~~~~~~~~~~~~~ +``blacklist_file`` +~~~~~~~~~~~~~~~~~~ + +:Description: + E-mail domains blacklist is used for filtering out users that are + using disposable email address during the registration. If their + address domain matches any domain in the blacklist, they are + refused the registration. +:Default: ``config/disposable_email_blacklist.conf`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``registration_warning_message`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Registration warning message is used to discourage people from + registering multiple accounts. Applies mostly for the main Galaxy + instance. If no message specified the warning box will not be + shown. +:Default: ``Please register only one account - we provide this service free of charge and have limited computational resources. Multi-accounts are tracked and will be subjected to account termination and data deletion.`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~~~ +``user_activation_on`` +~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + User account activation feature global flag. If set to "False", + the rest of the Account activation configuration is ignored and + user activation is disabled (i.e. accounts are active since + registration). The activation is also not working in case the SMTP + server is not defined. +:Default: ``false`` +:Type: bool + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``activation_grace_period`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Activation grace period (in hours). Activation is not forced + (login is not disabled) until grace period has passed. Users + under grace period can't run jobs. Enter 0 to disable grace + period. Users with OpenID logins have grace period forever. +:Default: ``3`` +:Type: int + + +~~~~~~~~~~~~~~~~~~~~~~~~~~ +``inactivity_box_content`` +~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Shown in warning box to users that were not activated yet. In use + only if activation_grace_period is set. +:Default: ``Your account has not been activated yet. Feel free to browse around and see what's available, but you won't be able to upload data or run jobs until you have verified your email address.`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``password_expiration_period`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Password expiration period (in days). Users are required to change + their password every x days. Users will be redirected to the + change password screen when they log in after their password + expires. Enter 0 to disable password expiration. +:Default: ``0`` +:Type: int + + +~~~~~~~~~~~~~~~~~~~~ +``session_duration`` +~~~~~~~~~~~~~~~~~~~~ + +:Description: + Galaxy Session Timeout This provides a timeout (in minutes) after + which a user will have to log back in. A duration of 0 disables + this feature. +:Default: ``0`` +:Type: int + + +~~~~~~~~~~~ +``ga_code`` +~~~~~~~~~~~ + +:Description: + You can enter tracking code here to track visitor's behavior + through your Google Analytics account. Example: UA-XXXXXXXX-Y +:Default: ``None`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~ +``display_servers`` +~~~~~~~~~~~~~~~~~~~ + +:Description: + Galaxy can display data at various external browsers. These + options specify which browsers should be available. URLs and + builds available at these browsers are defined in the specifield + files. If use_remote_user = True, display application servers + will be denied access to Galaxy and so displaying datasets in + these sites will fail. display_servers contains a list of + hostnames which should be allowed to bypass security to display + datasets. Please be aware that there are security implications if + this is allowed. More details (including required changes to the + proxy server config) are available in the Apache proxy + documentation on the Galaxy Community Hub. The list of servers in + this sample config are for the UCSC Main, Test and Archaea + browsers, but the default if left commented is to not allow any + display sites to bypass security (you must uncomment the line + below to allow them). +:Default: ``hgw1.cse.ucsc.edu,hgw2.cse.ucsc.edu,hgw3.cse.ucsc.edu,hgw4.cse.ucsc.edu,hgw5.cse.ucsc.edu,hgw6.cse.ucsc.edu,hgw7.cse.ucsc.edu,hgw8.cse.ucsc.edu,lowepub.cse.ucsc.edu`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``enable_old_display_applications`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + To disable the old-style display applications that are hardcoded + into datatype classes, set enable_old_display_applications = + False. This may be desirable due to using the new-style, XML- + defined, display applications that have been defined for many of + the datatypes that have the old-style. There is also a potential + security concern with the old-style applications, where a + malicious party could provide a link that appears to reference the + Galaxy server, but contains a redirect to a third-party server, + tricking a Galaxy user to access said site. +:Default: ``true`` +:Type: bool + + +~~~~~~~~~~~~~~~~~~~~~~~ +``message_box_visible`` +~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Show a message box under the masthead. +:Default: ``false`` +:Type: bool + + +~~~~~~~~~~~~~~~~~~~~~~~ +``message_box_content`` +~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Show a message box under the masthead. +:Default: ``None`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~~ +``message_box_class`` +~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Show a message box under the masthead. +:Default: ``info`` +:Type: str + + +~~~~~~~~~ +``brand`` +~~~~~~~~~ + +:Description: + Append "/{brand}" to the "Galaxy" text in the masthead. +:Default: ``None`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~~~~~~~ +``pretty_datetime_format`` +~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Format string used when showing date and time information. The + string may contain: - the directives used by Python + time.strftime() function (see + https://docs.python.org/2/library/time.html#time.strftime ), - + $locale (complete format string for the server locale), - $iso8601 + (complete format string as specified by ISO 8601 international + standard). +:Default: ``$locale (UTC)`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``galaxy_infrastructure_url`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + URL (with schema http/https) of the Galaxy instance as accessible + within your local network - if specified used as a default by + pulsar file staging and Jupyter Docker container for communicating + back with Galaxy via the API. If you are attempting to setup GIEs + on Mac OS X with Docker for Mac - this should likely be the IP + address of your machine on the virtualbox network (vboxnet0) setup + for the Docker host VM. This can found by running ifconfig and + using the IP address of the network vboxnet0. +:Default: ``http://localhost:8080`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``galaxy_infrastructure_web_port`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + If the above URL cannot be determined ahead of time in dynamic + environments but the port which should be used to access Galaxy + can be - this should be set to prevent Galaxy from having to + guess. For example if Galaxy is sitting behind a proxy with + REMOTE_USER enabled - infrastructure shouldn't talk to Python + processes directly and this should be set to 80 or 443, etc... If + unset this file will be read for a server block defining a port + corresponding to the webapp. +:Default: ``8080`` +:Type: int + + +~~~~~~~~~~~~~~~ +``welcome_url`` +~~~~~~~~~~~~~~~ + +:Description: + The URL of the page to display in Galaxy's middle pane when + loaded. This can be an absolute or relative URL. +:Default: ``/static/welcome.html`` +:Type: str + + +~~~~~~~~~~~~ +``logo_url`` +~~~~~~~~~~~~ + +:Description: + The URL linked by the "Galaxy/brand" text. +:Default: ``/`` +:Type: str + + +~~~~~~~~~~~~ +``wiki_url`` +~~~~~~~~~~~~ + +:Description: + The URL linked by the "Wiki" link in the "Help" menu. +:Default: ``https://galaxyproject.org/`` +:Type: str + + +~~~~~~~~~~~~~~~ +``support_url`` +~~~~~~~~~~~~~~~ + +:Description: + The URL linked by the "Support" link in the "Help" menu. +:Default: ``https://galaxyproject.org/support`` +:Type: str + + +~~~~~~~~~~~~~~~~ +``citation_url`` +~~~~~~~~~~~~~~~~ + +:Description: + The URL linked by the "How to Cite Galaxy" link in the "Help" + menu. +:Default: ``https://galaxyproject.org/citing-galaxy`` +:Type: str + + +~~~~~~~~~~~~~~ +``search_url`` +~~~~~~~~~~~~~~ + +:Description: + The URL linked by the "Search" link in the "Help" menu. +:Default: ``https://galaxyproject.org/search/`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~~ +``mailing_lists_url`` +~~~~~~~~~~~~~~~~~~~~~ + +:Description: + The URL linked by the "Mailing Lists" link in the "Help" menu. +:Default: ``https://galaxyproject.org/mailing-lists`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~ +``screencasts_url`` +~~~~~~~~~~~~~~~~~~~ + +:Description: + The URL linked by the "Videos" link in the "Help" menu. +:Default: ``https://vimeo.com/galaxyproject`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~~~ +``genomespace_ui_url`` +~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Points to the GenomeSpace UI service which will be used by the + GenomeSpace importer and exporter tools +:Default: ``https://gsui.genomespace.org/jsui/`` +:Type: str + + +~~~~~~~~~~~~~ +``terms_url`` +~~~~~~~~~~~~~ + +:Description: + The URL linked by the "Terms and Conditions" link in the "Help" + menu, as well as on the user registration and login forms and in + the activation emails. +:Default: ``None`` +:Type: str + + +~~~~~~~~~~ +``qa_url`` +~~~~~~~~~~ + +:Description: + The URL linked by the "Galaxy Q&A" link in the "Help" menu The + Galaxy Q&A site is under development; when the site is done, this + URL will be set and uncommented. +:Default: ``None`` +:Type: str + + +~~~~~~~~~~~~~~~~~~ +``static_enabled`` +~~~~~~~~~~~~~~~~~~ + +:Description: + Serve static content, which must be enabled if you're not serving + it via a proxy server. These options should be self explanatory + and so are not documented individually. You can use these paths + (or ones in the proxy server) to point to your own styles. +:Default: ``true`` +:Type: bool + + +~~~~~~~~~~~~~~~~~~~~~ +``static_cache_time`` +~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Serve static content, which must be enabled if you're not serving + it via a proxy server. These options should be self explanatory + and so are not documented individually. You can use these paths + (or ones in the proxy server) to point to your own styles. +:Default: ``360`` +:Type: int + + +~~~~~~~~~~~~~~ +``static_dir`` +~~~~~~~~~~~~~~ + +:Description: + Serve static content, which must be enabled if you're not serving + it via a proxy server. These options should be self explanatory + and so are not documented individually. You can use these paths + (or ones in the proxy server) to point to your own styles. +:Default: ``static/`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~~ +``static_images_dir`` +~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Serve static content, which must be enabled if you're not serving + it via a proxy server. These options should be self explanatory + and so are not documented individually. You can use these paths + (or ones in the proxy server) to point to your own styles. +:Default: ``static/images`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~~~ +``static_favicon_dir`` +~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Serve static content, which must be enabled if you're not serving + it via a proxy server. These options should be self explanatory + and so are not documented individually. You can use these paths + (or ones in the proxy server) to point to your own styles. +:Default: ``static/favicon.ico`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~~~ +``static_scripts_dir`` +~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Serve static content, which must be enabled if you're not serving + it via a proxy server. These options should be self explanatory + and so are not documented individually. You can use these paths + (or ones in the proxy server) to point to your own styles. +:Default: ``static/scripts/`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~ +``static_style_dir`` +~~~~~~~~~~~~~~~~~~~~ + +:Description: + Serve static content, which must be enabled if you're not serving + it via a proxy server. These options should be self explanatory + and so are not documented individually. You can use these paths + (or ones in the proxy server) to point to your own styles. +:Default: ``static/june_2007_style/blue`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~~ +``static_robots_txt`` +~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Serve static content, which must be enabled if you're not serving + it via a proxy server. These options should be self explanatory + and so are not documented individually. You can use these paths + (or ones in the proxy server) to point to your own styles. +:Default: ``static/robots.txt`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~~~ +``display_chunk_size`` +~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Incremental Display Options +:Default: ``65536`` +:Type: int + + +~~~~~~~~~~~~~~~~~~~~ +``apache_xsendfile`` +~~~~~~~~~~~~~~~~~~~~ + +:Description: + For help on configuring the Advanced proxy features, see: + http://usegalaxy.org/production Apache can handle file downloads + (Galaxy-to-user) via mod_xsendfile. Set this to True to inform + Galaxy that mod_xsendfile is enabled upstream. +:Default: ``false`` +:Type: bool + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``nginx_x_accel_redirect_base`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + The same download handling can be done by nginx using X-Accel- + Redirect. This should be set to the path defined in the nginx + config as an internal redirect with access to Galaxy's data files + (see documentation linked above). +:Default: ``false`` +:Type: bool + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``nginx_x_archive_files_base`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + nginx can make use of mod_zip to create zip files containing + multiple library files. If using X-Accel-Redirect, this can be + the same value as that option. +:Default: ``false`` +:Type: bool + + +~~~~~~~~~~~~~~~~~ +``upstream_gzip`` +~~~~~~~~~~~~~~~~~ + +:Description: + If using compression in the upstream proxy server, use this option + to disable gzipping of library .tar.gz and .zip archives, since + the proxy server will do it faster on the fly. +:Default: ``false`` +:Type: bool + + +~~~~~~~~~~~~~~~~~~~ +``x_frame_options`` +~~~~~~~~~~~~~~~~~~~ + +:Description: + The following default adds a header to web request responses that + will cause modern web browsers to not allow Galaxy to be embedded + in the frames of web applications hosted at other hosts - this can + help prevent a class of attack called clickjacking + (https://www.owasp.org/index.php/Clickjacking). If you configure + a proxy in front of Galaxy - please ensure this header remains + intact to protect your users. Uncomment and leave empty to not + set the `X-Frame-Options` header. +:Default: ``SAMEORIGIN`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~~~ +``nginx_upload_store`` +~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + nginx can also handle file uploads (user-to-Galaxy) via + nginx_upload_module. Configuration for this is complex and + explained in detail in the documentation linked above. The upload + store is a temporary directory in which files uploaded by the + upload module will be placed. +:Default: ``false`` +:Type: bool + + +~~~~~~~~~~~~~~~~~~~~~ +``nginx_upload_path`` +~~~~~~~~~~~~~~~~~~~~~ + +:Description: + This value overrides the action set on the file upload form, e.g. + the web path where the nginx_upload_module has been configured to + intercept upload requests. +:Default: ``false`` +:Type: bool + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``nginx_upload_job_files_store`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Galaxy can also use nginx_upload_module to receive files staged + out upon job completion by remote job runners (i.e. Pulsar) that + initiate staging operations on the remote end. See the Galaxy + nginx documentation for the corresponding nginx configuration. +:Default: ``false`` +:Type: bool + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``nginx_upload_job_files_path`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Galaxy can also use nginx_upload_module to receive files staged + out upon job completion by remote job runners (i.e. Pulsar) that + initiate staging operations on the remote end. See the Galaxy + nginx documentation for the corresponding nginx configuration. +:Default: ``false`` +:Type: bool + + +~~~~~~~~~~~~~~~~~~~~~~~~ +``dynamic_proxy_manage`` +~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Have Galaxy manage dynamic proxy component for routing requests to + other services based on Galaxy's session cookie. It will attempt + to do this by default though you do need to install node+npm and + do an npm install from `lib/galaxy/web/proxy/js`. It is generally + more robust to configure this externally, managing it however + Galaxy is managed. If True, Galaxy will only launch the proxy if + it is actually going to be used (e.g. for Jupyter). +:Default: ``true`` +:Type: bool + + +~~~~~~~~~~~~~~~~~ +``dynamic_proxy`` +~~~~~~~~~~~~~~~~~ + +:Description: + As of 16.04 Galaxy supports multiple proxy types. The original + NodeJS implementation, alongside a new Golang single-binary-no- + dependencies version. Valid values are (node, golang) +:Default: ``node`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``dynamic_proxy_session_map`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + The NodeJS dynamic proxy can use an SQLite database or a JSON file + for IPC, set that here. +:Default: ``database/session_map.sqlite`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``dynamic_proxy_bind_port`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Set the port and IP for the the dynamic proxy to bind to, this + must match the external configuration if dynamic_proxy_manage is + False. +:Default: ``8800`` +:Type: int + + +~~~~~~~~~~~~~~~~~~~~~~~~~ +``dynamic_proxy_bind_ip`` +~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Set the port and IP for the the dynamic proxy to bind to, this + must match the external configuration if dynamic_proxy_manage is + False. +:Default: ``0.0.0.0`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~~~~ +``dynamic_proxy_debug`` +~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Enable verbose debugging of Galaxy-managed dynamic proxy. +:Default: ``false`` +:Type: bool + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``dynamic_proxy_external_proxy`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + The dynamic proxy is proxied by an external proxy (e.g. apache + frontend to nodejs to wrap connections in SSL). +:Default: ``false`` +:Type: bool + + +~~~~~~~~~~~~~~~~~~~~~~~~ +``dynamic_proxy_prefix`` +~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Additionally, when the dynamic proxy is proxied by an upstream + server, you'll want to specify a prefixed URL so both Galaxy and + the proxy reside under the same path that your cookies are under. + This will result in a url like https://FQDN/galaxy- + prefix/gie_proxy for proxying +:Default: ``gie_proxy`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``dynamic_proxy_golang_noaccess`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + This attribute governs the minimum length of time between + consecutive HTTP/WS requests through the proxy, before the proxy + considers a container as being inactive and kills it. +:Default: ``60`` +:Type: int + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``dynamic_proxy_golang_clean_interval`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + In order to kill containers, the golang proxy has to check at some + interval for possibly dead containers. This is exposed as a + configurable parameter, but the default value is probably fine. +:Default: ``10`` +:Type: int + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``dynamic_proxy_golang_docker_address`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + The golang proxy needs to know how to talk to your docker daemon. + Currently TLS is not supported, that will come in an update. +:Default: ``unix:///var/run/docker.sock`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``dynamic_proxy_golang_api_key`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + The golang proxy uses a RESTful HTTP API for communication with + Galaxy instead of a JSON or SQLite file for IPC. If you do not + specify this, it will be set randomly for you. You should set this + if you are managing the proxy manually. +:Default: ``None`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~~~~~~~ +``auto_configure_logging`` +~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + If True, Galaxy will attempt to configure a simple root logger if + a "loggers" section does not appear in this configuration file. +:Default: ``true`` +:Type: bool + + +~~~~~~~~~~~~~ +``log_level`` +~~~~~~~~~~~~~ + +:Description: + Verbosity of console log messages. Acceptable values can be found + here: https://docs.python.org/2/library/logging.html#logging- + levels A custom debug level of "TRACE" is available for even more + verbosity. +:Default: ``DEBUG`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``database_engine_option_echo`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Print database operations to the server log (warning, quite + verbose!). +:Default: ``false`` +:Type: bool + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``database_engine_option_echo_pool`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Print database pool operations to the server log (warning, quite + verbose!). +:Default: ``false`` +:Type: bool + + +~~~~~~~~~~~~~~ +``log_events`` +~~~~~~~~~~~~~~ + +:Description: + Turn on logging of application events and some user events to the + database. +:Default: ``true`` +:Type: bool + + +~~~~~~~~~~~~~~~ +``log_actions`` +~~~~~~~~~~~~~~~ + +:Description: + Turn on logging of user actions to the database. Actions + currently logged are grid views, tool searches, and use of + "recently" used tools menu. The log_events and log_actions + functionality will eventually be merged. +:Default: ``true`` +:Type: bool + + +~~~~~~~~~~~~~~ +``fluent_log`` +~~~~~~~~~~~~~~ + +:Description: + Fluentd configuration. Various events can be logged to the + fluentd instance configured below by enabling fluent_log. +:Default: ``false`` +:Type: bool + + +~~~~~~~~~~~~~~~ +``fluent_host`` +~~~~~~~~~~~~~~~ + +:Description: + Fluentd configuration. Various events can be logged to the + fluentd instance configured below by enabling fluent_log. +:Default: ``localhost`` +:Type: str + + +~~~~~~~~~~~~~~~ +``fluent_port`` +~~~~~~~~~~~~~~~ + +:Description: + Fluentd configuration. Various events can be logged to the + fluentd instance configured below by enabling fluent_log. +:Default: ``24224`` +:Type: int + + +~~~~~~~~~~~~~~~~~~~~~ +``sanitize_all_html`` +~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Sanitize all HTML tool output. By default, all tool output served + as 'text/html' will be sanitized thoroughly. This can be disabled + if you have special tools that require unaltered output. WARNING: + disabling this does make the Galaxy instance susceptible to XSS + attacks initiated by your users. +:Default: ``true`` +:Type: bool + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``sanitize_whitelist_file`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Whitelist sanitization file. Datasets created by tools listed in + this file are trusted and will not have their HTML sanitized on + display. This can be manually edited or manipulated through the + Admin control panel -- see "Manage Display Whitelist" +:Default: ``config/sanitize_whitelist.txt`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``serve_xss_vulnerable_mimetypes`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + By default Galaxy will serve non-HTML tool output that may + potentially contain browser executable JavaScript content as plain + text. This will for instance cause SVG datasets to not render + properly and so may be disabled by setting the following option to + True. +:Default: ``false`` +:Type: bool + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``allowed_origin_hostnames`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Return a Access-Control-Allow-Origin response header that matches + the Origin header of the request if that Origin hostname matches + one of the strings or regular expressions listed here. This is a + comma separated list of hostname strings or regular expressions + beginning and ending with /. E.g. + mysite.com,google.com,usegalaxy.org,/^[\w\.]*example\.com/ See: + https://developer.mozilla.org/en- + US/docs/Web/HTTP/Access_control_CORS +:Default: ``None`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``trust_jupyter_notebook_conversion`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Set the following to True to use Jupyter nbconvert to build HTML + from Jupyter notebooks in Galaxy histories. This process may + allow users to execute arbitrary code or serve arbitrary HTML. If + enabled, Jupyter must be available and on Galaxy's PATH, to do + this run `pip install jinja2 pygments jupyter` in Galaxy's + virtualenv. +:Default: ``false`` +:Type: bool + + +~~~~~~~~~ +``debug`` +~~~~~~~~~ + +:Description: + Debug enables access to various config options useful for + development and debugging: use_lint, use_profile, use_printdebug + and use_interactive. It also causes the files used by PBS/SGE + (submission script, output, and error) to remain on disk after the + job is complete. +:Default: ``false`` +:Type: bool + + +~~~~~~~~~~~~ +``use_lint`` +~~~~~~~~~~~~ + +:Description: + Check for WSGI compliance. +:Default: ``false`` +:Type: bool + + +~~~~~~~~~~~~~~~ +``use_profile`` +~~~~~~~~~~~~~~~ + +:Description: + Run the Python profiler on each request. +:Default: ``false`` +:Type: bool + + +~~~~~~~~~~~~~~~~~~ +``use_printdebug`` +~~~~~~~~~~~~~~~~~~ + +:Description: + Intercept print statements and show them on the returned page. +:Default: ``true`` +:Type: bool + + +~~~~~~~~~~~~~~~~~~~ +``use_interactive`` +~~~~~~~~~~~~~~~~~~~ + +:Description: + Enable live debugging in your browser. This should NEVER be + enabled on a public site. Enabled in the sample config for + development. +:Default: ``true`` +:Type: bool + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``monitor_thread_join_timeout`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + When stopping Galaxy cleanly, how much time to give various + monitoring/polling threads to finish before giving up on joining + them. Set to 0 to disable this and restore the pre-18.01 default + behavior. +:Default: ``5`` +:Type: int + + +~~~~~~~~~~~~~~~~~ +``use_heartbeat`` +~~~~~~~~~~~~~~~~~ + +:Description: + Write thread status periodically to 'heartbeat.log', (careful, + uses disk space rapidly!). Useful to determine why your processes + may be consuming a lot of CPU. +:Default: ``false`` +:Type: bool + + +~~~~~~~~~~~~~~~~~~~~~~ +``heartbeat_interval`` +~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Control the period (in seconds) between dumps. Use -1 to disable. + Regardless of this setting, if use_heartbeat is enabled, you can + send a Galaxy process (unless running with uWSGI) SIGUSR1 (`kill + -USR1`) to force a dump. +:Default: ``20`` +:Type: int + + +~~~~~~~~~~~~~~~~~ +``heartbeat_log`` +~~~~~~~~~~~~~~~~~ + +:Description: + Heartbeat log filename. Can accept the template variables + {server_name} and {pid} +:Default: ``heartbeat_{server_name}.log`` +:Type: str + + +~~~~~~~~~~~~~~ +``sentry_dsn`` +~~~~~~~~~~~~~~ + +:Description: + Log to Sentry Sentry is an open source logging and error + aggregation platform. Setting sentry_dsn will enable the Sentry + middleware and errors will be sent to the indicated sentry + instance. This connection string is available in your sentry + instance under -> Settings -> API Keys. +:Default: ``None`` +:Type: str + + +~~~~~~~~~~~~~~~ +``statsd_host`` +~~~~~~~~~~~~~~~ + +:Description: + Log to statsd Statsd is an external statistics aggregator + (https://github.com/etsy/statsd) Enabling the following options + will cause galaxy to log request timing and other statistics to + the configured statsd instance. The statsd_prefix is useful if + you are running multiple Galaxy instances and want to segment + statistics between them within the same aggregator. +:Default: ``None`` +:Type: str + + +~~~~~~~~~~~~~~~ +``statsd_port`` +~~~~~~~~~~~~~~~ + +:Description: + Log to statsd Statsd is an external statistics aggregator + (https://github.com/etsy/statsd) Enabling the following options + will cause galaxy to log request timing and other statistics to + the configured statsd instance. The statsd_prefix is useful if + you are running multiple Galaxy instances and want to segment + statistics between them within the same aggregator. +:Default: ``8125`` +:Type: int + + +~~~~~~~~~~~~~~~~~ +``statsd_prefix`` +~~~~~~~~~~~~~~~~~ + +:Description: + Log to statsd Statsd is an external statistics aggregator + (https://github.com/etsy/statsd) Enabling the following options + will cause galaxy to log request timing and other statistics to + the configured statsd instance. The statsd_prefix is useful if + you are running multiple Galaxy instances and want to segment + statistics between them within the same aggregator. +:Default: ``galaxy`` +:Type: str + + +~~~~~~~~~~~~~~~~~ +``graphite_host`` +~~~~~~~~~~~~~~~~~ + +:Description: + Log to graphite Graphite is an external statistics aggregator + (https://github.com/graphite-project/carbon) Enabling the + following options will cause galaxy to log request timing and + other statistics to the configured graphite instance. The + graphite_prefix is useful if you are running multiple Galaxy + instances and want to segment statistics between them within the + same aggregator. +:Default: ``None`` +:Type: str + + +~~~~~~~~~~~~~~~~~ +``graphite_port`` +~~~~~~~~~~~~~~~~~ + +:Description: + Log to graphite Graphite is an external statistics aggregator + (https://github.com/graphite-project/carbon) Enabling the + following options will cause galaxy to log request timing and + other statistics to the configured graphite instance. The + graphite_prefix is useful if you are running multiple Galaxy + instances and want to segment statistics between them within the + same aggregator. +:Default: ``2003`` +:Type: int + + +~~~~~~~~~~~~~~~~~~~ +``graphite_prefix`` +~~~~~~~~~~~~~~~~~~~ + +:Description: + Log to graphite Graphite is an external statistics aggregator + (https://github.com/graphite-project/carbon) Enabling the + following options will cause galaxy to log request timing and + other statistics to the configured graphite instance. The + graphite_prefix is useful if you are running multiple Galaxy + instances and want to segment statistics between them within the + same aggregator. +:Default: ``galaxy`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~~~ +``library_import_dir`` +~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Add an option to the library upload form which allows + administrators to upload a directory of files. +:Default: ``None`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``user_library_import_dir`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Add an option to the library upload form which allows authorized + non-administrators to upload a directory of files. The configured + directory must contain sub-directories named the same as the non- + admin user's Galaxy login ( email ). The non-admin user is + restricted to uploading files or sub-directories of files + contained in their directory. +:Default: ``None`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``user_library_import_symlink_whitelist`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + For security reasons, users may not import any files that actually + lie outside of their `user_library_import_dir` (e.g. using + symbolic links). A list of directories can be allowed by setting + the following option (the list is comma-separated). Be aware that + *any* user with library import permissions can import from + anywhere in these directories (assuming they are able to create + symlinks to them). +:Default: ``None`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~ +``allow_path_paste`` +~~~~~~~~~~~~~~~~~~~~ + +:Description: + Allow admins to paste filesystem paths during upload. For + libraries this adds an option to the admin library upload tool + allowing admins to paste filesystem paths to files and directories + in a box, and these paths will be added to a library. For history + uploads, this allows pasting in paths as URIs. (i.e. prefixed with + file://). Set to True to enable. Please note the security + implication that this will give Galaxy Admins access to anything + your Galaxy user has access to. +:Default: ``false`` +:Type: bool + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``disable_library_comptypes`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Users may choose to download multiple files from a library in an + archive. By default, Galaxy allows users to select from a few + different archive formats if testing shows that Galaxy is able to + create files using these formats. Specific formats can be disabled + with this option, separate more than one format with commas. + Available formats are currently 'zip', 'gz', and 'bz2'. +:Default: ``None`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~~~~~~ +``transfer_manager_port`` +~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Some sequencer integration features in beta allow you to + automatically transfer datasets. This is done using a lightweight + transfer manager which runs outside of Galaxy (but is spawned by + it automatically). Galaxy will communicate with this manager over + the port specified here. +:Default: ``8163`` +:Type: int + + +~~~~~~~~~~~~~~~~~~~ +``tool_name_boost`` +~~~~~~~~~~~~~~~~~~~ + +:Description: + Boosts are used to customize this instance's toolbox search. The + higher the boost, the more importance the scoring algorithm gives + to the given field. Section refers to the tool group in the tool + panel. Rest of the fields are tool's attributes. +:Default: ``9`` +:Type: float + + +~~~~~~~~~~~~~~~~~~~~~~ +``tool_section_boost`` +~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Boosts are used to customize this instance's toolbox search. The + higher the boost, the more importance the scoring algorithm gives + to the given field. Section refers to the tool group in the tool + panel. Rest of the fields are tool's attributes. +:Default: ``3`` +:Type: float + + +~~~~~~~~~~~~~~~~~~~~~~~~~~ +``tool_description_boost`` +~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Boosts are used to customize this instance's toolbox search. The + higher the boost, the more importance the scoring algorithm gives + to the given field. Section refers to the tool group in the tool + panel. Rest of the fields are tool's attributes. +:Default: ``2`` +:Type: float + + +~~~~~~~~~~~~~~~~~~~~ +``tool_label_boost`` +~~~~~~~~~~~~~~~~~~~~ + +:Description: + Boosts are used to customize this instance's toolbox search. The + higher the boost, the more importance the scoring algorithm gives + to the given field. Section refers to the tool group in the tool + panel. Rest of the fields are tool's attributes. +:Default: ``1`` +:Type: float + + +~~~~~~~~~~~~~~~~~~~ +``tool_stub_boost`` +~~~~~~~~~~~~~~~~~~~ + +:Description: + Boosts are used to customize this instance's toolbox search. The + higher the boost, the more importance the scoring algorithm gives + to the given field. Section refers to the tool group in the tool + panel. Rest of the fields are tool's attributes. +:Default: ``5`` +:Type: float + + +~~~~~~~~~~~~~~~~~~~ +``tool_help_boost`` +~~~~~~~~~~~~~~~~~~~ + +:Description: + Boosts are used to customize this instance's toolbox search. The + higher the boost, the more importance the scoring algorithm gives + to the given field. Section refers to the tool group in the tool + panel. Rest of the fields are tool's attributes. +:Default: ``0.5`` +:Type: float + + +~~~~~~~~~~~~~~~~~~~~~ +``tool_search_limit`` +~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Limits the number of results in toolbox search. Can be used to + tweak how many results will appear. +:Default: ``20`` +:Type: int + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``tool_enable_ngram_search`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Enable/ disable Ngram-search for tools. It makes tool search + results tolerant for spelling mistakes in the query by dividing + the query into multiple ngrams and search for each ngram +:Default: ``false`` +:Type: bool + + +~~~~~~~~~~~~~~~~~~~~~~ +``tool_ngram_minsize`` +~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Set minimum size of ngrams +:Default: ``3`` +:Type: int + + +~~~~~~~~~~~~~~~~~~~~~~ +``tool_ngram_maxsize`` +~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Set maximum size of ngrams +:Default: ``4`` +:Type: int + + +~~~~~~~~~~~~~ +``id_secret`` +~~~~~~~~~~~~~ + +:Description: + Galaxy encodes various internal values when these values will be + output in some format (for example, in a URL or cookie). You + should set a key to be used by the algorithm that encodes and + decodes these values. It can be any string up to 448 bits long. + One simple way to generate a value for this is with the shell + command: python -c 'import time; print time.time()' | md5sum | + cut -f 1 -d ' ' +:Default: ``USING THE DEFAULT IS NOT SECURE!`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~ +``use_remote_user`` +~~~~~~~~~~~~~~~~~~~ + +:Description: + User authentication can be delegated to an upstream proxy server + (usually Apache). The upstream proxy should set a REMOTE_USER + header in the request. Enabling remote user disables regular + logins. For more information, see: + https://galaxyproject.org/admin/config/apache-proxy +:Default: ``false`` +:Type: bool + + +~~~~~~~~~~~~~~~~~~~~~~~~~~ +``remote_user_maildomain`` +~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + If use_remote_user is enabled and your external authentication + method just returns bare usernames, set a default mail domain to + be appended to usernames, to become your Galaxy usernames (email + addresses). +:Default: ``None`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~~~ +``remote_user_header`` +~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + If use_remote_user is enabled, the header that the upstream proxy + provides the remote username in defaults to HTTP_REMOTE_USER (the + 'HTTP_' is prepended by WSGI). This option allows you to change + the header. Note, you still need to prepend 'HTTP_' to the header + in this option, but your proxy server should *not* include 'HTTP_' + at the beginning of the header name. +:Default: ``HTTP_REMOTE_USER`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~~~ +``remote_user_secret`` +~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + If use_remote_user is enabled, anyone who can log in to the Galaxy + host may impersonate any other user by simply sending the + appropriate header. Thus a secret shared between the upstream + proxy server, and Galaxy is required. If anyone other than the + Galaxy user is using the server, then apache/nginx should pass a + value in the header 'GX_SECRET' that is identical to the one + below. +:Default: ``USING THE DEFAULT IS NOT SECURE!`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``remote_user_logout_href`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + If use_remote_user is enabled, you can set this to a URL that will + log your users out. +:Default: ``None`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``normalize_remote_user_email`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + If your proxy and/or authentication source does not normalize + e-mail addresses or user names being passed to Galaxy - set the + following option to True to force these to lower case. +:Default: ``false`` +:Type: bool + + +~~~~~~~~~~~~~~~ +``single_user`` +~~~~~~~~~~~~~~~ + +:Description: + If an e-mail address is specified here, it will hijack remote user + mechanics (``use_remote_user``) and have the webapp inject a + single fixed user. This has the effect of turning Galaxy into a + single user application with no login or external proxy required. + Such applications should not be exposed to the world. +:Default: ``None`` +:Type: str + + +~~~~~~~~~~~~~~~ +``admin_users`` +~~~~~~~~~~~~~~~ + +:Description: + Administrative users - set this to a comma-separated list of valid + Galaxy users (email addresses). These users will have access to + the Admin section of the server, and will have access to create + users, groups, roles, libraries, and more. For more information, + see: https://galaxyproject.org/admin/ +:Default: ``None`` +:Type: str + + +~~~~~~~~~~~~~~~~~ +``require_login`` +~~~~~~~~~~~~~~~~~ + +:Description: + Force everyone to log in (disable anonymous access). +:Default: ``false`` +:Type: bool + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``show_welcome_with_login`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Show the site's welcome page (see welcome_url) alongside the login + page (even if require_login is True) +:Default: ``false`` +:Type: bool + + +~~~~~~~~~~~~~~~~~~~~~~~ +``allow_user_creation`` +~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Allow unregistered users to create new accounts (otherwise, they + will have to be created by an admin). +:Default: ``true`` +:Type: bool + + +~~~~~~~~~~~~~~~~~~~~~~~ +``allow_user_deletion`` +~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Allow administrators to delete accounts. +:Default: ``false`` +:Type: bool + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``allow_user_impersonation`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Allow administrators to log in as other users (useful for + debugging) +:Default: ``false`` +:Type: bool + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``allow_user_dataset_purge`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Allow users to remove their datasets from disk immediately + (otherwise, datasets will be removed after a time period specified + by an administrator in the cleanup scripts run via cron) +:Default: ``true`` +:Type: bool + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``new_user_dataset_access_role_default_private`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + By default, users' data will be public, but setting this to True + will cause it to be private. Does not affect existing users and + data, only ones created after this option is set. Users may still + change their default back to public. +:Default: ``false`` +:Type: bool + + +~~~~~~~~~~~~~~~~~~~~ +``expose_user_name`` +~~~~~~~~~~~~~~~~~~~~ + +:Description: + Expose user list. Setting this to True will expose the user list + to authenticated users. This makes sharing datasets in smaller + galaxy instances much easier as they can type a name/email and + have the correct user show up. This makes less sense on large + public Galaxy instances where that data shouldn't be exposed. For + semi-public Galaxies, it may make sense to expose just the + username and not email, or vice versa. +:Default: ``false`` +:Type: bool + + +~~~~~~~~~~~~~~~~~~~~~ +``expose_user_email`` +~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Expose user list. Setting this to True will expose the user list + to authenticated users. This makes sharing datasets in smaller + galaxy instances much easier as they can type a name/email and + have the correct user show up. This makes less sense on large + public Galaxy instances where that data shouldn't be exposed. For + semi-public Galaxies, it may make sense to expose just the + username and not email, or vice versa. +:Default: ``false`` +:Type: bool + + +~~~~~~~~~~~~~~~~~~~~~~~ +``fetch_url_whitelist`` +~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Whitelist for local network addresses for "Upload from URL" + dialog. By default, Galaxy will deny access to the local network + address space, to prevent users making requests to services which + the administrator did not intend to expose. Previously, you could + request any network service that Galaxy might have had access to, + even if the user could not normally access it. It should be a + comma separated list of IP addresses or IP address/mask, e.g. + 10.10.10.10,10.0.1.0/24,fd00::/8 +:Default: ``None`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``enable_beta_ts_api_install`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Enable the new interface for installing tools from Tool Shed via + the API. Admin menu will list both if enabled. +:Default: ``true`` +:Type: bool + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``enable_beta_containers_interface`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Enable the new container interface for Interactive Environments +:Default: ``false`` +:Type: bool + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``tool_submission_burst_threads`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Set the following to a number of threads greater than 1 to spawn a + Python task queue for dealing with large tool submissions (either + through the tool form or as part of an individual workflow step + across large collection). This affects workflow scheduling and web + processes, not job handlers. This is a beta option and should not + be used in production. +:Default: ``1`` +:Type: int + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``tool_submission_burst_at`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + If tool_submission_burst_threads is set to a number greater than + 1, this is the number of jobs to schedule at which the task queue + will be created. +:Default: ``10`` +:Type: int + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``enable_beta_workflow_modules`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Enable beta workflow modules that should not yet be considered + part of Galaxy's stable API. +:Default: ``false`` +:Type: bool + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``force_beta_workflow_scheduled_min_steps`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Following options only apply to workflows scheduled using the + legacy workflow run API (running workflows via a POST to + /api/workflows). Force usage of Galaxy's beta workflow scheduler + under certain circumstances - this workflow scheduling forces + Galaxy to schedule workflows in the background so initial + submission of the workflows is significantly sped up. This does + however force the user to refresh their history manually to see + newly scheduled steps (for "normal" workflows - steps are still + scheduled far in advance of them being queued and scheduling here + doesn't refer to actual cluster job scheduling). Workflows + containing more than the specified number of steps will always use + the Galaxy's beta workflow scheduling. +:Default: ``250`` +:Type: int + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``force_beta_workflow_scheduled_for_collections`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Following options only apply to workflows scheduled using the + legacy workflow run API (running workflows via a POST to + /api/workflows). Force usage of Galaxy's beta workflow scheduler + under certain circumstances - this workflow scheduling forces + Galaxy to schedule workflows in the background so initial + submission of the workflows is significantly sped up. This does + however force the user to refresh their history manually to see + newly scheduled steps (for "normal" workflows - steps are still + scheduled far in advance of them being queued and scheduling here + doesn't refer to actual cluster job scheduling). Workflows + containing more than the specified number of steps will always use + the Galaxy's beta workflow scheduling. Switch to using Galaxy's + beta workflow scheduling for all workflows involving collections. +:Default: ``false`` +:Type: bool + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``parallelize_workflow_scheduling_within_histories`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + If multiple job handlers are enabled, allow Galaxy to schedule + workflow invocations in multiple handlers simultaneously. This is + discouraged because it results in a less predictable order of + workflow datasets within in histories. +:Default: ``false`` +:Type: bool + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``maximum_workflow_invocation_duration`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + This is the maximum amount of time a workflow invocation may stay + in an active scheduling state in seconds. Set to -1 to disable + this maximum and allow any workflow invocation to schedule + indefinitely. The default corresponds to 1 month. +:Default: ``2678400`` +:Type: int + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``maximum_workflow_jobs_per_scheduling_iteration`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Specify a maximum number of jobs that any given workflow + scheduling iteration can create. Set this to a positive integer to + prevent large collection jobs in a workflow from preventing other + jobs from executing. This may also mitigate memory issues + associated with scheduling workflows at the expense of increased + total DB traffic because model objects are expunged from the SQL + alchemy session between workflow invocation scheduling iterations. + Set to -1 to disable any such maximum (the default). +:Default: ``-1`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``history_local_serial_workflow_scheduling`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Force serial scheduling of workflows within the context of a + particular history +:Default: ``false`` +:Type: bool + + +~~~~~~~~~~~~~~~~~ +``enable_openid`` +~~~~~~~~~~~~~~~~~ + +:Description: + Enable authentication via OpenID. Allows users to log in to their + Galaxy account by authenticating with an OpenID provider. +:Default: ``false`` +:Type: bool + + +~~~~~~~~~~~~~~~~~~~~~~ +``openid_config_file`` +~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + If OpenID is enabled, this configuration file specifies providers + to use. Falls back to the .sample variant in config if default + does not exist. +:Default: ``config/openid_conf.xml`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``openid_consumer_cache_path`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + If OpenID is enabled, consumer cache directory to use. +:Default: ``database/openid_consumer_cache`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~ +``auth_config_file`` +~~~~~~~~~~~~~~~~~~~~ + +:Description: + XML config file that allows the use of different authentication + providers (e.g. LDAP) instead or in addition to local + authentication (.sample is used if default does not exist). +:Default: ``config/auth_conf.xml`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~ +``api_allow_run_as`` +~~~~~~~~~~~~~~~~~~~~ + +:Description: + Optional list of email addresses of API users who can make calls + on behalf of other users. +:Default: ``None`` +:Type: str + + +~~~~~~~~~~~~~~~~~~ +``master_api_key`` +~~~~~~~~~~~~~~~~~~ + +:Description: + Master key that allows many API admin actions to be used without + actually having a defined admin user in the database/config. Only + set this if you need to bootstrap Galaxy, you probably do not want + to set this on public servers. +:Default: ``changethis`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~ +``enable_tool_tags`` +~~~~~~~~~~~~~~~~~~~~ + +:Description: + Enable tool tags (associating tools with tags). This has its own + option since its implementation has a few performance implications + on startup for large servers. +:Default: ``false`` +:Type: bool + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``enable_unique_workflow_defaults`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Enable a feature when running workflows. When enabled, default + datasets are selected for "Set at Runtime" inputs from the history + such that the same input will not be selected twice, unless there + are more inputs than compatible datasets in the history. When + False, the most recently added compatible item in the history will + be used for each "Set at Runtime" input, independent of others in + the Workflow +:Default: ``false`` +:Type: bool + + +~~~~~~~~~~~~~~~~~~~~ +``myexperiment_url`` +~~~~~~~~~~~~~~~~~~~~ + +:Description: + The URL to the myExperiment instance being used (omit scheme but + include port) +:Default: ``www.myexperiment.org:80`` +:Type: str + + +~~~~~~~~~~~~~~~~~~ +``ftp_upload_dir`` +~~~~~~~~~~~~~~~~~~ + +:Description: + Enable Galaxy's "Upload via FTP" interface. You'll need to + install and configure an FTP server (we've used ProFTPd since it + can use Galaxy's database for authentication) and set the + following two options. This should point to a directory containing + subdirectories matching users' identifier (defaults to e-mail), + where Galaxy will look for files. +:Default: ``None`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~ +``ftp_upload_site`` +~~~~~~~~~~~~~~~~~~~ + +:Description: + This should be the hostname of your FTP server, which will be + provided to users in the help text. +:Default: ``None`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``ftp_upload_dir_identifier`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + User attribute to use as subdirectory in calculating default + ftp_upload_dir pattern. By default this will be email so a user's + FTP upload directory will be ${ftp_upload_dir}/${user.email}. Can + set this to other attributes such as id or username though. +:Default: ``email`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``ftp_upload_dir_template`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Python string template used to determine an FTP upload directory + for a particular user. +:Default: ``${ftp_upload_dir}/${ftp_upload_dir_identifier}`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~ +``ftp_upload_purge`` +~~~~~~~~~~~~~~~~~~~~ + +:Description: + This should be set to False to prevent Galaxy from deleting + uploaded FTP files as it imports them. +:Default: ``true`` +:Type: bool + + +~~~~~~~~~~~~~~~~~ +``enable_quotas`` +~~~~~~~~~~~~~~~~~ + +:Description: + Enable enforcement of quotas. Quotas can be set from the Admin + interface. +:Default: ``false`` +:Type: bool + + +~~~~~~~~~~~~~~~~~~~~~~~ +``expose_dataset_path`` +~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + This option allows users to see the full path of datasets via the + "View Details" option in the history. This option also exposes the + command line to non-administrative users. Administrators can + always see dataset paths. +:Default: ``false`` +:Type: bool + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``expose_potentially_sensitive_job_metrics`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + This option allows users to see the job metrics (except for + environment variables). +:Default: ``false`` +:Type: bool + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``enable_legacy_sample_tracking_api`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Enable the API for sample tracking +:Default: ``false`` +:Type: bool + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``enable_data_manager_user_view`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Allow non-admin users to view available Data Manager options. +:Default: ``false`` +:Type: bool + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``data_manager_config_file`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + File where Data Managers are configured (.sample used if default + does not exist). +:Default: ``config/data_manager_conf.xml`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``shed_data_manager_config_file`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + File where Tool Shed based Data Managers are configured. +:Default: ``config/shed_data_manager_conf.xml`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``galaxy_data_manager_data_path`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Directory to store Data Manager based tool-data; defaults to + tool_data_path. +:Default: ``tool-data`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~ +``job_config_file`` +~~~~~~~~~~~~~~~~~~~ + +:Description: + To increase performance of job execution and the web interface, + you can separate Galaxy into multiple processes. There are more + than one way to do this, and they are explained in detail in the + documentation: + https://galaxyproject.org/admin/config/performance/scaling By + default, Galaxy manages and executes jobs from within a single + process and notifies itself of new jobs via in-memory queues. + Jobs are run locally on the system on which Galaxy is started. + Advanced job running capabilities can be configured through the + job configuration file. +:Default: ``config/job_conf.xml`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``default_job_resubmission_condition`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + When jobs fail due to job runner problems, Galaxy can be + configured to retry these or reroute the jobs to new destinations. + Very fine control of this is available with resubmit declarations + in job_conf.xml. For simple deployments of Galaxy though, the + following attribute can define resubmission conditions for all job + destinations. If any job destination defines even one resubmission + condition explicitly in job_conf.xml - the condition described by + this option will not apply to that destination. For instance, the + condition: 'attempt < 3 and unknown_error and (time_running < 300 + or time_since_queued < 300)' would retry up to two times jobs that + didn't fail due to detected memory or walltime limits but did fail + quickly (either while queueing or running). The commented out + default below results in no default job resubmission condition, + failing jobs are just failed outright. +:Default: ``None`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~~~~~~~ +``track_jobs_in_database`` +~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + In multiprocess configurations, notification between processes + about new jobs must be done via the database. In single process + configurations, this can be done in memory, which is a bit + quicker. +:Default: ``true`` +:Type: bool + + +~~~~~~~~~~~~~~~~~~~ +``use_tasked_jobs`` +~~~~~~~~~~~~~~~~~~~ + +:Description: + This enables splitting of jobs into tasks, if specified by the + particular tool config. This is a new feature and not recommended + for production servers yet. +:Default: ``false`` +:Type: bool + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``local_task_queue_workers`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + This enables splitting of jobs into tasks, if specified by the + particular tool config. This is a new feature and not recommended + for production servers yet. +:Default: ``2`` +:Type: int + + +~~~~~~~~~~~~~~~~~~~~~~~ +``enable_job_recovery`` +~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Enable job recovery (if Galaxy is restarted while cluster jobs are + running, it can "recover" them when it starts). This is not safe + to use if you are running more than one Galaxy server using the + same database. +:Default: ``true`` +:Type: bool + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``retry_metadata_internally`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Although it is fairly reliable, setting metadata can occasionally + fail. In these instances, you can choose to retry setting it + internally or leave it in a failed state (since retrying + internally may cause the Galaxy process to be unresponsive). If + this option is set to False, the user will be given the option to + retry externally, or set metadata manually (when possible). +:Default: ``true`` +:Type: bool + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``max_metadata_value_size`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Very large metadata values can cause Galaxy crashes. This will + allow limiting the maximum metadata key size (in bytes used in + memory, not the end result database value size) Galaxy will + attempt to save with a dataset. Use 0 to disable this feature. + The default is 5MB, but as low as 1MB seems to be a reasonable + size. +:Default: ``5242880`` +:Type: int + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``outputs_to_working_directory`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + If (for example) you run on a cluster and your datasets (by + default, database/files/) are mounted read-only, this option will + override tool output paths to write outputs to the working + directory instead, and the job manager will move the outputs to + their proper place in the dataset directory on the Galaxy server + after the job completes. +:Default: ``false`` +:Type: bool + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``retry_job_output_collection`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + If your network filesystem's caching prevents the Galaxy server + from seeing the job's stdout and stderr files when it completes, + you can retry reading these files. The job runner will retry the + number of times specified below, waiting 1 second between tries. + For NFS, you may want to try the -noac mount option (Linux) or + -actimeo=0 (Solaris). +:Default: ``0`` +:Type: int + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``preserve_python_environment`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + In the past Galaxy would preserve its Python environment when + running jobs ( and still does for internal tools packaged with + Galaxy). This behavior exposes Galaxy internals to tools and could + result in problems when activating Python environments for tools + (such as with Conda packaging). The default legacy_only will + restrict this behavior to tools identified by the Galaxy team as + requiring this environment. Set this to "always" to restore the + previous behavior (and potentially break Conda dependency + resolution for many tools). Set this to legacy_and_local to + preserve the environment for legacy tools and locally managed + tools (this might be useful for instance if you are installing + software into Galaxy's virtualenv for tool development). +:Default: ``legacy_only`` +:Type: str + + +~~~~~~~~~~~~~~~ +``cleanup_job`` +~~~~~~~~~~~~~~~ + +:Description: + Clean up various bits of jobs left on the filesystem after + completion. These bits include the job working directory, + external metadata temporary files, and DRM stdout and stderr files + (if using a DRM). Possible values are: always, onsuccess, never +:Default: ``always`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``drmaa_external_runjob_script`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + When running DRMAA jobs as the Galaxy user + (https://galaxyproject.org/admin/config/performance/cluster + /#submitting-jobs-as-the-real-user) this script is used to run the + job script Galaxy generates for a tool execution. +:Default: ``sudo -E scripts/drmaa_external_runner.py --assign_all_groups`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``drmaa_external_killjob_script`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + When running DRMAA jobs as the Galaxy user + (https://galaxyproject.org/admin/config/performance/cluster + /#submitting-jobs-as-the-real-user) this script is used to kill + such jobs by Galaxy (e.g. if the user cancels the job). +:Default: ``sudo -E scripts/drmaa_external_killer.py`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~~~~~~ +``external_chown_script`` +~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + When running DRMAA jobs as the Galaxy user + (https://galaxyproject.org/admin/config/performance/cluster + /#submitting-jobs-as-the-real-user) this script is used transfer + permissions back and forth between the Galaxy user and the user + that is running the job. +:Default: ``sudo -E scripts/external_chown_script.py`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~~~~~ +``real_system_username`` +~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + When running DRMAA jobs as the Galaxy user + (https://galaxyproject.org/admin/config/performance/cluster + /#submitting-jobs-as-the-real-user) Galaxy can extract the user + name from the email address (actually the local-part before the @) + or the username which are both stored in the Galaxy data base. The + latter option is particularly useful for installations that get + the authentication from LDAP. Also, Galaxy can accept the name of + a common system user (eg. galaxy_worker) who can run every job + being submitted. This user should not be the same user running the + galaxy system. Possible values are user_email (default), username + or +:Default: ``user_email`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~~~~~~~ +``environment_setup_file`` +~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + File to source to set up the environment when running jobs. By + default, the environment in which the Galaxy server starts is used + when running jobs locally, and the environment set up per the + DRM's submission method and policy is used when running jobs on a + cluster (try testing with `qsub` on the command line). + environment_setup_file can be set to the path of a file on the + cluster that should be sourced by the user to set up the + environment prior to running tools. This can be especially useful + for running jobs as the actual user, to remove the need to + configure each user's environment individually. +:Default: ``None`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``job_resource_params_file`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Optional file containing job resource data entry fields + definition. These fields will be presented to users in the tool + forms and allow them to overwrite default job resources such as + number of processors, memory and walltime. +:Default: ``config/job_resource_params_conf.xml`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~~~~~ +``cache_user_job_count`` +~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + If using job concurrency limits (configured in job_config_file), + several extra database queries must be performed to determine the + number of jobs a user has dispatched to a given destination. By + default, these queries will happen for every job that is waiting + to run, but if cache_user_job_count is set to True, it will only + happen once per iteration of the handler queue. Although better + for performance due to reduced queries, the trade-off is a greater + possibility that jobs will be dispatched past the configured + limits if running many handlers. +:Default: ``false`` +:Type: bool + + +~~~~~~~~~~~~~~~~ +``tool_filters`` +~~~~~~~~~~~~~~~~ + +:Description: + Define toolbox filters (https://galaxyproject.org/user-defined- + toolbox-filters/) that admins may use to restrict the tools to + display. +:Default: ``None`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~~~ +``tool_label_filters`` +~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Define toolbox filters (https://galaxyproject.org/user-defined- + toolbox-filters/) that admins may use to restrict the tool labels + to display. +:Default: ``None`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~~~~~ +``tool_section_filters`` +~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Define toolbox filters (https://galaxyproject.org/user-defined- + toolbox-filters/) that admins may use to restrict the tool + sections to display. +:Default: ``None`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~~ +``user_tool_filters`` +~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Define toolbox filters (https://galaxyproject.org/user-defined- + toolbox-filters/) that users may use to restrict the tools to + display. +:Default: ``examples:restrict_upload_to_admins, examples:restrict_encode`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``user_tool_section_filters`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Define toolbox filters (https://galaxyproject.org/user-defined- + toolbox-filters/) that users may use to restrict the tool sections + to display. +:Default: ``examples:restrict_text`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``user_tool_label_filters`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Define toolbox filters (https://galaxyproject.org/user-defined- + toolbox-filters/) that users may use to restrict the tool labels + to display. +:Default: ``examples:restrict_upload_to_admins, examples:restrict_encode`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``toolbox_filter_base_modules`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + The base module(s) that are searched for modules for toolbox + filtering (https://galaxyproject.org/user-defined-toolbox- + filters/) producedures. +:Default: ``galaxy.tools.toolbox.filters,galaxy.tools.filters`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``amqp_internal_connection`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Galaxy uses AMQP internally for communicating between processes. + For example, when reloading the toolbox or locking job execution, + the process that handled that particular request will tell all + others to also reload, lock jobs, etc. For connection examples, + see http://docs.celeryproject.org/projects/kombu/en/latest/usergui + de/connections.html Without specifying anything here, galaxy will + first attempt to use your specified database_connection above. If + that's not specified either, Galaxy will automatically create and + use a separate sqlite database located in your /database + folder (indicated in the commented out line below). +:Default: ``sqlalchemy+sqlite:///./database/control.sqlite?isolation_level=IMMEDIATE`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``enable_communication_server`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Galaxy real time communication server settings +:Default: ``false`` +:Type: bool + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``communication_server_host`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Galaxy real time communication server settings +:Default: ``http://localhost`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``communication_server_port`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Galaxy real time communication server settings +:Default: ``7070`` +:Type: int + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``persistent_communication_rooms`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + persistent_communication_rooms is a comma-separated list of rooms + that should be always available. +:Default: ``None`` +:Type: str + + + diff --git a/doc/source/admin/index.rst b/doc/source/admin/index.rst index 33902198a43..33b4d74f7a3 100644 --- a/doc/source/admin/index.rst +++ b/doc/source/admin/index.rst @@ -15,5 +15,6 @@ This documentation is in the midst of being ported and unified based on resource dependency_resolvers conda_faq framework_dependencies + options reports useful_scripts diff --git a/doc/source/admin/options.rst b/doc/source/admin/options.rst new file mode 100644 index 00000000000..ed968bf2fdd --- /dev/null +++ b/doc/source/admin/options.rst @@ -0,0 +1,5 @@ +---------------------------- +Configuration Options +---------------------------- + +.. include:: galaxy_options.rst diff --git a/lib/galaxy/webapps/config_manage.py b/lib/galaxy/webapps/config_manage.py index 06c0c70a691..2a06c470a2b 100644 --- a/lib/galaxy/webapps/config_manage.py +++ b/lib/galaxy/webapps/config_manage.py @@ -285,6 +285,10 @@ def _to_rst(args, app_desc, heading_level="~"): schema = app_desc.schema for key, value in schema.app_schema.items(): default = None if "default" not in value else value["default"] + if default is True: + default = "true" + elif default is False: + default = "false" option = schema.get_app_option(key) option_value = OptionValue(key, default, option) _write_option_rst(args, rst, key, heading_level, option_value) From 7bae23e105a46378b6042b6d00b1c61778349c0f Mon Sep 17 00:00:00 2001 From: John Chilton Date: Fri, 1 Dec 2017 09:30:53 -0500 Subject: [PATCH 021/112] yaml_config - update code base for converting galaxy.ini.sample to YAML. --- .travis.yml | 2 +- scripts/common_startup.sh | 7 +++++-- scripts/galaxy-main | 2 +- .../tool_shed/bootstrap_tool_shed/bootstrap_tool_shed.sh | 2 +- scripts/tool_shed/bootstrap_tool_shed/bootstrap_util.py | 2 +- test/base/driver_util.py | 4 ++-- test/docker/base/run_test_wrapper.sh | 4 ++-- 7 files changed, 13 insertions(+), 10 deletions(-) diff --git a/.travis.yml b/.travis.yml index bde4abd6f49..540f96f997e 100644 --- a/.travis.yml +++ b/.travis.yml @@ -24,7 +24,7 @@ addons: install: - pip install tox - - if [ "$TOX_ENV" == "first_startup" ]; then bash -c "bash scripts/common_startup.sh && wget -q https://github.com/jmchilton/galaxy-downloads/raw/master/db_gx_rev_0127.sqlite && mv db_gx_rev_0127.sqlite database/universe.sqlite && bash manage_db.sh -c ./config/galaxy.ini.sample upgrade"; fi + - if [ "$TOX_ENV" == "first_startup" ]; then bash -c "bash scripts/common_startup.sh && wget -q https://github.com/jmchilton/galaxy-downloads/raw/master/db_gx_rev_0127.sqlite && mv db_gx_rev_0127.sqlite database/universe.sqlite && bash manage_db.sh -c ./config/galaxy.yml.sample upgrade"; fi script: tox -e $TOX_ENV diff --git a/scripts/common_startup.sh b/scripts/common_startup.sh index 1fdff27ad4a..1fee176ed5a 100755 --- a/scripts/common_startup.sh +++ b/scripts/common_startup.sh @@ -61,12 +61,15 @@ for rmfile in $RMFILES; do [ -f "$rmfile" ] && rm -f "$rmfile" done -: ${GALAXY_CONFIG_FILE:=config/galaxy.ini} +: ${GALAXY_CONFIG_FILE:=config/galaxy.yml} +if [ ! -f "$GALAXY_CONFIG_FILE" ]; then + GALAXY_CONFIG_FILE=config/galaxy.ini +fi if [ ! -f "$GALAXY_CONFIG_FILE" ]; then GALAXY_CONFIG_FILE=universe_wsgi.ini fi if [ ! -f "$GALAXY_CONFIG_FILE" ]; then - GALAXY_CONFIG_FILE=config/galaxy.ini.sample + GALAXY_CONFIG_FILE=config/galaxy.yml.sample fi : ${GALAXY_VIRTUAL_ENV:=.venv} diff --git a/scripts/galaxy-main b/scripts/galaxy-main index 9cb5b7da345..f0242c16b0a 100755 --- a/scripts/galaxy-main +++ b/scripts/galaxy-main @@ -55,7 +55,7 @@ GALAXY_ROOT_DIR = os.path.abspath(os.path.join(os.path.dirname(real_file), os.pa GALAXY_LIB_DIR = os.path.join(GALAXY_ROOT_DIR, "lib") DEFAULT_INI_APP = "main" DEFAULT_CONFIG_SECTION = "galaxy" -DEFAULT_INIS = ["config/galaxy.ini", "universe_wsgi.ini", "config/galaxy.ini.sample"] +DEFAULT_INIS = ["config/galaxy.yml", "config/galaxy.ini", "universe_wsgi.ini", "config/galaxy.yml.sample"] DEFAULT_PID = "galaxy.pid" DEFAULT_VERBOSE = True diff --git a/scripts/tool_shed/bootstrap_tool_shed/bootstrap_tool_shed.sh b/scripts/tool_shed/bootstrap_tool_shed/bootstrap_tool_shed.sh index 4a7b61208e6..ce7005f9fc1 100755 --- a/scripts/tool_shed/bootstrap_tool_shed/bootstrap_tool_shed.sh +++ b/scripts/tool_shed/bootstrap_tool_shed/bootstrap_tool_shed.sh @@ -3,7 +3,7 @@ # Activate the virtualenv, if it exists. [ -f ./.venv/bin/activate ] && . ./.venv/bin/activate -: ${TOOL_SHED_CONFIG_FILE:=config/tool_shed.ini.sample} +: ${TOOL_SHED_CONFIG_FILE:=config/tool_shed.yml.sample} stop_err() { echo $1 diff --git a/scripts/tool_shed/bootstrap_tool_shed/bootstrap_util.py b/scripts/tool_shed/bootstrap_tool_shed/bootstrap_util.py index dacf5acb3d3..fded49a0f9e 100755 --- a/scripts/tool_shed/bootstrap_tool_shed/bootstrap_util.py +++ b/scripts/tool_shed/bootstrap_tool_shed/bootstrap_util.py @@ -124,7 +124,7 @@ def main(args): parser = optparse.OptionParser() -parser.add_option('-c', '--config_file', dest='config', action='store', default='config/tool_shed.ini.sample') +parser.add_option('-c', '--config_file', dest='config', action='store', default='config/tool_shed.yml.sample') parser.add_option('-e', '--execute', dest='method', action='store', default='check_db') (args, options) = parser.parse_args() diff --git a/test/base/driver_util.py b/test/base/driver_util.py index b9c83a50d28..7fd23cce018 100644 --- a/test/base/driver_util.py +++ b/test/base/driver_util.py @@ -508,7 +508,7 @@ def build_galaxy_app(simple_kwargs): """ log.info("Galaxy database connection: %s", simple_kwargs["database_connection"]) simple_kwargs['global_conf'] = get_webapp_global_conf() - simple_kwargs['global_conf']['__file__'] = "config/galaxy.ini.sample" + simple_kwargs['global_conf']['__file__'] = "config/galaxy.yml.sample" simple_kwargs = load_app_properties( kwds=simple_kwargs ) @@ -532,7 +532,7 @@ def build_shed_app(simple_kwargs): """ log.info("Tool shed database connection: %s", simple_kwargs["database_connection"]) # TODO: Simplify global_conf to match Galaxy above... - simple_kwargs['__file__'] = 'tool_shed_wsgi.ini.sample' + simple_kwargs['__file__'] = 'tool_shed_wsgi.yml.sample' simple_kwargs['global_conf'] = get_webapp_global_conf() app = ToolshedUniverseApplication(**simple_kwargs) diff --git a/test/docker/base/run_test_wrapper.sh b/test/docker/base/run_test_wrapper.sh index 0aa62242558..fd5c74a5da0 100644 --- a/test/docker/base/run_test_wrapper.sh +++ b/test/docker/base/run_test_wrapper.sh @@ -83,8 +83,8 @@ else GALAXY_CONFIG_OVERRIDE_DATABASE_CONNECTION="$GALAXY_TEST_DBURI" TOOL_SHED_CONFIG_OVERRIDE_DATABASE_CONNECTION="$TOOL_SHED_TEST_DBURI" GALAXY_CONFIG_MASTER_API_KEY=${GALAXY_CONFIG_MASTER_API_KEY:-"testmasterapikey"} - GALAXY_CONFIG_FILE=${GALAXY_CONFIG_FILE:-config/galaxy.ini.sample} - TOOL_SHED_CONFIG_FILE=${GALAXY_CONFIG_FILE:-config/tool_shed.ini.sample} + GALAXY_CONFIG_FILE=${GALAXY_CONFIG_FILE:-config/galaxy.yml.sample} + TOOL_SHED_CONFIG_FILE=${GALAXY_CONFIG_FILE:-config/tool_shed.yml.sample} GALAXY_CONFIG_CHECK_MIGRATE_TOOLS=false GALAXY_CONFIG_JOB_CONFIG_FILE=${GALAXY_CONFIG_JOB_CONFIG_FILE:-config/job_conf.xml.sample} GALAXY_CONFIG_FILE_PATH=${GALAXY_CONFIG_FILE_PATH:-/tmp/gx1} From ba35d474a012d2ef60a6191fbfe3ee03ed04e09c Mon Sep 17 00:00:00 2001 From: John Chilton Date: Fri, 1 Dec 2017 12:41:09 -0500 Subject: [PATCH 022/112] yaml_config - update admin docs for switch to YAML config. --- doc/source/admin/authentication.md | 31 +++++++++--------- doc/source/admin/conda_faq.rst | 32 +++++++++---------- doc/source/admin/dependency_resolvers.rst | 2 +- doc/source/admin/reports.md | 6 ++-- .../admin/special_topics/bug_reports.rst | 2 +- doc/source/admin/special_topics/chat.rst | 14 ++++---- .../interactive_environments.rst | 26 +++++++-------- 7 files changed, 57 insertions(+), 56 deletions(-) diff --git a/doc/source/admin/authentication.md b/doc/source/admin/authentication.md index 15ed1b5ef89..994fbb83dc6 100644 --- a/doc/source/admin/authentication.md +++ b/doc/source/admin/authentication.md @@ -33,8 +33,8 @@ of documentation on configuring these plugins. [OpenID](https://en.wikipedia.org/wiki/OpenID) is becoming less popular and probably shouldn't be used the primary mechanism for authentication in Galaxy but it is an available option. -Enabling OpenID requires you to edit Galaxy's configuration file and set `enable_openid` to `True`. This file is -likely located in `config/galaxy.ini` and can be created by copying Galaxy's sample `config/galaxy.ini.sample`. +Enabling OpenID requires you to edit Galaxy's configuration file and set `enable_openid` to `true`. This file is +likely located in `config/galaxy.yml` and can be created by copying Galaxy's sample `config/galaxy.yml.sample`. Enabling this option enables OpenID and causes the OpenID form to be displayed on the login screen. @@ -55,8 +55,8 @@ and the "external" flag should itself prohibit the traditional mechanism being u user returns to Galaxy and is not already logged in, the details of the user are retrieved according to the identity information supplied by the Web server. -Enabling remote user authentication requires you to edit Galaxy's configuration file and set `use_remote_user` to `True`. -This file is likely located in `config/galaxy.ini` and can be created by copying Galaxy's sample `config/galaxy.ini.sample`. +Enabling remote user authentication requires you to edit Galaxy's configuration file and set `use_remote_user` to `true`. +This file is likely located in `config/galaxy.yml` and can be created by copying Galaxy's sample `config/galaxy.yml.sample`. Additional Galaxy configuration options related to remote user authentication are documented in Galaxy's sample configuration file. The options ``remote_user_maildomain``, ``remote_user_header``, and ``normalize_remote_user_email`` can @@ -75,29 +75,30 @@ How to set up this config is presented here. ### Account activation feature -In the Galaxy config file **config/galaxy.ini** there is the user activation setting that you have to turn on. +In the Galaxy config file **config/galaxy.yml** there is the user activation setting that you have to turn on. -``` -user_activation_on = True +```yaml +user_activation_on: true ``` There is also the option for tracking jobs in database that is required to be turned on for the account activation to be effective. By default it is off. -``` -track_jobs_in_database = True +```yaml +track_jobs_in_database: true ``` After you turn on both of these every user that will try to register after this configuration file takes effect will have the verification email sent to the email address provided. Unless the Grace period (see below) is set, the user won't be able to login before the verification happens. Furthermore in order for this to work correctly smtp server and admin email should be set: -``` -#smtp_server = some.server.edu:587 -#smtp_username = example_username -#smtp_password = example_passsword -#activation_email = activation-noreply@example.com -#error_email_to = admin@example.com + +```yaml +smtp_server: some.server.edu:587 +smtp_username: example_username +smtp_password: example_passsword +activation_email: activation-noreply@example.com +error_email_to: admin@example.com ``` Smtp server takes care of the email sending and the activation_email email is used as the *From* address in the verification email. Furthermore the error_email_to is being shown to the user if the Galaxy detects its own misconfiguration. diff --git a/doc/source/admin/conda_faq.rst b/doc/source/admin/conda_faq.rst index a3838398d73..9937b98735e 100644 --- a/doc/source/admin/conda_faq.rst +++ b/doc/source/admin/conda_faq.rst @@ -63,19 +63,19 @@ entry should remain first. This means that tools that have specified Tool Shed p as their dependencies will work without a change. The most common configuration settings related to Conda are listed in Table 1. -See `galaxy.ini.sample`_ for the complete list. +See `galaxy.yml.sample`_ for the complete list. +-------------------------+------------------------------------+---------------------------+ | Setting | Default setting | Meaning | +-------------------------+------------------------------------+---------------------------+ -| ``conda_auto_init`` | ``True`` | If ``True``, Galaxy will | +| ``conda_auto_init`` | ``true`` | If ``true``, Galaxy will | | | | try to install Conda | | | | (the package manager) | | | | automatically if it | | | | cannot find a local copy | | | | already on the system | +-------------------------+------------------------------------+---------------------------+ -| ``conda_auto_install`` | ``False`` | If ``True``, Galaxy will | +| ``conda_auto_install`` | ``false`` | If ``true``, Galaxy will | | | | look for and install | | | | Conda packages for | | | | missing tool dependencies | @@ -99,8 +99,8 @@ admin to install and manage packages without touching Galaxy at all. Galaxy can handle these dependencies for you, but admins are not required to use Galaxy for dependency management. -There are a few new config options in the ``galaxy.ini`` file (see Table 1 or -`galaxy.ini.sample`_ for more information), but by default Galaxy will install +There are a few new config options in the ``galaxy.yml`` file (see Table 1 or +`galaxy.yml.sample`_ for more information), but by default Galaxy will install Conda (the package manager) and the required packages in the ``/_conda/`` directory. In this directory, Galaxy will create an ``envs`` folder with all of the environments managed by Galaxy. Each @@ -111,7 +111,7 @@ available before the tool is executed on your system. To summarize, there are four ways to manage Conda dependencies for use with Galaxy. For all of these options, Conda dependency management must -be configured in the ``dependency_resolvers_conf.xml`` and the ``galaxy.ini`` file. +be configured in the ``dependency_resolvers_conf.xml`` and the ``galaxy.yml`` file. #. Galaxy Admin Interface (>= 16.07) - Galaxy will install Conda tool dependencies when tools are installed from the Tool Shed if the @@ -121,7 +121,7 @@ be configured in the ``dependency_resolvers_conf.xml`` and the ``galaxy.ini`` fi #. Manual Install - Conda dependencies may be installed by administrators from the command line. Conda (and thus the Conda environments) should be installed in the location specified by the - ``conda_prefix`` path (defined in ``galaxy.ini`` and by default + ``conda_prefix`` path (defined in ``galaxy.yml`` and by default ``/_conda/`` directory). Galaxy will search these environments for required packages when tools are run. Conda environment names have to follow a specific naming pattern. As an @@ -157,11 +157,11 @@ will run on all major \*nix operating systems newer than 2007. 4. If I have Conda enabled, what do I need to do to install tools using it? For example, how can I install the latest Trinity? And how will I know the dependencies are installed? ********************************************************************************************************************************************************************************** -This depends on your ``galaxy.ini`` setting. Starting with release 16.07, Galaxy +This depends on your ``galaxy.yml`` settings. Starting with release 16.07, Galaxy can automatically install the Conda package manager for you if you have enabled ``conda_auto_init``. Galaxy can then install Trinity along with its dependencies using one of the methods listed in question 2 above. In particular, if -``conda_auto_install`` is ``True`` and Trinity is not installed yet, Galaxy will +``conda_auto_install`` is ``true`` and Trinity is not installed yet, Galaxy will try to install it via Conda when a Trinity job is launched. With release 16.07 you can see which dependencies are being used @@ -176,7 +176,7 @@ dependency resolvers configuration with regards to what will actually be used du the tool execution. To check if Galaxy has created a Trinity environment, have a look at folders under -``/_conda/envs/`` (or ``/envs`` if you have changed ``conda_prefix`` in your galaxy.ini file). +``/_conda/envs/`` (or ``/envs`` if you have changed ``conda_prefix`` in your ``galaxy.yml`` file). We recommend to use Conda on a tool-per-tool basis, by unchecking the checkbox for TS dependencies during the tool installation, and for tools where there @@ -224,7 +224,7 @@ The simple answer is: you don't need to do much to make Conda work for a tool. The ```` tag in the tool XML file is enough. The name and the version should correspond to a Conda package in the ``default``, ``r``, ``bioconda`` or ``iuc`` Conda channel (you can extend this list if you -like in your ``galaxy.ini`` ). If this is the case you are ready to go. Read +like in your ``galaxy.yml`` ). If this is the case you are ready to go. Read more about `Conda channels`_ and browse their packages on https://anaconda.org/ url followed by the channel name (e.g. `https://anaconda.org/bioconda `__ ). @@ -328,14 +328,14 @@ message appears in your logs: You can also use: $ conda clean --lock First, you may wish to enable cached dependencies. This can be done by setting -``use_cached_dependency_manager`` to ``True`` in ``galaxy.ini``. Without this +``use_cached_dependency_manager`` to ``true`` in ``galaxy.yml``. Without this option, many jobs will create a per-job Conda environment with just the dependencies needed for that job installed. This will be placed on the filesystem containg the job working directory. This is an expensive operation and Conda doesn't always link environments correctly across filesystems. Enabling this dependency caching will create a cache directory for each required combination of requirements inside the directory -specified by ``tool_dependency_cache_dir`` in ``galaxy.ini`` (defaulting to +specified by ``tool_dependency_cache_dir`` in ``galaxy.yml`` (defaulting to ``/_cache``). The cached dependency manager was added to the 16.10 release of Galaxy (see @@ -364,8 +364,8 @@ newer version of Conda than shipped with Galaxy as of 17.01. See the question be on upgrading Conda if you must use this trick. Alternatively, copying can be used when creating environments instead of links (either -symbolic or hard). To enable this set ``conda_copy_dependencies`` to ``True`` in -``galaxy.ini``. This requires at least version 16.07 of Galaxy. +symbolic or hard). To enable this set ``conda_copy_dependencies`` to ``true`` in +``galaxy.yml``. This requires at least version 16.07 of Galaxy. More reading on this can be found at `Conda Pull Request #3870`_, `Conda Issue #3308`, and Galaxy `Issue #3193`_. @@ -409,7 +409,7 @@ The command can obviously be adapted to install any version of Conda. .. _submit: https://bioconda.github.io/#step-4-join-the-team .. _BioConda: https://bioconda.github.io .. _contact with the IUC: https://gitter.im/galaxy-iuc/iuc -.. _galaxy.ini.sample: https://github.com/galaxyproject/galaxy/blob/dev/config/galaxy.ini.sample +.. _galaxy.yml.sample: https://docs.galaxyproject.org/en/master/admin/options.html .. _Pull Request #3106: https://github.com/galaxyproject/galaxy/pull/3106 .. _Pull Request #3348: https://github.com/galaxyproject/galaxy/pull/3348 .. _Pull Request #3391: https://github.com/galaxyproject/galaxy/pull/3391 diff --git a/doc/source/admin/dependency_resolvers.rst b/doc/source/admin/dependency_resolvers.rst index 12e93a77357..4205a41fc2c 100644 --- a/doc/source/admin/dependency_resolvers.rst +++ b/doc/source/admin/dependency_resolvers.rst @@ -92,7 +92,7 @@ installed packages. This resolver can be configured either to use the version st The Galaxy Packages dependency resolver takes a ``base_path`` argument that specifies the path under which it starts looking for the files it requires. The default value for this ``base_path`` is the -``tool_dependency_dir`` configured in Galaxy's ``config/galaxy.ini``. Below the base path, the Galaxy Packages +``tool_dependency_dir`` configured in Galaxy's ``config/galaxy.yml``. Below the base path, the Galaxy Packages resolver looks for directories named after tools, e.g. ``bedtools``. As mentioned before, this resolver works in versioned and versionless mode. The default mode is versioned, where the dependency resolver looks for a directory named after the dependency's version string. For example, if the Galaxy tool specifies that it diff --git a/doc/source/admin/reports.md b/doc/source/admin/reports.md index 425538951c2..71cb4924609 100644 --- a/doc/source/admin/reports.md +++ b/doc/source/admin/reports.md @@ -4,12 +4,12 @@ Galaxy includes a report tool that is separate from the main process but which g ## Setup on localhost -The report tool takes its configuration settings from a file called reports.ini, which is located in the config subdirectory of the Galaxy distribution. +The report tool takes its configuration settings from a file called `reports.yml`, which is located in the ``config/` subdirectory of the Galaxy distribution. Configuring the reports for your local setup is a case of: -* Making a copy of `reports.ini.sample` called `reports.ini`. -* Editing the `database_connection` parameter to match the one in your `galaxy.ini` file +* Making a copy of ``reports.yml.sample`` called `reports.yml`. +* Editing the `database_connection` parameter to match the one in your `galaxy.yml` file * Optionally, editing the `port` parameter (by default the tool uses port 9001) You should also set the 'salt' parameter `session_secret` if you intend to expose the reports via the web proxy (see below). diff --git a/doc/source/admin/special_topics/bug_reports.rst b/doc/source/admin/special_topics/bug_reports.rst index 07a4744fb4a..1ddb557914f 100644 --- a/doc/source/admin/special_topics/bug_reports.rst +++ b/doc/source/admin/special_topics/bug_reports.rst @@ -46,7 +46,7 @@ information about the job and links to the precise locations within Galaxy. As a plugin, nothing has changed to this functionality, though future updates may add features. It currently takes all of its configuration from your -``$GALAXY/config/galaxy.ini``, e.g. the variables ``error_email_to`` and +``$GALAXY/config/galaxy.yml``, e.g. the variables ``error_email_to`` and ``email_from``. JSON diff --git a/doc/source/admin/special_topics/chat.rst b/doc/source/admin/special_topics/chat.rst index fb249a4d5f4..f2ecbeddd14 100644 --- a/doc/source/admin/special_topics/chat.rst +++ b/doc/source/admin/special_topics/chat.rst @@ -23,7 +23,7 @@ This service will need to be deployed on a host that has: - Access to the Galaxy database - A port exposed -- A non-default ``id_secret`` set in your ``galaxy.ini`` +- A non-default ``id_secret`` set in your ``galaxy.yml`` We say "access to galaxy database", this service could run on an NFS mounted copy of Galaxy, if the host it is deployed on can access the database of the @@ -36,16 +36,16 @@ Deploying the Server The chat server is a very new feature in Galaxy and has been disabled by default at a number of levels, as not all users may wish to use this feature. -Configuration is managed in ``galaxy.ini``: +Configuration is managed in ``galaxy.yml``: -.. code-block:: ini +.. code-block:: yaml # Galaxy real time communication server settings - enable_communication_server = True - communication_server_host = http://localhost - communication_server_port = 7070 + enable_communication_server: True + communication_server_host: http://localhost + communication_server_port: 7070 # persistent_communication_rooms is a comma-separated list of rooms that should be always available. - persistent_communication_rooms = NGS,RNA-Seq,Genome Annotation + persistent_communication_rooms: NGS,RNA-Seq,Genome Annotation As you can see in this configuration, it is pointing at a service running on the same host as Galaxy, talking to port 7070. diff --git a/doc/source/admin/special_topics/interactive_environments.rst b/doc/source/admin/special_topics/interactive_environments.rst index 9f2ef730bdb..b2cbefd3d02 100644 --- a/doc/source/admin/special_topics/interactive_environments.rst +++ b/doc/source/admin/special_topics/interactive_environments.rst @@ -102,26 +102,26 @@ Galaxy runs as. Configuring the Proxy ^^^^^^^^^^^^^^^^^^^^^ -Configuration is all managed in ``galaxy.ini``. The default arguments used +Configuration is all managed in ``galaxy.yml``. The default arguments used for the proxy are: -.. code-block:: ini +.. code-block:: yaml - dynamic_proxy_manage=True - dynamic_proxy_session_map=database/session_map.sqlite - dynamic_proxy_bind_port=8800 - dynamic_proxy_bind_ip=0.0.0.0 - dynamic_proxy_debug=True + dynamic_proxy_manage: true + dynamic_proxy_session_map: database/session_map.sqlite + dynamic_proxy_bind_port: 8800 + dynamic_proxy_bind_ip: 0.0.0.0 + dynamic_proxy_debug: true As you can see most of these variables map directly to the command line arguments to the NodeJS script. There are a few extra parameters which will be needed if you run Galaxy behind an upstream proxy like nginx or Apache: -.. code-block:: ini +.. code-block:: yaml - dynamic_proxy_external_proxy=True - dynamic_proxy_prefix=gie_proxy + dynamic_proxy_external_proxy: true + dynamic_proxy_prefix: gie_proxy The first option says that you have Galaxy and the Galaxy NodeJS proxy wrapped in an upstream proxy like Apache or NGINX. This will cause Galaxy to connect @@ -139,7 +139,7 @@ second (``dynamic_proxy_prefix``) option sets the URL path that's used to differentiate requests that should go through the proxy to those that should go to Galaxy. You will need to add special upstream proxy configuration to handle this, and you'll need to use the same ``dynamic_proxy_prefix`` in your -``galaxy.ini`` that you use in your URL routes. +``galaxy.yml`` that you use in your URL routes. In the examples below, we assume that your Galaxy installation is available at a URL such as ``https://f.q.d.n/galaxy``. If instead it is available at a @@ -296,10 +296,10 @@ configuration file: swarm_mode = True You can also enable swarm mode for *all* GIE plugins by setting -``interactive_environment_swarm_mode`` in ``galaxy.ini`` to ``True``. If using +``interactive_environment_swarm_mode`` in ``galaxy.yml`` to ``True``. If using this setting, you must still set ``docker_connect_port`` in each GIE plugin's ini configuration file. The ``swarm_mode`` setting in individual GIE plugin -config files will override the value set in ``galaxy.ini``. +config files will override the value set in ``galaxy.yml``. Note that your Galaxy server does not need to be a member of the swarm itself. It can use the method outlined above in the `Docker on Another Host`_ section From 14f0185b217fad83009f2f8822a75774af42ae42 Mon Sep 17 00:00:00 2001 From: John Chilton Date: Fri, 1 Dec 2017 14:22:49 -0500 Subject: [PATCH 023/112] yaml_config - change test wrapper to work with either ini or yml in container. --- test/docker/base/run_test_wrapper.sh | 12 ++++++++++-- 1 file changed, 10 insertions(+), 2 deletions(-) diff --git a/test/docker/base/run_test_wrapper.sh b/test/docker/base/run_test_wrapper.sh index fd5c74a5da0..1bfd939fd6f 100644 --- a/test/docker/base/run_test_wrapper.sh +++ b/test/docker/base/run_test_wrapper.sh @@ -83,8 +83,16 @@ else GALAXY_CONFIG_OVERRIDE_DATABASE_CONNECTION="$GALAXY_TEST_DBURI" TOOL_SHED_CONFIG_OVERRIDE_DATABASE_CONNECTION="$TOOL_SHED_TEST_DBURI" GALAXY_CONFIG_MASTER_API_KEY=${GALAXY_CONFIG_MASTER_API_KEY:-"testmasterapikey"} - GALAXY_CONFIG_FILE=${GALAXY_CONFIG_FILE:-config/galaxy.yml.sample} - TOOL_SHED_CONFIG_FILE=${GALAXY_CONFIG_FILE:-config/tool_shed.yml.sample} + # This is a path baked inside of Docker it seems, so we should support both ini and + # YAML for some time. + GALAXY_CONFIG_FILE=${GALAXY_CONFIG_FILE:-config/galaxy.ini.sample} + if [ ! -f "$GALAXY_CONFIG_FILE" ]; then + GALAXY_CONFIG_FILE=config/galaxy.yml.sample + fi + TOOL_SHED_CONFIG_FILE=${GALAXY_CONFIG_FILE:-config/tool_shed.ini.sample} + if [ ! -f "$TOOL_SHED_CONFIG_FILE" ]; then + TOOL_SHED_CONFIG_FILE=config/tool_shed.yml.sample + fi GALAXY_CONFIG_CHECK_MIGRATE_TOOLS=false GALAXY_CONFIG_JOB_CONFIG_FILE=${GALAXY_CONFIG_JOB_CONFIG_FILE:-config/job_conf.xml.sample} GALAXY_CONFIG_FILE_PATH=${GALAXY_CONFIG_FILE_PATH:-/tmp/gx1} From f06860a8fb200f01154e4822b3931f32c882a706 Mon Sep 17 00:00:00 2001 From: John Chilton Date: Fri, 1 Dec 2017 15:08:32 -0500 Subject: [PATCH 024/112] yaml_config - Don't parse YAML configurations as ini files. --- lib/galaxy/config.py | 2 +- lib/galaxy/webapps/tool_shed/config.py | 2 +- 2 files changed, 2 insertions(+), 2 deletions(-) diff --git a/lib/galaxy/config.py b/lib/galaxy/config.py index cf751d0edb9..e6704cf3a1b 100644 --- a/lib/galaxy/config.py +++ b/lib/galaxy/config.py @@ -531,7 +531,7 @@ class Configuration(object): global_conf_parser = configparser.ConfigParser() self.config_file = None self.global_conf_parser = global_conf_parser - if global_conf and "__file__" in global_conf: + if global_conf and "__file__" in global_conf and ".yml" not in global_conf["__file__"]: self.config_file = global_conf['__file__'] global_conf_parser.read(global_conf['__file__']) # Heartbeat log file name override diff --git a/lib/galaxy/webapps/tool_shed/config.py b/lib/galaxy/webapps/tool_shed/config.py index 6a46410542f..8069a21a3e6 100644 --- a/lib/galaxy/webapps/tool_shed/config.py +++ b/lib/galaxy/webapps/tool_shed/config.py @@ -134,7 +134,7 @@ class Configuration(object): global_conf = kwargs.get('global_conf', None) global_conf_parser = configparser.ConfigParser() self.global_conf_parser = global_conf_parser - if global_conf and "__file__" in global_conf: + if global_conf and "__file__" in global_conf and ".yml" not in global_conf["__file__"]: global_conf_parser.read(global_conf['__file__']) self.running_functional_tests = string_as_bool(kwargs.get('running_functional_tests', False)) self.citation_cache_type = kwargs.get("citation_cache_type", "file") From 60cbcfd1eeb07a8b93e96ce148e911f1dfddb22b Mon Sep 17 00:00:00 2001 From: John Chilton Date: Fri, 1 Dec 2017 15:57:06 -0500 Subject: [PATCH 025/112] yaml_config - Try to fix first startup CI job for uWSGI default. --- .ci/first_startup.sh | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/.ci/first_startup.sh b/.ci/first_startup.sh index a05a3cf5388..778f73588d8 100644 --- a/.ci/first_startup.sh +++ b/.ci/first_startup.sh @@ -10,7 +10,7 @@ bash run.sh --daemon && \ sleep 1 i=$((i + 1)) done -kill -9 "$(cat paster.pid)" +kill -9 "$(cat galaxy.pid)" echo "exit code:$EXIT_CODE, showing startup log:" -cat paster.log +cat galaxy.log exit $EXIT_CODE From bce21ab3f3ef7948a53c251c45f36b386928a29e Mon Sep 17 00:00:00 2001 From: John Chilton Date: Fri, 1 Dec 2017 16:20:39 -0500 Subject: [PATCH 026/112] Axe special amqp config handling not used by modern messaging stuff. It wasn't compatible with YAML config and looks unused as far as I can tell. xref https://github.com/galaxyproject/galaxy/commit/6b92bf6eb8ca8a5114fc2ecf7fda64c011524b9f --- lib/galaxy/config.py | 8 -------- 1 file changed, 8 deletions(-) diff --git a/lib/galaxy/config.py b/lib/galaxy/config.py index e6704cf3a1b..66a9008e3d4 100644 --- a/lib/galaxy/config.py +++ b/lib/galaxy/config.py @@ -581,14 +581,6 @@ class Configuration(object): # Store advanced job management config self.job_handlers = [x.strip() for x in kwargs.get('job_handlers', self.server_name).split(',')] self.default_job_handlers = [x.strip() for x in kwargs.get('default_job_handlers', ','.join(self.job_handlers)).split(',')] - # Galaxy messaging (AMQP) configuration options - self.amqp = {} - try: - amqp_config = global_conf_parser.items("galaxy_amqp") - except configparser.NoSectionError: - amqp_config = {} - for k, v in amqp_config: - self.amqp[k] = v # Galaxy internal control queue configuration. # If specified in universe, use it, otherwise we use whatever 'real' # database is specified. Lastly, we create and use new sqlite database From 8f69d17e8612dd8f33355a4bfd7a46ba635f1403 Mon Sep 17 00:00:00 2001 From: Nate Coraor Date: Fri, 1 Dec 2017 16:25:20 -0500 Subject: [PATCH 027/112] Don't use uWSGI master mode by default. Fixes Ctrl+C on macOS and is really only important in production configs where you should be using a config file anyway. --- scripts/get_uwsgi_args.py | 3 +-- 1 file changed, 1 insertion(+), 2 deletions(-) diff --git a/scripts/get_uwsgi_args.py b/scripts/get_uwsgi_args.py index bd73a5501e6..d8fbc0e505e 100644 --- a/scripts/get_uwsgi_args.py +++ b/scripts/get_uwsgi_args.py @@ -22,7 +22,7 @@ ALIASES = { 'http': ('httprouter', 'socket', 'uwsgi-socket', 'suwsgi-socket', 'ssl-socket'), } DEFAULT_ARGS = { - '_all_': ('virtualenv', 'pythonpath', 'master', 'threads', 'http', 'static-map', 'die-on-term', 'hook-master-start', 'enable-threads'), + '_all_': ('virtualenv', 'pythonpath', 'threads', 'http', 'static-map', 'die-on-term', 'hook-master-start', 'enable-threads'), 'galaxy': ('py-call-osafterfork',), 'reports': (), 'tool_shed': (), @@ -89,7 +89,6 @@ def _get_uwsgi_args(cliargs, kwargs): defaults = { 'virtualenv': os.environ.get('VIRTUAL_ENV', './.venv'), 'pythonpath': 'lib', - 'master': True, 'threads': '4', 'http': 'localhost:{port}'.format(port=DEFAULT_PORTS[cliargs.app]), 'static-map': ('/static/style={here}/static/style/blue'.format(here=os.getcwd()), From cec42d1656f9e6ea5f28b3fd02dbe3eb3f1bf078 Mon Sep 17 00:00:00 2001 From: John Chilton Date: Sat, 2 Dec 2017 11:23:41 -0500 Subject: [PATCH 028/112] yaml_config - Update Conda FAQ to link out to last .ini variant of docs for those who need them. --- doc/source/admin/conda_faq.rst | 5 +++++ 1 file changed, 5 insertions(+) diff --git a/doc/source/admin/conda_faq.rst b/doc/source/admin/conda_faq.rst index 9937b98735e..7f611d227a2 100644 --- a/doc/source/admin/conda_faq.rst +++ b/doc/source/admin/conda_faq.rst @@ -4,6 +4,11 @@ Conda for Tool Dependencies =========================== +.. note:: This document describes configuring Galaxy using YAML based configuraiton + options. For Galaxy instances before version 18.01, `this variant + `__ of this + document will be more directly relatable. + Galaxy tools (also called wrappers) have tradionally used Tool Shed package recipes to install their dependencies. These were too tightly tied to Galaxy and to the Tool Shed and so have been replaced with Conda as the package From 33abb94252544686b313e7c238e19882bdcbc2af Mon Sep 17 00:00:00 2001 From: Nate Coraor Date: Mon, 4 Dec 2017 12:06:57 -0500 Subject: [PATCH 029/112] Drop missing --safe-pidfile uWSGI arg until it is released. --- scripts/common_startup_functions.sh | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/scripts/common_startup_functions.sh b/scripts/common_startup_functions.sh index 6acdf5bead4..722429b7c96 100644 --- a/scripts/common_startup_functions.sh +++ b/scripts/common_startup_functions.sh @@ -41,7 +41,7 @@ parse_common_args() { paster_args="$paster_args --pid-file $PID_FILE --log-file $LOG_FILE --daemon" # --daemonize2 waits until after the application has loaded # to daemonize, thus it stops if any errors are found - uwsgi_args="$uwsgi_args --daemonize2 $LOG_FILE --safe-pidfile $PID_FILE" + uwsgi_args="--daemonize2 $LOG_FILE --pidfile2 $PID_FILE $uwsgi_args" daemon_or_restart_arg_set=1 shift ;; From f5aa17df1893ed9901de629e602fa052c169fa25 Mon Sep 17 00:00:00 2001 From: Nate Coraor Date: Mon, 4 Dec 2017 16:11:04 -0500 Subject: [PATCH 030/112] Fix the use of --set galaxy_config_file with uWSGI where the app name is the PasteDeploy default `app:main`. --- lib/galaxy/web/stack/__init__.py | 26 +++++++++++++++----------- 1 file changed, 15 insertions(+), 11 deletions(-) diff --git a/lib/galaxy/web/stack/__init__.py b/lib/galaxy/web/stack/__init__.py index dcb13d9889f..458e768dbf5 100644 --- a/lib/galaxy/web/stack/__init__.py +++ b/lib/galaxy/web/stack/__init__.py @@ -18,6 +18,7 @@ from six import string_types from galaxy.util.bunch import Bunch from galaxy.util.facts import get_facts +from galaxy.util.path import has_ext from galaxy.util.properties import nice_config_parser from .message import ApplicationStackMessage, ApplicationStackMessageDispatcher from .transport import ApplicationStackTransport, UWSGIFarmMessageTransport @@ -181,21 +182,24 @@ class UWSGIApplicationStack(MessageApplicationStack): 'config_section': config_section, } uwsgi_opt = uwsgi.opt - # check for --yaml or --json uWSGI config options first - config_file = uwsgi_opt.get("yaml") or uwsgi_opt.get("json") - # --ini and --ini-paste don't behave the same way, but this method will only be called by mules if the main - # application was loaded with --ini-paste, so we can make some assumptions, most notably, uWSGI does not have - # any way to set the app name when loading with paste.deploy:loadapp(), so hardcoding the alternate section - # name to `app:main` is fine. - if config_file is None and uwsgi_opt.get("ini") or uwsgi_opt.get("ini-paste"): - config_file = uwsgi_opt.get("ini") or uwsgi_opt.get("ini-paste") - parser = nice_config_parser(config_file) - if not parser.has_section(config_section) and parser.has_section('app:main'): - kwds['config_section'] = 'app:main' + config_file = None # check for --set galaxy_config_file=, this overrides whatever config file uWSGI was loaded with (which # may not actually include a Galaxy config) if uwsgi_opt.get("galaxy_config_file"): config_file = uwsgi_opt.get("galaxy_config_file") + # check for --yaml or --json uWSGI config options next + if config_file is None: + config_file = uwsgi_opt.get("yaml") or uwsgi_opt.get("json") + # --ini and --ini-paste don't behave the same way, but this method will only be called by mules if the main + # application was loaded with --ini-paste, so we can make some assumptions, most notably, uWSGI does not have + # any way to set the app name when loading with paste.deploy:loadapp(), so hardcoding the alternate section + # name to `app:main` is fine. + if ((config_file is None and uwsgi_opt.get("ini") or uwsgi_opt.get("ini-paste")) + or has_ext(config_file, "ini", aliases=True, ignore="sample")): + config_file = config_file or uwsgi_opt.get("ini") or uwsgi_opt.get("ini-paste") + parser = nice_config_parser(config_file) + if not parser.has_section(config_section) and parser.has_section('app:main'): + kwds['config_section'] = 'app:main' kwds['config_file'] = config_file return kwds From 8cd23970fbb1f6250a65f570c288579777464cbf Mon Sep 17 00:00:00 2001 From: John Chilton Date: Wed, 6 Dec 2017 19:54:54 -0500 Subject: [PATCH 031/112] Fix for None config_file in web stack stuff. --- lib/galaxy/web/stack/__init__.py | 5 +++-- 1 file changed, 3 insertions(+), 2 deletions(-) diff --git a/lib/galaxy/web/stack/__init__.py b/lib/galaxy/web/stack/__init__.py index 458e768dbf5..6d92d45741d 100644 --- a/lib/galaxy/web/stack/__init__.py +++ b/lib/galaxy/web/stack/__init__.py @@ -194,8 +194,9 @@ class UWSGIApplicationStack(MessageApplicationStack): # application was loaded with --ini-paste, so we can make some assumptions, most notably, uWSGI does not have # any way to set the app name when loading with paste.deploy:loadapp(), so hardcoding the alternate section # name to `app:main` is fine. - if ((config_file is None and uwsgi_opt.get("ini") or uwsgi_opt.get("ini-paste")) - or has_ext(config_file, "ini", aliases=True, ignore="sample")): + has_ini_config = config_file is None and uwsgi_opt.get("ini") or uwsgi_opt.get("ini-paste") + has_ini_config = has_ini_config or (config_file and has_ext(config_file, "ini", aliases=True, ignore="sample")) + if has_ini_config: config_file = config_file or uwsgi_opt.get("ini") or uwsgi_opt.get("ini-paste") parser = nice_config_parser(config_file) if not parser.has_section(config_section) and parser.has_section('app:main'): From c99b4ece5bfb0b2d30049796cc9e415e05ef2092 Mon Sep 17 00:00:00 2001 From: John Chilton Date: Wed, 6 Dec 2017 20:18:26 -0500 Subject: [PATCH 032/112] [17.09] Deployer doc fixes. --- doc/source/admin/special_topics/apache.md | 2 +- doc/source/admin/special_topics/job_metrics.md | 4 +++- doc/source/admin/special_topics/nginx.md | 2 +- 3 files changed, 5 insertions(+), 3 deletions(-) diff --git a/doc/source/admin/special_topics/apache.md b/doc/source/admin/special_topics/apache.md index e88b1fc5048..bbb5f408958 100644 --- a/doc/source/admin/special_topics/apache.md +++ b/doc/source/admin/special_topics/apache.md @@ -180,7 +180,7 @@ For this to work, the user under which your nginx server runs will need read acc ### External user authentication - [Apache for External Authentication](https://galaxyproject.org/admin/config/apache-external-user-auth/) -- [Built-in Galaxy External Authentication](../authentication.md) +- [Built-in Galaxy External Authentication](../authentication.html) ### Display Sites diff --git a/doc/source/admin/special_topics/job_metrics.md b/doc/source/admin/special_topics/job_metrics.md index dc9a6179899..16e2934cfac 100644 --- a/doc/source/admin/special_topics/job_metrics.md +++ b/doc/source/admin/special_topics/job_metrics.md @@ -1,4 +1,6 @@ -AGalaxy contains a plugin infrastructure for collecting and displaying metrics for job execution (see the original [pull request](https://bitbucket.org/galaxy/galaxy-central/pull-request/352) for implementation details). +# Job Metrics + +Galaxy contains a plugin infrastructure for collecting and displaying metrics for job execution (see the original [pull request](https://bitbucket.org/galaxy/galaxy-central/pull-request/352) for implementation details). ## Configuration diff --git a/doc/source/admin/special_topics/nginx.md b/doc/source/admin/special_topics/nginx.md index b279face30d..4968c11edd6 100644 --- a/doc/source/admin/special_topics/nginx.md +++ b/doc/source/admin/special_topics/nginx.md @@ -304,4 +304,4 @@ server { # This you should already have. ### External User Authentication - [Nginx for External Authentication](https://galaxyproject.org/admin/config/nginx-external-user-auth/) -- [Built-in Galaxy External Authentication](../authentication.md) +- [Built-in Galaxy External Authentication](../authentication.html) From 0585efaaa7d7d63d54088e120e3d5a7cd7e6ef33 Mon Sep 17 00:00:00 2001 From: John Chilton Date: Wed, 6 Dec 2017 20:53:39 -0500 Subject: [PATCH 033/112] Update newer deployer config docs for switch to YAML config. --- doc/source/admin/cluster.md | 20 +++++----- doc/source/admin/jobs.md | 4 +- doc/source/admin/production.md | 20 +++++----- doc/source/admin/scaling.md | 6 +-- doc/source/admin/special_topics/apache.md | 13 +++--- doc/source/admin/special_topics/ftp.md | 4 +- doc/source/admin/special_topics/nginx.md | 22 +++++----- .../special_topics/performance_tracking.rst | 40 ++++++++++--------- doc/source/admin/special_topics/webhooks.rst | 2 +- doc/source/admin/tool_panel.rst | 4 +- 10 files changed, 71 insertions(+), 64 deletions(-) diff --git a/doc/source/admin/cluster.md b/doc/source/admin/cluster.md index 214fd00fc57..5f40c91440b 100644 --- a/doc/source/admin/cluster.md +++ b/doc/source/admin/cluster.md @@ -53,20 +53,20 @@ galaxy_user@node1% ``` -If your cluster nodes have Internet access (NAT is okay) and you want to run the data source tools (upload, ucsc, etc.) on the cluster (doing so is highly recommended), set `new_file_path` in `galaxy.ini` to a directory somewhere in your shared filesystem: +If your cluster nodes have Internet access (NAT is okay) and you want to run the data source tools (upload, ucsc, etc.) on the cluster (doing so is highly recommended), set `new_file_path` in `galaxy.yml` to a directory somewhere in your shared filesystem: -```ini -new_file_path = /clusterfs/galaxy/tmp +```yaml +new_file_path: /clusterfs/galaxy/tmp ``` Additionally some of the runners including DRMAA may use the ``cluster_files_directory`` for sharing files with the cluster, which defaults to ``database/pbs``. You may need to create this folder. -```ini -cluster_files_directory = database/pbs +```yaml +cluster_files_directory: database/pbs ``` -You may also find that attribute caching in your filesystem causes problems with job completion since it interferes with Galaxy detecting the presence and correct sizes of output files. In NFS caching can be disabled with the `-noac` mount option on Linux (on the Galaxy server), but this may have a significant impact on performance since all attributes will have to be read from the file server upon every file access. You should try the `retry_output_collection` option in `galaxy.ini` first to see if this solves the problem. +You may also find that attribute caching in your filesystem causes problems with job completion since it interferes with Galaxy detecting the presence and correct sizes of output files. In NFS caching can be disabled with the `-noac` mount option on Linux (on the Galaxy server), but this may have a significant impact on performance since all attributes will have to be read from the file server upon every file access. You should try the `retry_output_collection` option in `galaxy.yml` first to see if this solves the problem. ## Runner Configuration @@ -336,9 +336,9 @@ The directory specified in `new_file_path` in the Galaxy config should be world- The `outputs_to_working_directory` option in the Galaxy config **must** be set to `True`. This ensures that a tool/job's outputs are written to the temporary working directory, which (when using the real user system) is owned by the real user who submitted the job. If left set to the default (`False`), the tool will attempt to write directly to the directory specified in `file_path` (by default, `galaxy-app/database/files/`), which must be owned by the Galaxy user (and thus will not be writable by the real user). -For releases later than 17.05 you can configure the method how the system user is determined in `config/galaxy.ini` via the variable `real_system_username`. For determining the system user from the email adress stored in Galaxy set it to `user_email`, otherwise for determining the system user from the Galaxy user name set it to `username`. +For releases later than 17.05 you can configure the method how the system user is determined in `config/galaxy.yml` via the variable `real_system_username`. For determining the system user from the email adress stored in Galaxy set it to `user_email`, otherwise for determining the system user from the Galaxy user name set it to `username`. -Once these are set, you must set the `drmaa_external_*` and `external_chown_script` settings in the Galaxy config and configure `sudo(8)` to allow them to be run. A sudo config using the three scripts set in the sample `galaxy.ini` would be: +Once these are set, you must set the `drmaa_external_*` and `external_chown_script` settings in the Galaxy config and configure `sudo(8)` to allow them to be run. A sudo config using the three scripts set in the sample `galaxy.yml` would be: ``` galaxy ALL = (root) NOPASSWD: SETENV: /opt/galaxy/scripts/drmaa_external_runner.py @@ -348,8 +348,8 @@ galaxy ALL = (root) NOPASSWD: SETENV: /opt/galaxy/scripts/external_chown_script If your sudo config contains `Defaults requiretty`, this option must be disabled. -For Galaxy releases > 17.05 the sudo call has been moved to `galaxy.ini` and is thereby configurable by the Galaxy admin. This can be of interest because sudo removes `PATH`, `LD_LIBRARY_PATH`, etc. variables per default in some installations. In such cases the sudo calls in the three variables in galaxy.ini can be adapted, e.g., `sudo -E PATH=... LD_LIBRARY_PATH=... /PATH/TO/GALAXY/scripts/drmaa_external_runner.py`. In order to allow setting the variables this way adaptions to the sudo configuration might be necessary. -Also for Galaxy releases > 17.05: In order to allow `external_chown_script.py` to chown only path below certain entry points the variable `ALLOWED_PATHS` in the python script can be adapted. It is sufficient to include the directorries `job_working_directory` and `new_file_path` as configured in `galaxy.ini`. +For Galaxy releases > 17.05, the sudo call has been moved to `galaxy.yml` and is thereby configurable by the Galaxy admin. This can be of interest because sudo removes `PATH`, `LD_LIBRARY_PATH`, etc. variables per default in some installations. In such cases the sudo calls in the three variables in galaxy.yml can be adapted, e.g., `sudo -E PATH=... LD_LIBRARY_PATH=... /PATH/TO/GALAXY/scripts/drmaa_external_runner.py`. In order to allow setting the variables this way adaptions to the sudo configuration might be necessary. +Also for Galaxy releases > 17.05: In order to allow `external_chown_script.py` to chown only path below certain entry points the variable `ALLOWED_PATHS` in the python script can be adapted. It is sufficient to include the directorries `job_working_directory` and `new_file_path` as configured in `galaxy.yml`. It is also a good idea to make sure that only trusted users, e.g. root, have write access to all three scripts. diff --git a/doc/source/admin/jobs.md b/doc/source/admin/jobs.md index 35dc20471ea..1a06222fd4b 100644 --- a/doc/source/admin/jobs.md +++ b/doc/source/admin/jobs.md @@ -6,7 +6,7 @@ This document is a reference for the job configuration file. [Detailed document **The most up-to-date details of advanced job configuration features can be found in the [sample job_conf.xml](https://github.com/galaxyproject/galaxy/blob/dev/config/job_conf.xml.sample_advanced) found in the Galaxy distribution.** -Configuration of where to run jobs is performed in the `job_conf.xml` file in `$GALAXY_ROOT/config/`. The path to the config file can be overridden by setting the value of `job_config_file` in `config/galaxy.ini`. Sample configurations are provided at `galaxy-dist/config/job_conf.xml.sample_basic` and `galaxy-dist/config/job_conf.xml.sample_advanced`. The job configuration file is not required - if it does not exist, a default configuration that runs jobs on the local system (with a maximum of 4 concurrent jobs) will be used. `job_conf.xml.sample_basic` provides a configuration identical to the default configuration if no `job_conf.xml` exists. +Configuration of where to run jobs is performed in the `job_conf.xml` file in `$GALAXY_ROOT/config/`. The path to the config file can be overridden by setting the value of `job_config_file` in `config/galaxy.yml`. Sample configurations are provided at `galaxy-dist/config/job_conf.xml.sample_basic` and `galaxy-dist/config/job_conf.xml.sample_advanced`. The job configuration file is not required - if it does not exist, a default configuration that runs jobs on the local system (with a maximum of 4 concurrent jobs) will be used. `job_conf.xml.sample_basic` provides a configuration identical to the default configuration if no `job_conf.xml` exists. ## job_conf.xml Syntax @@ -237,7 +237,7 @@ The above examples demonstrate that the dynamic job destination framework will p ```eval_rst ``app`` - Global Galaxy application object, has attributes such as config (the configuration parameters loaded from ``config/galaxy.ini``) and ``job_config`` (Galaxy representation of the data loaded in from ``job_conf.xml``). + Global Galaxy application object, has attributes such as config (the configuration parameters loaded from ``config/galaxy.yml``) and ``job_config`` (Galaxy representation of the data loaded in from ``job_conf.xml``). ``user_email`` E-mail of user submitting this job. diff --git a/doc/source/admin/production.md b/doc/source/admin/production.md index dd73cf5b8b6..54091f5135a 100644 --- a/doc/source/admin/production.md +++ b/doc/source/admin/production.md @@ -37,17 +37,17 @@ nate@weyerbacher% sh run.sh ## Basic configuration -The steps to install Galaxy mostly follow those of the regular instructions at [Admin/GetGalaxy](https://getgalaxy.org). The difference is that after performing the groundwork above, you should initialize the configuration file (`cp config/galaxy.ini.sample config/galaxy.ini`) and modify it as outlined below before starting the server. If you make any changes to this configuration file while the server is running, you will have to restart the server for the changes to take effect. +The steps to install Galaxy mostly follow those of the regular instructions at [Admin/GetGalaxy](https://getgalaxy.org). The difference is that after performing the groundwork above, you should initialize the configuration file (`cp config/galaxy.yml.sample config/galaxy.yml`) and modify it as outlined below before starting the server. If you make any changes to this configuration file while the server is running, you will have to restart the server for the changes to take effect. ### Disable the developer settings -Two options are set in the sample `config/galaxy.ini` which should not be enabled on a production server. You should set both to `False`: +Two options are set in the sample `config/galaxy.yml` which should not be enabled on a production server. You should set both to `false`: -* `debug = False` - Disable middleware that loads the entire response in memory for displaying debugging information in the page. If left enabled, the proxy server may timeout waiting for a response or your Galaxy process may run out of memory if it's serving large files. -* `use_interactive = False` - Disables displaying and live debugging of tracebacks via the web. Leaving it enabled will expose your configuration (database password, id_secret, etc.). -* Disable `filter-with = gzip`. Leaving the gzip filter enabled will cause UI failures because of the way templates are streamed once `debug` is set to `False`. You will still be able (and are encouraged) to enable gzip in the proxy server. +* `debug: false` - Disable middleware that loads the entire response in memory for displaying debugging information in the page. If left enabled, the proxy server may timeout waiting for a response or your Galaxy process may run out of memory if it's serving large files. +* `use_interactive: false` - Disables displaying and live debugging of tracebacks via the web. Leaving it enabled will expose your configuration (database password, id_secret, etc.). +* Disable `filter-with: gzip`. Leaving the gzip filter enabled will cause UI failures because of the way templates are streamed once `debug` is set to `False`. You will still be able (and are encouraged) to enable gzip in the proxy server. -During deployment, you may run into problems with failed jobs. By default, Galaxy removes files related to job execution. You can instruct Galaxy to keep files of failed jobs with: `cleanup_job = onsuccess` +During deployment, you may run into problems with failed jobs. By default, Galaxy removes files related to job execution. You can instruct Galaxy to keep files of failed jobs with: `cleanup_job: onsuccess` ### Switching to a database server @@ -61,7 +61,7 @@ To use an external database, you'll need to set one up. That process is outside Once installed, create a new database user and new database which the new user is the owner of. No further setup is required, since Galaxy manages its own schema. If you are using a UNIX socket to connect the application to the database (this is the standard case if Galaxy and the database are on the same system), you'll want to name the database user the same as the system user under which you run the Galaxy process. -To configure Galaxy, set `database_connection` in Galaxy's config file, `config/galaxy.ini`. The syntax for a database URL is explained in the [SQLAlchemy documentation](http://docs.sqlalchemy.org/en/latest/core/engines.html). +To configure Galaxy, set `database_connection` in Galaxy's config file, `config/galaxy.yml`. The syntax for a database URL is explained in the [SQLAlchemy documentation](http://docs.sqlalchemy.org/en/latest/core/engines.html). Here follow two example database URLs with username and password: @@ -81,7 +81,7 @@ mysql:///mydatabase?unix_socket=/var/run/mysqld/mysqld.sock For more hints on available options for the database URL, see the [SQLAlchemy documentation](http://docs.sqlalchemy.org/en/latest/core/engines.html#database-urls). -If you are using [MySQL](http://dev.mysql.com/) and encounter the "MySQL server has gone away" error, please note the `database_engine_option_pool_recycle` option in `config/galaxy.ini`. If this does not solve your problem, see [this post](http://gmod.827538.n3.nabble.com/template/NamlServlet.jtp?macro=print_post&node=2354941) on the Galaxy Development [mailing list](/src/mailing-lists/index.md). +If you are using [MySQL](http://dev.mysql.com/) and encounter the "MySQL server has gone away" error, please note the `database_engine_option_pool_recycle` option in `config/galaxy.yml`. If this does not solve your problem, see [this post](http://gmod.827538.n3.nabble.com/template/NamlServlet.jtp?macro=print_post&node=2354941) on the Galaxy Development [mailing list](/src/mailing-lists/index.md). If you are using [MySQL](http://dev.mysql.com/) please make sure the database output is in UTF-8, otherwise you may encounter python TypeErrors. @@ -155,11 +155,11 @@ For those readers who've already been running Galaxy on a cluster, a bit of info ### Tune the database -[PostgreSQL](http://www.postgresql.org/) can store results more efficiently than Galaxy, and as a result, reduce Galaxy's memory footprint. When a query is made, the result will remain on the Postgres server and Galaxy can retrieve only the rows it needs. To enable this, set `database_engine_option_server_side_cursors = True` in the Galaxy config. +[PostgreSQL](http://www.postgresql.org/) can store results more efficiently than Galaxy, and as a result, reduce Galaxy's memory footprint. When a query is made, the result will remain on the Postgres server and Galaxy can retrieve only the rows it needs. To enable this, set `database_engine_option_server_side_cursors: true` in the Galaxy config. If your server logs errors about the database connection pool size, you may need to increase the default minimum and maximum number of pool connections, 5 and 10. These config file options are `database_engine_option_pool_size` and `database_engine_option_max_overflow`. -Finally, if you are using Galaxy <= release_2014.06.02, we recommend that you instruct Galaxy to use one database connection per thread, to avoid connection overhead and overuse. This can be enabled with `database_engine_option_strategy = threadlocal`. +Finally, if you are using Galaxy <= release_2014.06.02, we recommend that you instruct Galaxy to use one database connection per thread, to avoid connection overhead and overuse. This can be enabled with `database_engine_option_strategy: threadlocal`. ### Make the proxy handle uploads and downloads diff --git a/doc/source/admin/scaling.md b/doc/source/admin/scaling.md index 97b2cda4e28..b484cff0c68 100644 --- a/doc/source/admin/scaling.md +++ b/doc/source/admin/scaling.md @@ -2,7 +2,7 @@ The Galaxy framework is written in Python and makes extensive use of threads. However, one of the drawbacks of Python is the [Global Interpreter Lock](http://docs.python.org/c-api/init.html#thread-state-and-the-global-interpreter-lock), which prevents more than one thread from being on CPU at a time. Because of this, having a multi-core system will not improve the Galaxy framework's performance out of the box since Galaxy can use (at most) one core at a time. However, Galaxy can easily run in multiple separate processes, which solves this problem. For a more thorough explanation of this problem and why you will almost surely want to switch to the load balanced configuration if running for more than a small handful of users, see the [production configuration](production.html) page. -Just to be clear: increasing the values of `threadpool_workers` in `galaxy.ini` or the number of plugin workers in `job_conf.xml` will not make you Galaxy server much more responsive. The key to scaling Galaxy is the ability to run *multiple* Galaxy servers which co-operatively work on the same database. +Just to be clear: increasing the values of `threadpool_workers` in `galaxy.yml` or the number of plugin workers in `job_conf.xml` will not make you Galaxy server much more responsive. The key to scaling Galaxy is the ability to run *multiple* Galaxy servers which co-operatively work on the same database. A simple configuration: * 1 "job handler" process - responsible for starting and monitoring jobs, submitting jobs to a cluster (if configured), and for setting metadata (externally or internally). @@ -124,9 +124,9 @@ Using web processes as handlers is possible, but it is not recommended since han ### Remaining configuration options -If you do not have a `job_conf.xml` file, you will need to create one. There are samples for a basic configuration and an advanced configuration provided in the distribution. Please note that creating `job_conf.xml` overrides any legacy job running settings in `galaxy.ini`. See the [jobs configuration documentation](jobs.html) for more detail on job configuration. +If you do not have a `job_conf.xml` file, you will need to create one. There are samples for a basic configuration and an advanced configuration provided in the distribution. Please note that creating `job_conf.xml` overrides any legacy job running settings in `galaxy.yml`. See the [jobs configuration documentation](jobs.html) for more detail on job configuration. -In `job_conf.xml`, create `` tags with `id` attributes that match the handler server names you defined in `galaxy.ini`. For example, using the configuration above, the `` section of `job_conf.xml` would look like: +In `job_conf.xml`, create `` tags with `id` attributes that match the handler server names you defined in `galaxy.yml`. For example, using the configuration above, the `` section of `job_conf.xml` would look like: ```xml diff --git a/doc/source/admin/special_topics/apache.md b/doc/source/admin/special_topics/apache.md index bbb5f408958..8e9fe6c8f29 100644 --- a/doc/source/admin/special_topics/apache.md +++ b/doc/source/admin/special_topics/apache.md @@ -168,11 +168,12 @@ To enable it, you must first install `mod_xsendfile`, this is usually available ``` -Finally edit your `$GALAXY_ROOT/config/galaxy.ini` and make the following change before restarting Galaxy: +Finally edit your `$GALAXY_ROOT/config/galaxy.yml` and make the following change before restarting Galaxy: -```ini -[app:main] -apache_xsendfile = True +```yaml +galaxy: + # ... + apache_xsendfile: true ``` For this to work, the user under which your nginx server runs will need read access to Galaxy's `$GALAXY_ROOT/database/files/` directory and its contents. @@ -184,7 +185,7 @@ For this to work, the user under which your nginx server runs will need read acc ### Display Sites -Display sites such as UCSC work not by sending data directly from Galaxy to UCSC via the client's browser, but by sending UCSC a URL to the data in Galaxy that the UCSC server will retrieve data from. Since enabling authentication will place **all** of Galaxy behind authentication, such display sites will no longer be able to access data via that URL. If `display_servers` is set to a non-empty value in `$GALAXY_ROOT/config/galaxy.ini`, this tells Galaxy it should allow the named servers access to data in Galaxy. However, you still need to configure Apache to allow access to the datasets. An example config is provided here that allows the UCSC Main/Test backends: +Display sites such as UCSC work not by sending data directly from Galaxy to UCSC via the client's browser, but by sending UCSC a URL to the data in Galaxy that the UCSC server will retrieve data from. Since enabling authentication will place **all** of Galaxy behind authentication, such display sites will no longer be able to access data via that URL. If `display_servers` is set to a non-empty value in `$GALAXY_ROOT/config/galaxy.yml`, this tells Galaxy it should allow the named servers access to data in Galaxy. However, you still need to configure Apache to allow access to the datasets. An example config is provided here that allows the UCSC Main/Test backends: ```apache @@ -211,7 +212,7 @@ Display sites such as UCSC work not by sending data directly from Galaxy to UCSC ### Proxying multiple galaxy worker threads -If you've configured multiple threads for galaxy in the `config/galaxy.ini` file, you will need a `ProxyBalancer` to manage sending requests to each of the threads. You can do that with apache configuration as follows: +If you've configured multiple threads for galaxy in the `config/galaxy.yml` file, you will need a `ProxyBalancer` to manage sending requests to each of the threads. You can do that with apache configuration as follows: ```apache diff --git a/doc/source/admin/special_topics/ftp.md b/doc/source/admin/special_topics/ftp.md index cb41e52a3d1..17ba71c6692 100644 --- a/doc/source/admin/special_topics/ftp.md +++ b/doc/source/admin/special_topics/ftp.md @@ -10,7 +10,7 @@ Although there is no specific required server, we use [ProFTPD](http://proftpd.o ## Configure Galaxy -The first step is to choose a directory into which your users will upload files. Preferably this will be on the same filesystem as Galaxy's datasets (by default, `galaxy_dist/database/files/`). The FTP server will create subdirectories inside of this directory which match the user's email address. Likewise, Galaxy will expect to find email-named subdirectories at that path. This directory should be set in the config file (`galaxy.ini`) as `ftp_upload_dir`. +The first step is to choose a directory into which your users will upload files. Preferably this will be on the same filesystem as Galaxy's datasets (by default, `galaxy_dist/database/files/`). The FTP server will create subdirectories inside of this directory which match the user's email address. Likewise, Galaxy will expect to find email-named subdirectories at that path. This directory should be set in the config file (`galaxy.yml`) as `ftp_upload_dir`. In the config file, you'll also want to set `ftp_upload_site` to the hostname your users should connect to via FTP. This will be provided in the help text on the Upload File form. @@ -38,7 +38,7 @@ GRANT ## Configuring ProFTPD -By default, Galaxy stores passwords using [PBKDF2](http://en.wikipedia.org/wiki/PBKDF2). It's possible to disable this using the `use_pbkdf2 = False` setting in `galaxy.ini`. Once disabled, any new passwords created will be stored in an older hex-encoded SHA1 format. Because of this, it's possible to have both PBKDF2 and SHA1 passwords in your database (especially if your server has been around since before PBKDF2 support was added). Although this is fine (Galaxy can read passwords in either format), ProFTPD will expect them in one format or the other (although with some amount of hackery it could probably be made to read both). +By default, Galaxy stores passwords using [PBKDF2](http://en.wikipedia.org/wiki/PBKDF2). It's possible to disable this using the `use_pbkdf2: false` setting in the `galaxy` section of `galaxy.yml`. Once disabled, any new passwords created will be stored in an older hex-encoded SHA1 format. Because of this, it's possible to have both PBKDF2 and SHA1 passwords in your database (especially if your server has been around since before PBKDF2 support was added). Although this is fine (Galaxy can read passwords in either format), ProFTPD will expect them in one format or the other (although with some amount of hackery it could probably be made to read both). Because of this, you'll need to choose one or the other in your Galaxy config (PBKDF2 is more secure and therefore preferred) and configure ProFTPD accordingly. If users cannot log in because their password is stored in the wrong format, they can simply use Galaxy's password change form to set their password, which will rewrite their password using the currently configured algorithm. diff --git a/doc/source/admin/special_topics/nginx.md b/doc/source/admin/special_topics/nginx.md index 4968c11edd6..20e0a3a5588 100644 --- a/doc/source/admin/special_topics/nginx.md +++ b/doc/source/admin/special_topics/nginx.md @@ -109,7 +109,7 @@ http { } ``` -2. The Galaxy application needs to be aware that it is running with a prefix (for generating URLs in dynamic pages). This is accomplished by configuring a Paste proxy-prefix filter in the `[app:main]` section of `config/galaxy.ini` and restarting Galaxy: +2. The Galaxy application needs to be aware that it is running with a prefix (for generating URLs in dynamic pages). This is accomplished by configuring a Paste proxy-prefix filter in the `galaxy` section of `config/galaxy.ini` and restarting Galaxy: ```ini @@ -198,11 +198,12 @@ http { } ``` -Finally edit your `$GALAXY_ROOT/config/galaxy.ini` and make the following change before restarting Galaxy: +Finally edit your `$GALAXY_ROOT/config/galaxy.yml` and make the following change before restarting Galaxy: -```ini -[app:main] -nginx_x_accel_redirect_base = /_x_accel_redirect +```yaml +galaxy: + #... + nginx_x_accel_redirect_base: '/_x_accel_redirect' ``` For this to work, the user under which your nginx server runs will need read access to Galaxy's `$GALAXY_ROOT/database/files/` directory and its contents. @@ -245,12 +246,13 @@ http { Note the `user` directive. To ensure that Galaxy has write permission on the uploaded files, nginx's workers will need to run as the same user as Galaxy. -Finally edit your `$GALAXY_ROOT/config/galaxy.ini` and make the following change before restarting Galaxy: +Finally edit your `$GALAXY_ROOT/config/galaxy.yml` and make the following change before restarting Galaxy: -```ini -[app:main] -nginx_upload_store = database/tmp/upload_store -nginx_upload_path = /_upload +```yaml +galaxy: + #... + nginx_upload_store: database/tmp/upload_store + nginx_upload_path: '/_upload' ``` When serving Galaxy with a prefix, as described in the serving Galaxy in a sub-directory section above, you will need to change one line in the `\_upload\_done` section. If your galaxy instance is available from `/galaxy`, then the first line should include this prefix: diff --git a/doc/source/admin/special_topics/performance_tracking.rst b/doc/source/admin/special_topics/performance_tracking.rst index 51150b8724a..e39759e0468 100644 --- a/doc/source/admin/special_topics/performance_tracking.rst +++ b/doc/source/admin/special_topics/performance_tracking.rst @@ -8,21 +8,21 @@ Most performance tracking requires sending metrics to a metrics collection serve uWSGI ----- -As you have certainly switched to uWSGI from the default paste server, there is some built-in uWSGI support for performance logging. You can send uWSGI's internal metrics to a carbon (Graphite) server by setting the carbon option in your galaxy.ini: +As you have certainly switched to uWSGI from the default paste server, there is some built-in uWSGI support for performance logging. You can send uWSGI's internal metrics to a carbon (Graphite) server by setting the carbon option in your galaxy.yml: -.. code-block:: ini +.. code-block:: yaml - [uwsgi] - socket = ... - carbon = 127.0.0.1:2003 + uwsgi: + socket: ... + carbon: 127.0.0.1:2003 Or a StatsD server via: -.. code-block:: ini +.. code-block:: yaml - [uwsgi] - socket = ... - statsd-push = 127.0.0.1:8125 + wsgi: + socket: ... + statsd-push: 127.0.0.1:8125 The `official documentation `__ contains further information on uWSGI and stats servers. In the `uWSGI Stats Server ` documentation, you can see an example of the sort of information that you will be able to collect. @@ -31,21 +31,25 @@ API / Route Timing Statistics Galaxy provides middleware to automatically log the amount of time controllers take to execute and to send that data to a stats server. Using the stats server of your choice, you can calculate the relevant statistics to ensure that your Galaxy server is performing as expected. -The statsD configuration requires setting the following: +The statsD configuration requires setting the following options in the ``galaxy`` section of ``config/galaxy.yml``: -.. code-block:: ini +.. code-block:: yaml - statsd_host=127.0.0.1 - statsd_port=8125 - statsd_prefix=galaxy + galaxy: + #... + statsd_host: 127.0.0.1 + statsd_port: 8125 + statsd_prefix: galaxy And the graphite configuration is very similar: -.. code-block:: ini +.. code-block:: yaml - graphite_host=127.0.0.1 - graphite_port=2003 - graphite_prefix=galaxy + galaxy: + # ... + graphite_host: 127.0.0.1 + graphite_port: 2003 + graphite_prefix: galaxy Most people visualize the statistics using something like `Grafana `__: diff --git a/doc/source/admin/special_topics/webhooks.rst b/doc/source/admin/special_topics/webhooks.rst index 395dc5a82d9..98164fe6ba4 100644 --- a/doc/source/admin/special_topics/webhooks.rst +++ b/doc/source/admin/special_topics/webhooks.rst @@ -14,7 +14,7 @@ Plugin activation ----------------- All webhooks that are included in the main Galaxy distribution are located in the ``config/plugins/webhooks/demo`` folder and are deactivated by default. -To activate these demo webhooks make sure this path is added to ``webhooks_dir`` in your ``galaxy.ini``. You can add as many +To activate these demo webhooks make sure this path is added to ``webhooks_dir`` in your ``galaxy.yml``. You can add as many webhook folders as you like as a comma separated list. Webhooks supports one additional layer of activating/deactivating by changing the ``activate: true`` in each config of each webhook. diff --git a/doc/source/admin/tool_panel.rst b/doc/source/admin/tool_panel.rst index 40049f90ca5..750da1036f7 100644 --- a/doc/source/admin/tool_panel.rst +++ b/doc/source/admin/tool_panel.rst @@ -9,7 +9,7 @@ The contents of the tool panel are defined by the following configuration files. Local tools ~~~~~~~~~~~ -In the past, the file named by your ``tool_config_file`` configuration setting in your ``config/galaxy.ini`` file was the only file used to populate your Galaxy tool panel. The default name for this file is ``tool_conf.xml``. Since this was the only file involved in populating your Galaxy tool panel, it defined the items (tools, workflows, sections and labels) that would be displayed and the way in which they would be arranged. +In the past, the file named by your ``tool_config_file`` configuration setting in your ``config/galaxy.yml`` file was the only file used to populate your Galaxy tool panel. The default name for this file is ``tool_conf.xml``. Since this was the only file involved in populating your Galaxy tool panel, it defined the items (tools, workflows, sections and labels) that would be displayed and the way in which they would be arranged. Tool Shed tools ~~~~~~~~~~~~~~~ @@ -23,7 +23,7 @@ Layout ------ The 3 or more files described in the previous section (``tool_conf.xml``, one or more ``shed_tool_conf.xml`` files, and ``migrated_tools_conf.xml``) are all used to load tool panel items (tools, sections, labels and workflows). A file named ``integrated_tool_panel.xml`` defines the arrangement for displaying these loaded items in your Galaxy tool panel. -If this file does not exist in your Galaxy installation directory, it will be automatically created and populated when you start your Galaxy server. It is initially populated based on the order in which the tool panel items are loaded. The items are loaded as each tool panel configuration file is parsed and its items are loaded. The order in which these configuration files are parsed is the order of the comma-separated list of files defined in your ``tool_config_file`` setting in your ``config/galaxy.ini`` configuration file. The ``migrated_tools_conf.xml`` file is always parsed and loaded last. Let's look at an example to help clarify how this works. +If this file does not exist in your Galaxy installation directory, it will be automatically created and populated when you start your Galaxy server. It is initially populated based on the order in which the tool panel items are loaded. The items are loaded as each tool panel configuration file is parsed and its items are loaded. The order in which these configuration files are parsed is the order of the comma-separated list of files defined in your ``tool_config_file`` setting in your ``config/galaxy.yml`` configuration file. The ``migrated_tools_conf.xml`` file is always parsed and loaded last. Let's look at an example to help clarify how this works. If you uninstall a repository that contains tools, entries for those tools will automatically be removed from the shed-related tool panel config file and the integrated_tool_panel.xml file. From 70ee8d00cc3708b866723de9fe784c9c6a2cda3c Mon Sep 17 00:00:00 2001 From: Nate Coraor Date: Mon, 13 Nov 2017 17:15:13 -0500 Subject: [PATCH 034/112] Begin config schema for Galaxy (just the new not-in-galaxy.ini logging option for now, the rest will be autogenerated from the sample) --- lib/galaxy/webapps/galaxy/config_schema.yml | 9 +++++++++ 1 file changed, 9 insertions(+) diff --git a/lib/galaxy/webapps/galaxy/config_schema.yml b/lib/galaxy/webapps/galaxy/config_schema.yml index f256aab7065..30de5389932 100644 --- a/lib/galaxy/webapps/galaxy/config_schema.yml +++ b/lib/galaxy/webapps/galaxy/config_schema.yml @@ -1305,6 +1305,15 @@ mapping: https://docs.python.org/2/library/logging.html#logging-levels A custom debug level of "TRACE" is available for even more verbosity. + logging: + type: map + default: galaxy.config.LOGGING_CONFIG_DEFAULT + desc: | + Controls where and how the server logs messages. If unset, the default is to log all messages to standard + output at the level defined by the `log_level` configuration option. Configuration is described in the + documentation at: + https://docs.galaxyproject.org/en/master/admin/config_logging.html + database_engine_option_echo: type: bool default: false From 0664921e00ba5dac623c19f1f5344a7f367aaa62 Mon Sep 17 00:00:00 2001 From: Nate Coraor Date: Mon, 13 Nov 2017 17:16:59 -0500 Subject: [PATCH 035/112] WIP admin documentation updates --- doc/source/admin/application_server.rst | 57 ++++++++++++ doc/source/admin/config.rst | 111 ++++++++++++++++++++++++ doc/source/admin/config_logging.rst | 99 +++++++++++++++++++++ 3 files changed, 267 insertions(+) create mode 100644 doc/source/admin/application_server.rst create mode 100644 doc/source/admin/config.rst create mode 100644 doc/source/admin/config_logging.rst diff --git a/doc/source/admin/application_server.rst b/doc/source/admin/application_server.rst new file mode 100644 index 00000000000..c2b39bcfb29 --- /dev/null +++ b/doc/source/admin/application_server.rst @@ -0,0 +1,57 @@ +Application Server +======================================== + +Overview +---------------------------- + +It is possible to run the Galaxy server in many different ways, including under different web application frameworks, or +as a standalone server with no web stack. For most of its modern life, prior to the 18.01 release, Galaxy used the +`Python Paste`_ web stack, and ran in a single process. + +Beginning with Galaxy release 18.01, the default application server for new installations of Galaxy is `uWSGI`_, which +has numerous benefits: + +- Written in C and designed to be high performance. +- Internal support for serving static content. +- Supports WebSockets, which allows for support of Galaxy Interactive Environments out of the box, removing the + dependency on Node.js. +- ... + +In addition, uWSGI has been the recommended application server for production Galaxy servers for many years, but was not +previously provided with Galaxy. + +What server am I running? +---------------------------- + +**Galaxy releases older than 18.01** + +- If you start your server with the provided ``run.sh`` script, it is using Paste. +- + +Unless it has been manually configured to run under uWSGI, your server is using Paste. + +**Galaxy releases 18.01 and newer** + +If you upgraded from + +In any case, ``pgrep(1)`` or ``ps(1)`` should provide the answer, for example: + +```sh-session +galaxy@server$ pgrep -af -u $EUID galaxy +16232 uwsgi --ini-paste config/galaxy.ini +16233 uwsgi --ini-paste config/galaxy.ini +17406 /srv/galaxy/venv/bin/python2.7 /srv/galaxy/venv/bin/uwsgi --yaml config/galaxy.yml +17419 /srv/galaxy/venv/bin/python2.7 /srv/galaxy/venv/bin/uwsgi --yaml config/galaxy.yml +17172 python ./scripts/paster.py serve config/galaxy.ini +``` + +The first 4 processes listed are uWSGI + + + +If you are upgrading to Galaxy 18.01 +from an older release, still have your ``galaxy.ini`` file in place, and have not manually switched to another stack +(such as uWSGI), Galaxy will continue to run under Paste. + +.. _Python Paste: http://paste.readthedocs.io/ +.. _uWSGI: https://uwsgi-docs.readthedocs.io/ diff --git a/doc/source/admin/config.rst b/doc/source/admin/config.rst new file mode 100644 index 00000000000..2b77488aa6f --- /dev/null +++ b/doc/source/admin/config.rst @@ -0,0 +1,111 @@ +Galaxy Configuration +======================================== + +Overview +---------------------------- + +Galaxy has a large number of configuration files in an array of formats. Although it is not required to modify *any* +Galaxy configuration files to run the server, most Galaxy servers will modify at least the core configuration file. +These have grown organically over time as new features with the needs for advanced syntaxes and config isolation have +been added. An effort is under way to `standardize and unify configuration formats`_. + +Configuration files can be found underneath the ``config/`` subdirectory, wherein you can find ``.sample`` files +corresponding to configuration files that you can modify by copying the ``.sample`` to ````. In many cases, +you will find that the sample configuration provides the most up-to-date and detailed documentation about the features +configured therein. + +Most config files are administered by hand, although a few (ones which begin with ``shed_*``) are modified by Galaxy +when installing from the Galaxy Tool Shed. When starting Galaxy for the first time, these files are copied from their +sample files automatically. You should not need to modify these unless you want to change the directory in to which Tool +Shed tools are installed. + + +Configuration Files +---------------------------- + +The primary Galaxy configuration file is ``galaxy.yml``. You will need to use this file to modify core functionality +such as the port on which Galaxy listens, the directory in which Galaxy datasets are stored, the database connection +options, and so forth. + +The most commonly modified configuration files include: + +- ``galaxy.yml``: Core Galaxy configuration file. +- ``tool_conf.xml``: Describes the paths to local tool configurations that Galaxy should attempt to load. Tools that + are installed via the Tool Shed are configured to load in the ``shed_tool_conf.xml`` file. See the :ref:`Tool Panel + Administration ` and `Installing Tools into Galaxy`_ documentation for more. +- ``datatypes_conf.xml``: Describes the file formats that are supported in Galaxy. See the `Datatypes documentation`_ + for more. +- ``job_conf.xml``: Controls how Galaxy runs tools, e.g. to run them on a compute cluster. See the `Cluster + documentation`_ for more. + +Some configuration files are only used when adding local components, rather than ones installed from the Tool Shed: + +- ``tool_conf.xml``: As described above. +- ``tool_data_table_conf.xml``: Describes the mapping between Data Tables - the structured format that allow tools to + work with locally cached reference data - and the location files that describe the actual data that is available (e.g. + paths, genome builds, etc.). Data table configurations are also provided by tools in the Tool Shed, those are + configured in ``shed_tool_data_table_conf.xml``. See the `Data Preparation documentation`_ for more. +- ``data_manager_conf.xml``: Describes the paths to local Data Managers, special Galaxy tools that automatically fetch + or create data for Data Tables and manage the corresponding data table and location configuration files. See the `Data + Managers documentation`_ for more. +- ``local_conda_mapping.yml``: Define mappings between the names specified in the tool configuration (```` + tags) and the conda resolver's names (conda package name). +- ``lmod_modules_mapping.yml``: Define mappings between the names specified in the tool configuration (```` + tags) and the Lmod system. + +Some configuration files are used to control the way that Galaxy resolves tool dependencies. Most Galaxy tools are only +descriptions of how to run a particular command line tool, and they do not contain the dependent command line tool. The +task of locating and making available these command line tools is performed by the Galaxy tool dependencies system, +which has configuration files of its own: + +Additional configuration files and their purposes are: + +- ``auth_conf.xml``: Configures the pluggable authentication service. By default, Galaxy users are created and managed + internally. +- ``build_sites.yml``: Controls which display applications are available and their configuration paths +- ``containers_conf.yml``: Configures the beta Galaxy containers interface, currently only used by Galaxy Interactive + Environments, and only neccesary for Docker Swarm support. +- ``dependency_resolvers_conf.xml``: Describes how Galaxy tools (which are typically just descriptions of how to run a + particular command line tool) should locate their dependencies (the command line tool) that are not part of the tool. + See the `Dependency Resolvers documentation ` for more. +- ``error_report.yml``: Controls how user-initiated error reporting (e.g. due to tool failure) is performed. See the + :ref:`Bug Reports documentation ` for more. +- ``job_metrics_conf.xml``: Enables reporting of certain conditions and collection of metrics when jobs run. +- ``job_resource_params_conf.xml``: Describes tool form elements that should be inserted into tool forms that can be + used by users to control runtime parameters such as memory allocations, cluster selection, and so forth. +- ``object_store_conf.xml``: Configures more advanced storage paradigms for Galaxy datasets, including layout across + multiple filesystems, or in object storage systems such as Swift or Amazon S3. +- ``openid_conf.xml``: Controls which OpenID (if enabled) providers should be presented as options to the user on the + login form. +- ``swarm_manager_conf.yml``: Configures the experimental Docker Swarm manager. +- ``tool_destinations.yml``: Configures dynamic tool destinations, which allow for mapping tools to job destinations + based on certain runtime job properties, such as the user submitting it, input sizes, and so forth. +- ``tool_sheds_conf.xml``: Defines the list of Tool Shed servers that should appear in the Galaxy Administration + interface when searching for new tools. +- ``workflow_schedulers_conf.xml``: Similar to the job configuration, controls the scheduling of workflows as jobs. + +.. _standardize and unify configuration formats: https://github.com/galaxyproject/galaxy/issues/... +.. _Installing Tools into Galaxy: https://galaxyproject.org/admin/tools/add-tool-from-toolshed-tutorial/ +.. _Datatypes documentation: https://galaxyproject.org/learn/datatypes/ +.. _Cluster documentation: https://galaxyproject.org/admin/config/performance/cluster/ +.. _Data Preparation documentation: https://galaxyproject.org/admin/data-preparation/ +.. _Data Managers documentation: https://galaxyproject.org/admin/tools/data-managers/ + + +Configuration +---------------------------- + +- Configure ``config/reports.yml`` in the same manner as your main galaxy instance (i.e., same database connection, but different port). This is a uwsgi YAML configuration file and should contain a reports section with app-specific configuration (options described below). + + - The default port for the reports application is ``9001``, and like Galaxy it only binds to localhost by default. + - ``database_connection`` should match the value used in your Galaxy configuration + - ``database_connection`` should point at a Postgres database, experimental support for MySQL is available but sqlite is not supported at all. + +- Run reports in a uWSGI server with ``sh run_reports.sh`` +- Use a web browser and go to the address you configured in ``reports.yml`` (defaults to http://localhost:9001/) + +.. ---------------------------- +.. Configuration Options +.. ---------------------------- +.. +.. .. include:: galaxy_options.rst diff --git a/doc/source/admin/config_logging.rst b/doc/source/admin/config_logging.rst new file mode 100644 index 00000000000..43da5f85f98 --- /dev/null +++ b/doc/source/admin/config_logging.rst @@ -0,0 +1,99 @@ +Logging Configuration +======================================== + +Overview +---------------------------- + +Logging in Galaxy is performed through the Python `logging`_ module. Traditionally, and on Galaxy releases prior to +18.01, customization of the logging could be performed in two ways: + +1. Basic/automatic configuration with control over log level and log destination (standard output or a named log file). +2. More complex configuration using `logging.config.fileConfig`_. + +Starting with release 18.01, it's possible to use the more featureful `logging.config.dictConfig`_ format, with a few +Galaxy-specific extensions described below. + +By default, Galaxy logs all messages to standard output at the ``DEBUG`` logging level. + +.. .. The way in which logging is configured depends on whether you are using Python Paste or uWSGI. See :ref:`Application +.. .. Server ` for help figuring out what you're using. If using uWSGI, it also depends on whether you are +.. .. using an INI or YAML configuration file. + +The way in which logging is configured depends on whether you are using an YAML or INI configuration file. Galaxy +servers that were created starting with Galaxy Release 18.01 or later use a YAML configuration file. Galaxy servers that +were created with 17.09 or older use an INI configuration file. If you upgrade a pre-18.01 server to 18.01 or later but +do not convert your INI config (``galaxy.ini``) to a YAML config (``galaxy.yml``), the INI config will still be used. + +Basic Configuration +---------------------------- + +YAML +~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +**Setting the log level:** + +```yaml +galaxy: + log_level: LEVEL +``` + +Where ``LEVEL`` is one of the `logging levels`_ documented in the `logging`_ module. + +**Logging to a file:** + +When using ``run.sh --daemon``, the log is written to ``galaxy.log`` in the current directory. To change this: + +INI +~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +Setting the log level: + + +```ini +[app:main] +log_level = LEVEL +``` + +**Logging to a file:** + +Where ``LEVEL`` is one of the `logging levels`_ documented in the `logging`_ module. + +When using ``run.sh --daemon``, the log is written to ``paster.log`` in the current directory. To change this: + +Advanced Configuration +---------------------------- + +YAML +~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +INI +~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + + + + + + + +On Galaxy servers older than 18.01, or newer servers still running under Paste (see :ref:`Application Server + Date: Thu, 7 Dec 2017 16:47:52 -0500 Subject: [PATCH 036/112] WIP admin docs updates for 18.01 --- doc/source/admin/application_server.rst | 57 ------------- doc/source/admin/config.rst | 23 ++++-- doc/source/admin/index.rst | 1 + doc/source/admin/reports.rst | 2 +- doc/source/admin/scaling.md | 103 ++++++++++++++---------- 5 files changed, 78 insertions(+), 108 deletions(-) delete mode 100644 doc/source/admin/application_server.rst diff --git a/doc/source/admin/application_server.rst b/doc/source/admin/application_server.rst deleted file mode 100644 index c2b39bcfb29..00000000000 --- a/doc/source/admin/application_server.rst +++ /dev/null @@ -1,57 +0,0 @@ -Application Server -======================================== - -Overview ----------------------------- - -It is possible to run the Galaxy server in many different ways, including under different web application frameworks, or -as a standalone server with no web stack. For most of its modern life, prior to the 18.01 release, Galaxy used the -`Python Paste`_ web stack, and ran in a single process. - -Beginning with Galaxy release 18.01, the default application server for new installations of Galaxy is `uWSGI`_, which -has numerous benefits: - -- Written in C and designed to be high performance. -- Internal support for serving static content. -- Supports WebSockets, which allows for support of Galaxy Interactive Environments out of the box, removing the - dependency on Node.js. -- ... - -In addition, uWSGI has been the recommended application server for production Galaxy servers for many years, but was not -previously provided with Galaxy. - -What server am I running? ----------------------------- - -**Galaxy releases older than 18.01** - -- If you start your server with the provided ``run.sh`` script, it is using Paste. -- - -Unless it has been manually configured to run under uWSGI, your server is using Paste. - -**Galaxy releases 18.01 and newer** - -If you upgraded from - -In any case, ``pgrep(1)`` or ``ps(1)`` should provide the answer, for example: - -```sh-session -galaxy@server$ pgrep -af -u $EUID galaxy -16232 uwsgi --ini-paste config/galaxy.ini -16233 uwsgi --ini-paste config/galaxy.ini -17406 /srv/galaxy/venv/bin/python2.7 /srv/galaxy/venv/bin/uwsgi --yaml config/galaxy.yml -17419 /srv/galaxy/venv/bin/python2.7 /srv/galaxy/venv/bin/uwsgi --yaml config/galaxy.yml -17172 python ./scripts/paster.py serve config/galaxy.ini -``` - -The first 4 processes listed are uWSGI - - - -If you are upgrading to Galaxy 18.01 -from an older release, still have your ``galaxy.ini`` file in place, and have not manually switched to another stack -(such as uWSGI), Galaxy will continue to run under Paste. - -.. _Python Paste: http://paste.readthedocs.io/ -.. _uWSGI: https://uwsgi-docs.readthedocs.io/ diff --git a/doc/source/admin/config.rst b/doc/source/admin/config.rst index 2b77488aa6f..3ff53213b84 100644 --- a/doc/source/admin/config.rst +++ b/doc/source/admin/config.rst @@ -92,18 +92,27 @@ Additional configuration files and their purposes are: .. _Data Managers documentation: https://galaxyproject.org/admin/tools/data-managers/ -Configuration +Configuration Basics ---------------------------- -- Configure ``config/reports.yml`` in the same manner as your main galaxy instance (i.e., same database connection, but different port). This is a uwsgi YAML configuration file and should contain a reports section with app-specific configuration (options described below). +- Edit ``config/galaxy.yml`` (copy it from ``config/galaxy.yml.sample`` if it does not exist) to make configuration + changes. This is a `uWSGI YAML configuration file`_ and should contain two sections, one named ``uwsgi`` for uWSGI and + one named ``galaxy`` for Galaxy. - - The default port for the reports application is ``9001``, and like Galaxy it only binds to localhost by default. - - ``database_connection`` should match the value used in your Galaxy configuration - - ``database_connection`` should point at a Postgres database, experimental support for MySQL is available but sqlite is not supported at all. + - The default port for the Galaxy web server is ``8080``, and it only binds to localhost by default. To configure + uWSGI to listen on all available network addresses, set ``http`` to ``0.0.0.0:`` (e.g. ``http: + 0.0.0.0:8080``). + - Some uWSGI options are required for uWSGI to run Galaxy properly and will be added to the ``uwsgi`` command line + by ``run.sh`` if not specified in ``galaxy.yml``. + - uWSGI has a `large number of options`_. The Galaxy documentation refers to some of them, but many additional + advanced deployment scenarios are available. -- Run reports in a uWSGI server with ``sh run_reports.sh`` -- Use a web browser and go to the address you configured in ``reports.yml`` (defaults to http://localhost:9001/) +- Run Galaxy in a uWSGI server with ``GALAXY_UWSGI=1 sh run.sh`` +- Use a web browser and go to the address you configured in ``galaxy.yml`` (defaults to http://localhost:8080/) +.. _uWSGI YAML configuration file: http://uwsgi-docs.readthedocs.io/en/latest/Configuration.html +.. _large number of options: http://uwsgi-docs.readthedocs.io/en/latest/Options.html + .. ---------------------------- .. Configuration Options .. ---------------------------- diff --git a/doc/source/admin/index.rst b/doc/source/admin/index.rst index 33b4d74f7a3..dab90b3965f 100644 --- a/doc/source/admin/index.rst +++ b/doc/source/admin/index.rst @@ -6,6 +6,7 @@ This documentation is in the midst of being ported and unified based on resource .. toctree:: :maxdepth: 2 + config production cluster scaling diff --git a/doc/source/admin/reports.rst b/doc/source/admin/reports.rst index bac451a7a4a..87d5c763009 100644 --- a/doc/source/admin/reports.rst +++ b/doc/source/admin/reports.rst @@ -41,7 +41,7 @@ following (and more): Configuration ---------------------------- -- Configure ``config/reports.yml`` in the same manner as your main galaxy instance (i.e., same database connection, but different port). This is a uwsgi YAML configuration file and should contain a reports section with app-specific configuration (options described below). +- Configure ``config/reports.yml`` in the same manner as your main galaxy instance (i.e., same database connection, but different web server port). This is a uWSGI YAML configuration file and should contain a ``reports`` section with app-specific configuration (options described below). - The default port for the reports application is ``9001``, and like Galaxy it only binds to localhost by default. - ``database_connection`` should match the value used in your Galaxy configuration diff --git a/doc/source/admin/scaling.md b/doc/source/admin/scaling.md index b484cff0c68..251b7169d09 100644 --- a/doc/source/admin/scaling.md +++ b/doc/source/admin/scaling.md @@ -1,63 +1,80 @@ # Scaling and Load Balancing -The Galaxy framework is written in Python and makes extensive use of threads. However, one of the drawbacks of Python is the [Global Interpreter Lock](http://docs.python.org/c-api/init.html#thread-state-and-the-global-interpreter-lock), which prevents more than one thread from being on CPU at a time. Because of this, having a multi-core system will not improve the Galaxy framework's performance out of the box since Galaxy can use (at most) one core at a time. However, Galaxy can easily run in multiple separate processes, which solves this problem. For a more thorough explanation of this problem and why you will almost surely want to switch to the load balanced configuration if running for more than a small handful of users, see the [production configuration](production.html) page. +The Galaxy framework is written in Python and makes extensive use of threads. However, one of the drawbacks of Python is the [Global Interpreter Lock](http://docs.python.org/c-api/init.html#thread-state-and-the-global-interpreter-lock), which prevents more than one thread from being on CPU at a time. Because of this, having a multi-core system will not improve the Galaxy framework's performance out of the box since Galaxy can use (at most) one core at a time in its default configuration. However, Galaxy can easily run in multiple separate processes, which solves this problem. For a more thorough explanation of this problem and why you will almost surely want to switch to the multiprocess configuration if running for more than a small handful of users, see the [production configuration](production.html) page. Just to be clear: increasing the values of `threadpool_workers` in `galaxy.yml` or the number of plugin workers in `job_conf.xml` will not make you Galaxy server much more responsive. The key to scaling Galaxy is the ability to run *multiple* Galaxy servers which co-operatively work on the same database. -A simple configuration: -* 1 "job handler" process - responsible for starting and monitoring jobs, submitting jobs to a cluster (if configured), and for setting metadata (externally or internally). -* 1 "web server" process - responsible for servicing web pages to users. +## Terminology -An advanced configuration: -* Multiple "job handler" processes. -* Multiple "web server" processes, proxied through a load-balancing capable web server (e.g. nginx or apache). +* **web worker** - Galaxy server process responsible for servicing web requests for the UI/API +* **job handler** - Galaxy server process responsible for starting and monitoring jobs, submitting jobs to a cluster (if configured), and for setting metadata (if not set on the cluster) +* **[uWSGI][uwsgi]** - Powerful application server written in C that implements the HTTP and Python WSGI protocols + * **[Mules][uwsgi-mules]** - uWSGI processes started after the main application (Galaxy) that can run separate code and receive messages from uWSGI web workers + * **[Zerg Mode][uwsgi-zerg-mode]** - uWSGI configuration where multiple copies of the same application can be started simultaneously in order to maintain availability during application restarts + * **[Emperor Mode][uwsgi-emperor-mode]** - uWSGI configuration where multiple distinct applications can be started by a single master uWSGI process +* **Webless Galaxy application** - The Galaxy application run as a standalone Python application with no web/WSGI server +* **[Paste][paste]** - Application server written in pure Python that implements the HTTP and Python WSGI protocols -### Web Server(s) +[uwsgi]: http://uwsgi-docs.readthedocs.io/ +[uwsgi-mules]: http://uwsgi-docs.readthedocs.io/en/latest/Mules.html +[uwsgi-zerg-mode]: http://uwsgi-docs.readthedocs.io/en/latest/Zerg.html +[uwsgi-emperor-mode]: http://uwsgi-docs.readthedocs.io/en/latest/Emperor.html +[paste]: http://paste.readthedocs.io/ -There are a few different ways you can run multiple web server processes: +### Deployment Options -**Standalone Paste-based processes:** -* Pros: - * Simplest setup, especially if only using a single web server process - * No additional dependencies - * Proxy not required if only using a single web server process -* Cons: - * Not as resilient to failure - * Load balancing typically round-robin regardless of individual process load - * No dynamic scaling +There are multiple deployment strategies for the Galaxy application that you can choose from. The right one depends on the configuration of the infrastructure on which you are deploying. -**uWSGI:** -* Pros: - * Higher performance server than Paste - * Better scalability and fault tolerance - * Easier process management and Galaxy server restartability -* Cons: - * Requires uWSGI +#### uWSGI with jobs handled by web workers (default configuration) -Using uWSGI for production servers is recommended by the Galaxy team. +* Easily runs multiple processes by increasing `processes` config option +* Load balanced internally +* Speaks native uWSGI protocol supported by nginx and Apache or direct HTTP (and SSL) +* Written in C and designed to be high performance +* Supports WebSockets, which enable Galaxy Interactive Environments out-of-the-box without a proxy server or Node.js +* Incredibly featureful, supports a wide array of deployment scenarios +* The default as of Galaxy Release 18.01 +* Jobs are handled by uWSGI web workers (but all Galaxy job features such as [running on a cluster](cluster.html) are still supported) -#### Standalone Paste-based processes +Under this strategy, jobs will be handled by the web worker that receives the job request from the UI/API. Having web processes handle jobs will negatively impact UI/API performance. -In `galaxy.ini`, define one or more `[server:...]` sections: +#### uWSGI for web serving with Mules as job handlers -```ini -[server:web0] -use = egg:Paste#http -port = 8080 -host = 127.0.0.1 -use_threadpool = true -threadpool_workers = 7 +* Job handlers run as children of the uWSGI process +* Jobs are dispatched from web workers to job handlers via native *mule messaging* +* Jobs can only be dispatched to mules on the same host +* Trivially easy to enable (disabled by default for simplicity reasons) -[server:web1] -use = egg:Paste#http -port = 8081 -host = 127.0.0.1 -use_threadpool = true -threadpool_workers = 7 -``` +Under this strategy, job handling is offloaded to dedicated non-web-serving processes that are started and stopped directly by the master uWSGI process. As a benefit of using mule messaging, only job handlers that are alive will be selected to run jobs. +**uWSGI + Mule job handlers is the recommended deployment strategy** for Galaxy servers that run web servers and job handlers **on the same host**. -Two are shown, you should create as many as are suitable for your usage and hardware. On our eight-core server, I run six web server processes. You may find you only need one, which is a slightly simpler configuration. +#### uWSGI for web serving and Webless Galaxy applications as job handlers + +* Galaxy is started as a standalone Python application with no web stack +* Jobs are dispatched from web workers to job handlers via the Galaxy database +* Jobs can be dispatched to job handlers running on any host +* The recommended deployment strategy for production Galaxy instances prior to 18.01 + +Like mules, under this strategy, job handling is offloaded to dedicated non-web-serving processes, but those processes are [managed by the administrator](#starting-and-stopping). Because the handler is randomly assigned by the web worker when the job is submitted via the UI/API, jobs may be assigned to dead handlers. + +**uWSGI + Webless job handlers is the recommended deployment strategy** for Galaxy servers that run web servers and job handlers **on different hosts**. + +#### Legacy Deployment Options + +Certain deployment strategies were commonly used prior to the introduction of new features described above. These are still possible but should no longer be used. + +##### uWSGI for web serving with Paste Galaxy applications as job handlers + +This is essentially the same as **uWSGI + Webless job handlers** but needlessly starts handlers with a web stack. This was recommended before the Webless method existed + +##### Paste for web serving with Paste or Webless job handlers + +Unlike uWSGI, Paste cannot start multiple server processes on its own. Prior to uWSGI support, this was the only way to run multiple Galaxy processes, but each web worker and job handler process had to be configured and managed separately. + +##### Paste web serving and job handling in a single process + +This was the default configuration prior to the 18.01 Galaxy release and offered the simplest out-of-the-box setup at the expense of performance and scalability. #### uWSGI From 5ae0c323ec1ef374a24e18efb59df423424aa80c Mon Sep 17 00:00:00 2001 From: John Chilton Date: Fri, 8 Dec 2017 10:27:23 -0500 Subject: [PATCH 037/112] Expand number of parameters with custom conversion/linting for Galaxy. Add functionality and test case for converting parameter names (e.g. from allow_library_path_paste to allow_path_pate) during conversion. --- lib/galaxy/webapps/config_manage.py | 80 ++++++++++++++++--- .../1705_allow_path_paste/config/galaxy.ini | 5 ++ test/unit/config/__init__.py | 0 test/unit/config/test_config_manage.py | 20 ++--- 4 files changed, 84 insertions(+), 21 deletions(-) create mode 100644 test/unit/config/1705_allow_path_paste/config/galaxy.ini create mode 100644 test/unit/config/__init__.py diff --git a/lib/galaxy/webapps/config_manage.py b/lib/galaxy/webapps/config_manage.py index 2a06c470a2b..bdcad53d441 100644 --- a/lib/galaxy/webapps/config_manage.py +++ b/lib/galaxy/webapps/config_manage.py @@ -98,6 +98,12 @@ class _OptionAction(object): pass +class _DeprecatedAction(_OptionAction): + + def lint(self, args, app_desc, key, value): + print("Option [%s] has been deprecated, this will likely be dropped in future releases of Galaxy." % key) + + class _DeprecatedAndDroppedAction(_OptionAction): def converted(self, args, app_desc, key, value): @@ -120,7 +126,7 @@ class _PasteAppFactoryAction(_OptionAction): print("Problem - unknown paste app factory encountered [%s]" % value) -class _ProductionNotReady(_OptionAction): +class _ProductionUnsafe(_OptionAction): def __init__(self, unsafe_value): self.unsafe_value = unsafe_value @@ -132,6 +138,14 @@ class _ProductionNotReady(_OptionAction): print(message) +class _ProductionPerformance(_OptionAction): + + def lint(self, args, app_desc, key, value): + template = "Problem - option [%s] should not be set to [%s] in production environments - it may cause performance issues or instability." + message = template % (key, value) + print(message) + + class _HandleFilterWithAction(_OptionAction): def converted(self, args, app_desc, key, value): @@ -139,6 +153,20 @@ class _HandleFilterWithAction(_OptionAction): return DROP_OPTION_VALUE +class _RenameAction(_OptionAction): + + def __init__(self, new_name): + self.new_name = new_name + + def converted(self, args, app_desc, key, value): + return (self.new_name, value) + + def lint(self, args, app_desc, key, value): + template = "Problem - option [%s] has been renamed (possibly with slightly different behavior) to [%s]." + message = template % (key, self.new_name) + print(message) + + OPTION_ACTIONS = { 'use_beaker_session': _DeprecatedAndDroppedAction(), 'session_type': _DeprecatedAndDroppedAction(), @@ -147,12 +175,33 @@ OPTION_ACTIONS = { 'session_secret': _DeprecatedAndDroppedAction(), 'paste.app_factory': _PasteAppFactoryAction(), 'filter-with': _HandleFilterWithAction(), - 'debug': _ProductionNotReady(True), - 'serve_xss_vulnerable_mimetypes': _ProductionNotReady(True), - 'use_printdebug': _ProductionNotReady(True), - 'use_interactive': _ProductionNotReady(True), - 'id_secret': _ProductionNotReady('USING THE DEFAULT IS NOT SECURE!'), - 'master_api_key': _ProductionNotReady('changethis'), + 'debug': _ProductionUnsafe(True), + 'serve_xss_vulnerable_mimetypes': _ProductionUnsafe(True), + 'use_printdebug': _ProductionUnsafe(True), + 'use_interactive': _ProductionUnsafe(True), + 'id_secret': _ProductionUnsafe('USING THE DEFAULT IS NOT SECURE!'), + 'master_api_key': _ProductionUnsafe('changethis'), + 'external_service_type_config_file': _DeprecatedAndDroppedAction(), + 'external_service_type_path': _DeprecatedAndDroppedAction(), + 'enable_sequencer_communication': _DeprecatedAndDroppedAction(), + 'run_workflow_toolform_upgrade': _DeprecatedAndDroppedAction(), + # Next 4 were from library search which is no longer available. + 'enable_lucene_library_search': _DeprecatedAndDroppedAction(), + 'fulltext_max_size': _DeprecatedAndDroppedAction(), + 'fulltext_noindex_filetypes': _DeprecatedAndDroppedAction(), + 'fulltext_url': _DeprecatedAndDroppedAction(), + 'enable_legacy_sample_tracking_api': _DeprecatedAction(), + 'enable_new_user_preferences': _DeprecatedAndDroppedAction(), + 'force_beta_workflow_scheduled_for_collections': _DeprecatedAction(), + 'force_beta_workflow_scheduled_min_steps': _DeprecatedAction(), + 'history_local_serial_workflow_scheduling': _ProductionPerformance(), + 'allow_library_path_paste': _RenameAction("allow_path_paste"), + 'trust_ipython_notebook_conversion': _RenameAction("trust_jupyter_notebook_conversion"), + 'enable_beta_tool_command_isolation': _DeprecatedAndDroppedAction(), + 'single_user': _ProductionUnsafe(True), + 'tool_submission_burst_threads': _ProductionPerformance(), + 'tool_submission_burst_at': _ProductionPerformance(), + 'toolform_upgrade': _DeprecatedAndDroppedAction(), } @@ -508,7 +557,12 @@ def _run_conversion(args, app_desc): if key in OPTION_ACTIONS: option_action = OPTION_ACTIONS.get(key) - value = option_action.converted(args, app_desc, key, value) + new_value = option_action.converted(args, app_desc, key, value) + if new_value: + if isinstance(new_value, tuple): + key, value = new_value + else: + value = new_value if value is DROP_OPTION_VALUE: continue @@ -521,7 +575,7 @@ def _run_conversion(args, app_desc): app_dict[key] = option_value f = StringIO() - _write_section(args, f, "uwsgi", uwsgi_dict) + _write_section(args, f, "uwsgi", uwsgi_dict, uwsgi_hack=True) _write_section(args, f, app_desc.app_name, app_dict) destination = os.path.join(args.galaxy_root, app_desc.destination) _replace_file(args, f, app_desc, ini_config, destination) @@ -603,10 +657,10 @@ def _write_sample_section(args, f, section_header, schema, as_comment=True, uwsg _write_option(args, f, key, option_value, as_comment=as_comment, uwsgi_hack=uwsgi_hack) -def _write_section(args, f, section_header, section_dict): +def _write_section(args, f, section_header, section_dict, uwsgi_hack=False): _write_header(f, section_header) for key, option_value in section_dict.items(): - _write_option(args, f, key, option_value) + _write_option(args, f, key, option_value, uwsgi_hack=uwsgi_hack) def _write_header(f, section_header): @@ -634,6 +688,10 @@ def _parse_option_value(option_value): if isinstance(option_value, OptionValue): option = option_value.option value = option_value.value + option = option_value.option + # Hack to get nicer YAML values during conversion + if option.get("type", "str") == "bool": + value = str(value).lower() == "true" else: value = option_value option = OPTION_DEFAULTS diff --git a/test/unit/config/1705_allow_path_paste/config/galaxy.ini b/test/unit/config/1705_allow_path_paste/config/galaxy.ini new file mode 100644 index 00000000000..2d2f935ba7c --- /dev/null +++ b/test/unit/config/1705_allow_path_paste/config/galaxy.ini @@ -0,0 +1,5 @@ +[server:main] +use = egg:Paste#http +use_threadpool = True +[app:main] +allow_library_path_paste = True diff --git a/test/unit/config/__init__.py b/test/unit/config/__init__.py new file mode 100644 index 00000000000..e69de29bb2d diff --git a/test/unit/config/test_config_manage.py b/test/unit/config/test_config_manage.py index 14c0cf42e4c..28b299757dd 100644 --- a/test/unit/config/test_config_manage.py +++ b/test/unit/config/test_config_manage.py @@ -63,17 +63,17 @@ def test_shed_conversion_1607_prefix(): assert uwsgi_config["mount"].startswith("/shed=galaxy.") -def test_reports_conversion_1607_gzip(): - with _config_directory("1607_root_filters") as config_dir: - config_dir.manage_cli(["convert", "reports"]) - config_dir.assert_not_exists("config/reports.ini") - config_dir.assert_is_yaml("config/reports.yml") - config_dir.assert_moved("config/reports.ini", "config/reports.ini.backup") - with config_dir.open("config/reports.yml") as f: +def test_allow_library_path_paste_conversion(): + with _config_directory("1705_allow_path_paste") as config_dir: + config_dir.manage_cli(["convert", "galaxy"]) + config_dir.assert_not_exists("config/galaxy.ini") + config_dir.assert_is_yaml("config/galaxy.yml") + config_dir.assert_moved("config/galaxy.ini", "config/galaxy.ini.backup") + with config_dir.open("config/galaxy.yml") as f: config = yaml.load(f) - assert "uwsgi" in config - uwsgi_config = config["uwsgi"] - assert uwsgi_config["http-auto-gzip"] is True, uwsgi_config + assert "galaxy" in config + galaxy_config = config["galaxy"] + assert galaxy_config["allow_path_paste"] is True def test_build_uwsgi_yaml(): From e8a9cc27ff9e7de6aa70aedc7005773d34d3d59d Mon Sep 17 00:00:00 2001 From: Nate Coraor Date: Fri, 8 Dec 2017 16:19:20 -0500 Subject: [PATCH 038/112] Locate the Galaxy config file when multiple uWSGI --yaml/--json arguments are used. --- lib/galaxy/web/stack/__init__.py | 24 +++++++++++++++++++++++- 1 file changed, 23 insertions(+), 1 deletion(-) diff --git a/lib/galaxy/web/stack/__init__.py b/lib/galaxy/web/stack/__init__.py index 6d92d45741d..ae853293483 100644 --- a/lib/galaxy/web/stack/__init__.py +++ b/lib/galaxy/web/stack/__init__.py @@ -3,6 +3,7 @@ from __future__ import absolute_import import inspect +import json import logging import os @@ -14,6 +15,7 @@ try: except ImportError: uwsgi = None +import yaml from six import string_types from galaxy.util.bunch import Bunch @@ -175,6 +177,25 @@ class UWSGIApplicationStack(MessageApplicationStack): postfork_functions = [] + @staticmethod + def _get_config_file(confs, loader, section): + """uWSGI allows config merging, in which case the corresponding config file option will be a list. + """ + conf = None + if isinstance(confs, list): + gconfs = filter(lambda x: os.path.exists(x) and section in loader(open(x)), confs) + if len(gconfs) == 1: + conf = gconfs[0] + elif len(gconfs) == 0: + log.warning('Could not locate a config file containing a Galaxy config from: %s', + ', '.join(confs)) + else: + log.warning('Multiple config files contain Galaxy configs, merging is not supported: %s', + ', '.join(gconfs)) + else: + conf = confs + return conf + @classmethod def get_app_kwds(cls, config_section, app_name=None): kwds = { @@ -189,7 +210,8 @@ class UWSGIApplicationStack(MessageApplicationStack): config_file = uwsgi_opt.get("galaxy_config_file") # check for --yaml or --json uWSGI config options next if config_file is None: - config_file = uwsgi_opt.get("yaml") or uwsgi_opt.get("json") + config_file = (UWSGIApplicationStack._get_config_file(uwsgi_opt.get("yaml"), yaml.safe_load, config_section) + or UWSGIApplicationStack._get_config_file(uwsgi_opt.get("json"), json.load, config_section)) # --ini and --ini-paste don't behave the same way, but this method will only be called by mules if the main # application was loaded with --ini-paste, so we can make some assumptions, most notably, uWSGI does not have # any way to set the app name when loading with paste.deploy:loadapp(), so hardcoding the alternate section From f5af9539b9d50e0c0e99ade18eea8af6f7beb0e4 Mon Sep 17 00:00:00 2001 From: Bjoern Gruening Date: Sun, 10 Dec 2017 15:02:31 +0100 Subject: [PATCH 039/112] add BamNative datatype --- lib/galaxy/datatypes/binary.py | 190 +++++++++++++++++++-------------- 1 file changed, 108 insertions(+), 82 deletions(-) diff --git a/lib/galaxy/datatypes/binary.py b/lib/galaxy/datatypes/binary.py index daefe7a7e97..4ed2a390e09 100644 --- a/lib/galaxy/datatypes/binary.py +++ b/lib/galaxy/datatypes/binary.py @@ -187,14 +187,11 @@ class GenericAsn1Binary(Binary): edam_data = "data_0849" -@dataproviders.decorators.has_dataproviders -class Bam(Binary): - """Class describing a BAM binary file""" +class BamNative(Binary): + """Class describing a BAM binary file that is not necessarily sorted""" edam_format = "format_2572" edam_data = "data_0863" - file_ext = "bam" - track_type = "ReadTrack" - data_sources = {"data": "bai", "index": "bigwig"} + file_ext = "bam_native" MetadataElement(name="bam_index", desc="BAM Index File", param=metadata.FileParameter, file_ext="bai", readonly=True, no_value=None, visible=False, optional=True) MetadataElement(name="bam_version", default=None, desc="BAM Version", param=MetadataParameter, readonly=True, visible=False, optional=True, no_value=None) @@ -210,13 +207,117 @@ class Bam(Binary): @staticmethod def merge(split_files, output_file): """ - Merges BAM files + Merges Bam files :param split_files: List of bam file paths to merge :param output_file: Write merged bam file to this location """ pysam.merge('-O', 'BAM', output_file, *split_files) + def init_meta(self, dataset, copy_from=None): + Binary.init_meta(self, dataset, copy_from=copy_from) + + def set_meta(self, dataset, overwrite=True, **kwd): + try: + bam_file = pysam.AlignmentFile(dataset.file_name, mode='rb') + # TODO: Reference names, lengths, read_groups and headers can become very large, truncate when necessary + dataset.metadata.reference_names = list(bam_file.references) + dataset.metadata.reference_lengths = list(bam_file.lengths) + dataset.metadata.bam_header = bam_file.header + dataset.metadata.read_groups = [read_group['ID'] for read_group in dataset.metadata.bam_header.get('RG', []) if 'ID' in read_group] + dataset.metadata.sort_order = bam_file.header.get('HD', {}).get('SO', None) + dataset.metadata.bam_version = bam_file.header.get('HD', {}).get('VN', None) + except Exception: + # Per Dan, don't log here because doing so will cause datasets that + # fail metadata to end in the error state + pass + + def set_peek(self, dataset, is_multi_byte=False): + if not dataset.dataset.purged: + dataset.peek = "Binary bam alignments file" + dataset.blurb = nice_size(dataset.get_size()) + else: + dataset.peek = 'file does not exist' + dataset.blurb = 'file purged from disk' + + def display_peek(self, dataset): + try: + return dataset.peek + except Exception: + return "Binary bam alignments file (%s)" % (nice_size(dataset.get_size())) + + def to_archive(self, trans, dataset, name=""): + rel_paths = [] + file_paths = [] + rel_paths.append("%s.%s" % (name or dataset.file_name, dataset.extension)) + file_paths.append(dataset.file_name) + rel_paths.append("%s.%s.bai" % (name or dataset.file_name, dataset.extension)) + file_paths.append(dataset.metadata.bam_index.file_name) + return zip(file_paths, rel_paths) + + def get_chunk(self, trans, dataset, offset=0, ck_size=None): + index_file = dataset.metadata.bam_index + if index_file: + index_filename = index_file.file_name + else: + index_filename = None + with pysam.AlignmentFile(dataset.file_name, "rb", index_filename=index_filename) as bamfile: + ck_size = 300 # 300 lines + ck_data = "" + header_line_count = 0 + if offset == 0: + ck_data = bamfile.text.replace('\t', ' ') + header_line_count = bamfile.text.count('\n') + else: + bamfile.seek(offset) + for line_number, alignment in enumerate(bamfile) : + # return only Header lines if 'header_line_count' exceeds 'ck_size' + # FIXME: Can be problematic if bam has million lines of header + offset = bamfile.tell() + if (line_number + header_line_count) > ck_size: + break + else: + bamline = alignment.tostring(bamfile) + # Galaxy display each tag as separate column because 'tostring()' funcition put tabs in between each tag of tags column. + # Below code will remove spaces between each tag. + bamline_modified = ('\t').join(bamline.split()[:11] + [(' ').join(bamline.split()[11:])]) + ck_data = "%s\n%s" % (ck_data, bamline_modified) + return dumps({'ck_data': util.unicodify(ck_data), + 'offset': offset}) + + def display_data(self, trans, dataset, preview=False, filename=None, to_ext=None, offset=None, ck_size=None, **kwd): + preview = util.string_as_bool(preview) + if offset is not None: + return self.get_chunk(trans, dataset, offset, ck_size) + elif to_ext or not preview: + return super(Bam, self).display_data(trans, dataset, preview, filename, to_ext, **kwd) + else: + column_names = dataset.metadata.column_names + if not column_names: + column_names = [] + column_types = dataset.metadata.column_types + if not column_types: + column_types = [] + column_number = dataset.metadata.columns + if column_number is None: + column_number = 1 + return trans.fill_template("/dataset/tabular_chunked.mako", + dataset=dataset, + chunk=self.get_chunk(trans, dataset, 0), + column_number=column_number, + column_names=column_names, + column_types=column_types) + + +@dataproviders.decorators.has_dataproviders +class Bam(BamNative): + """Class describing a BAM binary file""" + edam_format = "format_2572" + edam_data = "data_0863" + file_ext = "bam" + track_type = "ReadTrack" + data_sources = {"data": "bai", "index": "bigwig"} + def dataset_content_needs_grooming(self, file_name): """ Check if file_name is a coordinate-sorted BAM file @@ -266,9 +367,6 @@ class Bam(Binary): # Remove temp file and empty temporary directory os.rmdir(tmp_dir) - def init_meta(self, dataset, copy_from=None): - Binary.init_meta(self, dataset, copy_from=copy_from) - def set_meta(self, dataset, overwrite=True, **kwd): # These metadata values are not accessible by users, always overwrite index_file = dataset.metadata.bam_index @@ -302,78 +400,6 @@ class Bam(Binary): except Exception: return False - def set_peek(self, dataset, is_multi_byte=False): - if not dataset.dataset.purged: - dataset.peek = "Binary bam alignments file" - dataset.blurb = nice_size(dataset.get_size()) - else: - dataset.peek = 'file does not exist' - dataset.blurb = 'file purged from disk' - - def display_peek(self, dataset): - try: - return dataset.peek - except Exception: - return "Binary bam alignments file (%s)" % (nice_size(dataset.get_size())) - - def to_archive(self, trans, dataset, name=""): - rel_paths = [] - file_paths = [] - rel_paths.append("%s.%s" % (name or dataset.file_name, dataset.extension)) - file_paths.append(dataset.file_name) - rel_paths.append("%s.%s.bai" % (name or dataset.file_name, dataset.extension)) - file_paths.append(dataset.metadata.bam_index.file_name) - return zip(file_paths, rel_paths) - - def get_chunk(self, trans, dataset, offset=0, ck_size=None): - index_file = dataset.metadata.bam_index - with pysam.AlignmentFile(dataset.file_name, "rb", index_filename=index_file.file_name) as bamfile: - ck_size = 300 # 300 lines - ck_data = "" - header_line_count = 0 - if offset == 0: - ck_data = bamfile.text.replace('\t', ' ') - header_line_count = bamfile.text.count('\n') - else: - bamfile.seek(offset) - for line_number, alignment in enumerate(bamfile) : - # return only Header lines if 'header_line_count' exceeds 'ck_size' - # FIXME: Can be problematic if bam has million lines of header - offset = bamfile.tell() - if (line_number + header_line_count) > ck_size: - break - else: - bamline = alignment.tostring(bamfile) - # Galaxy display each tag as separate column because 'tostring()' funcition put tabs in between each tag of tags column. - # Below code will remove spaces between each tag. - bamline_modified = ('\t').join(bamline.split()[:11] + [(' ').join(bamline.split()[11:])]) - ck_data = "%s\n%s" % (ck_data, bamline_modified) - return dumps({'ck_data': util.unicodify(ck_data), - 'offset': offset}) - - def display_data(self, trans, dataset, preview=False, filename=None, to_ext=None, offset=None, ck_size=None, **kwd): - preview = util.string_as_bool(preview) - if offset is not None: - return self.get_chunk(trans, dataset, offset, ck_size) - elif to_ext or not preview: - return super(Bam, self).display_data(trans, dataset, preview, filename, to_ext, **kwd) - else: - column_names = dataset.metadata.column_names - if not column_names: - column_names = [] - column_types = dataset.metadata.column_types - if not column_types: - column_types = [] - column_number = dataset.metadata.columns - if column_number is None: - column_number = 1 - return trans.fill_template("/dataset/tabular_chunked.mako", - dataset=dataset, - chunk=self.get_chunk(trans, dataset, 0), - column_number=column_number, - column_names=column_names, - column_types=column_types) - # ------------- Dataproviders # pipe through samtools view # ALSO: (as Sam) From 017dad025db9a06c9c6d2430203f52fdec959f68 Mon Sep 17 00:00:00 2001 From: Bjoern Gruening Date: Sun, 10 Dec 2017 15:03:05 +0100 Subject: [PATCH 040/112] add new test file --- test-data/bam_native_from_sam.bam | Bin 0 -> 484 bytes 1 file changed, 0 insertions(+), 0 deletions(-) create mode 100644 test-data/bam_native_from_sam.bam diff --git a/test-data/bam_native_from_sam.bam b/test-data/bam_native_from_sam.bam new file mode 100644 index 0000000000000000000000000000000000000000..0052a80bd03036c571776cb753de60e344fce87e GIT binary patch literal 484 zcmb2|=3rp}f&Xj_PR>jWz6`}hUs6NT5)ukH_@3~5+pOi~`}oVp%|?b#oj4>KU3qrQ zXgC$oAfa(&0r!$f#T;ceUIk``y2tl2Jb;GCqnTF8SUS=yR+w!%7-Cc8cywVDi z5;$Y{a{6@@mp@J#B1_#Jzr@&7o~b&u@&7^lCs#MytDIXF9BcOSfVbIZ>+@&cSvRH5 znKb8J@9h>oi!FKXG2lua!la8DY zJMpN?h&ODt4y(n6s(s%Roqn2}S6$TZm3DVmg{jpmO_?7pwaJ@4KmDPYvZcdQ@T4m1 zk{AyWrLek?kYqFOWzr=aht)V{95xQ#zGLz}?J)UO{_QXKEm6OuC?8d;e9yUOs)uTs zR_^hz*=q6Y9vx@iE@1a>|EfOQbyp6*57BN~*e&$hVLQ()QwMjm44&ds(#fUQdcJZioQ^!Uj2ScJr5S*N GPyhf^LCc%~ literal 0 HcmV?d00001 From eea55a9258342e8de32162c9e62563de0f6438b8 Mon Sep 17 00:00:00 2001 From: Bjoern Gruening Date: Sun, 10 Dec 2017 15:03:47 +0100 Subject: [PATCH 041/112] add new test tool --- test/functional/tools/sam_to_bam_native.xml | 20 ++++++++++++++++++++ 1 file changed, 20 insertions(+) create mode 100644 test/functional/tools/sam_to_bam_native.xml diff --git a/test/functional/tools/sam_to_bam_native.xml b/test/functional/tools/sam_to_bam_native.xml new file mode 100644 index 00000000000..578b40f3549 --- /dev/null +++ b/test/functional/tools/sam_to_bam_native.xml @@ -0,0 +1,20 @@ + + '$outfile1' + ]]> + + + + + + + + + + + + + + + + From 2a093f25f6fdb6ebf4a8bba84050130c4929e6c3 Mon Sep 17 00:00:00 2001 From: Bjoern Gruening Date: Sun, 10 Dec 2017 15:05:28 +0100 Subject: [PATCH 042/112] add new bam_native datatype to the registry --- config/datatypes_conf.xml.sample | 5 +++++ 1 file changed, 5 insertions(+) diff --git a/config/datatypes_conf.xml.sample b/config/datatypes_conf.xml.sample index 6782d490ae0..4045ac713fc 100644 --- a/config/datatypes_conf.xml.sample +++ b/config/datatypes_conf.xml.sample @@ -16,6 +16,10 @@ + + + + @@ -285,6 +289,7 @@ + From 4d7bc9a778afa171bd7498004733943543af5730 Mon Sep 17 00:00:00 2001 From: Bjoern Gruening Date: Sun, 10 Dec 2017 15:06:28 +0100 Subject: [PATCH 043/112] bam to bigwig converter, converts also bam_native --- lib/galaxy/datatypes/converters/bam_to_bigwig_converter.xml | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/lib/galaxy/datatypes/converters/bam_to_bigwig_converter.xml b/lib/galaxy/datatypes/converters/bam_to_bigwig_converter.xml index 6307bcf0d64..50b8c1ca14c 100644 --- a/lib/galaxy/datatypes/converters/bam_to_bigwig_converter.xml +++ b/lib/galaxy/datatypes/converters/bam_to_bigwig_converter.xml @@ -17,7 +17,7 @@ > temp.bg && bedGraphToBigWig temp.bg '$chromInfo' '$output']]> - + From 2569851498f76d2fc416bd96ab4007c579bb0ffd Mon Sep 17 00:00:00 2001 From: Bjoern Gruening Date: Sun, 10 Dec 2017 15:06:53 +0100 Subject: [PATCH 044/112] use unsorted sam file for tests --- test-data/sam_with_header.sam | 8 ++++---- 1 file changed, 4 insertions(+), 4 deletions(-) diff --git a/test-data/sam_with_header.sam b/test-data/sam_with_header.sam index 33449b176bc..f2428278d55 100644 --- a/test-data/sam_with_header.sam +++ b/test-data/sam_with_header.sam @@ -1,14 +1,14 @@ @SQ SN:ref LN:45 @SQ SN:ref2 LN:40 +r003 16 ref 29 30 6H5M * 0 0 TAGGC * +r001 83 ref 37 30 9M = 7 -39 CAGCGCCAT * +x2 0 ref2 2 30 21M * 0 0 ggttttataaaacaaataatt ????????????????????? r001 163 ref 7 30 8M4I4M1D3M = 37 39 TTAGATAAAGAGGATACTG * XX:B:S,12561,2,20,112 r002 0 ref 9 30 1S2I6M1P1I1P1I4M2I * 0 0 AAAAGATAAGGGATAAA * r003 0 ref 9 30 5H6M * 0 0 AGCTAA * r004 0 ref 16 30 6M14N1I5M * 0 0 ATAGCTCTCAGC * -r003 16 ref 29 30 6H5M * 0 0 TAGGC * -r001 83 ref 37 30 9M = 7 -39 CAGCGCCAT * -x1 0 ref2 1 30 20M * 0 0 aggttttataaaacaaataa ???????????????????? -x2 0 ref2 2 30 21M * 0 0 ggttttataaaacaaataatt ????????????????????? x3 0 ref2 6 30 9M4I13M * 0 0 ttataaaacAAATaattaagtctaca ?????????????????????????? x4 0 ref2 10 30 25M * 0 0 CaaaTaattaagtctacagagcaac ????????????????????????? x5 0 ref2 12 30 24M * 0 0 aaTaattaagtctacagagcaact ???????????????????????? +x1 0 ref2 1 30 20M * 0 0 aggttttataaaacaaataa ???????????????????? x6 0 ref2 14 30 23M * 0 0 Taattaagtctacagagcaacta ??????????????????????? From 8b55e0a33a52fe45fc5fdaa171607c7f253021c9 Mon Sep 17 00:00:00 2001 From: Bjoern Gruening Date: Sun, 10 Dec 2017 15:28:39 +0100 Subject: [PATCH 045/112] add two converters --- .../bam_native_to_bam_converter.xml | 23 +++++++++++++++++++ .../converters/sam_to_bam_native.xml | 22 ++++++++++++++++++ 2 files changed, 45 insertions(+) create mode 100644 lib/galaxy/datatypes/converters/bam_native_to_bam_converter.xml create mode 100644 lib/galaxy/datatypes/converters/sam_to_bam_native.xml diff --git a/lib/galaxy/datatypes/converters/bam_native_to_bam_converter.xml b/lib/galaxy/datatypes/converters/bam_native_to_bam_converter.xml new file mode 100644 index 00000000000..8ac1dd7b633 --- /dev/null +++ b/lib/galaxy/datatypes/converters/bam_native_to_bam_converter.xml @@ -0,0 +1,23 @@ + diff --git a/lib/galaxy/datatypes/converters/sam_to_bam_native.xml b/lib/galaxy/datatypes/converters/sam_to_bam_native.xml new file mode 100644 index 00000000000..363a3b57b68 --- /dev/null +++ b/lib/galaxy/datatypes/converters/sam_to_bam_native.xml @@ -0,0 +1,22 @@ + + + + samtools + + + + + + + + + + + + From 8b76a5a698fd3bc13d4acc38194221def9ed5163 Mon Sep 17 00:00:00 2001 From: Nuwan Goonasekera Date: Thu, 21 Dec 2017 22:59:50 +0530 Subject: [PATCH 046/112] Added support for recursively discovering output datasets --- lib/galaxy/tools/parameters/output_collect.py | 48 +++++++++----- .../tools/parser/output_collection_def.py | 2 + .../functional/tools/multi_output_recurse.xml | 65 +++++++++++++++++++ test/functional/tools/samples_tool_conf.xml | 1 + .../tools/test_collect_primary_datasets.py | 25 +++++++ 5 files changed, 123 insertions(+), 18 deletions(-) create mode 100644 test/functional/tools/multi_output_recurse.xml diff --git a/lib/galaxy/tools/parameters/output_collect.py b/lib/galaxy/tools/parameters/output_collect.py index a452d580512..6a69cb6863e 100644 --- a/lib/galaxy/tools/parameters/output_collect.py +++ b/lib/galaxy/tools/parameters/output_collect.py @@ -480,37 +480,48 @@ def discover_files(output_name, tool_provided_metadata, extra_file_collectors, j path = os.path.join(target_directory, filename) yield DiscoveredFile(path, extra_file_collector, JsonCollectedDatasetMatch(dataset, extra_file_collector, filename, path=path)) else: - for (match, collector) in walk_over_extra_files(extra_file_collectors, job_working_directory, matchable): + for (match, collector) in walk_over_file_collectors(extra_file_collectors, job_working_directory, matchable): yield DiscoveredFile(match.path, collector, match) -def discover_target_directory(extra_file_collector, job_working_directory): - directory = job_working_directory - if extra_file_collector.directory: - directory = os.path.join(directory, extra_file_collector.directory) +def discover_target_directory(dir_name, job_working_directory): + if dir_name: + directory = os.path.join(job_working_directory, dir_name) if not util.in_directory(directory, job_working_directory): raise Exception("Problem with tool configuration, attempting to pull in datasets from outside working directory.") - return directory + return directory + else: + return job_working_directory -def walk_over_extra_files(extra_file_collectors, job_working_directory, matchable): - +def walk_over_file_collectors(extra_file_collectors, job_working_directory, matchable): for extra_file_collector in extra_file_collectors: assert extra_file_collector.discover_via == "pattern" - matches = [] - directory = discover_target_directory(extra_file_collector, job_working_directory) - if not os.path.isdir(directory): - continue - for filename in os.listdir(directory): - path = os.path.join(directory, filename) - if not os.path.isfile(path): - continue + for match in walk_over_extra_files(extra_file_collector.directory, extra_file_collector, job_working_directory, matchable): + yield match, extra_file_collector + + +def walk_over_extra_files(target_dir, extra_file_collector, job_working_directory, matchable): + """ + Walks through all files in a given directory, and returns all files that + match the given collector's match criteria. If the collector has the + recurse flag enabled, will also recursively descend into child folders. + """ + matches = [] + directory = discover_target_directory(target_dir, job_working_directory) + for filename in os.listdir(directory): + path = os.path.join(directory, filename) + if os.path.isdir(path) and extra_file_collector.recurse: + # The current directory is already validated, so use that as the next job_working_directory when recursing + for match in walk_over_extra_files(filename, extra_file_collector, directory, matchable): + yield match + else: match = extra_file_collector.match(matchable, filename, path=path) if match: matches.append(match) - for match in extra_file_collector.sort(matches): - yield match, extra_file_collector + for match in extra_file_collector.sort(matches): + yield match def dataset_collector(dataset_collection_description): @@ -551,6 +562,7 @@ class DatasetCollector(object): self.default_visible = dataset_collection_description.default_visible self.directory = dataset_collection_description.directory self.assign_primary_output = dataset_collection_description.assign_primary_output + self.recurse = dataset_collection_description.recurse def _pattern_for_dataset(self, dataset_instance=None): token_replacement = r'\d+' diff --git a/lib/galaxy/tools/parser/output_collection_def.py b/lib/galaxy/tools/parser/output_collection_def.py index d80f52a3042..e95c140a7d4 100644 --- a/lib/galaxy/tools/parser/output_collection_def.py +++ b/lib/galaxy/tools/parser/output_collection_def.py @@ -63,6 +63,7 @@ class DatasetCollectionDescription(object): self.default_visible = asbool(kwargs.get("visible", None)) self.assign_primary_output = asbool(kwargs.get('assign_primary_output', False)) self.directory = kwargs.get("directory", None) + self.recurse = False class ToolProvidedMetadataDatasetCollection(DatasetCollectionDescription): @@ -77,6 +78,7 @@ class FilePatternDatasetCollectionDescription(DatasetCollectionDescription): def __init__(self, **kwargs): super(FilePatternDatasetCollectionDescription, self).__init__(**kwargs) pattern = kwargs.get("pattern", "__default__") + self.recurse = asbool(kwargs.get("recurse", False)) if pattern in NAMED_PATTERNS: pattern = NAMED_PATTERNS.get(pattern) self.pattern = pattern diff --git a/test/functional/tools/multi_output_recurse.xml b/test/functional/tools/multi_output_recurse.xml new file mode 100644 index 00000000000..b397f1a3808 --- /dev/null +++ b/test/functional/tools/multi_output_recurse.xml @@ -0,0 +1,65 @@ + + + echo "Hello" > $report; + mkdir subdir1; + echo "This" > subdir1/this.txt; + echo "That" > subdir1/that.txt; + mkdir subdir2; + echo "1" > subdir2/CUSTOM_1.txt; + echo "2" > subdir2/CUSTOM_2.txt; + mkdir subdir3; + echo "Foo" > subdir3/Foo; + mkdir subdir3/nested1; + echo "Bar" > subdir3/nested1/bar.txt; + echo "Hello" > subdir3/nested1/hello; + echo "1" > sample1.report.txt; + echo "2" > sample2.report.txt; + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + diff --git a/test/functional/tools/samples_tool_conf.xml b/test/functional/tools/samples_tool_conf.xml index 5bd62a7cbb8..99f4c609e43 100644 --- a/test/functional/tools/samples_tool_conf.xml +++ b/test/functional/tools/samples_tool_conf.xml @@ -17,6 +17,7 @@ + diff --git a/test/unit/tools/test_collect_primary_datasets.py b/test/unit/tools/test_collect_primary_datasets.py index 4e10ad2132f..9361c773705 100644 --- a/test/unit/tools/test_collect_primary_datasets.py +++ b/test/unit/tools/test_collect_primary_datasets.py @@ -57,6 +57,31 @@ class CollectPrimaryDatasetsTestCase(unittest.TestCase, tools_support.UsesApp, t # didn't result in a dbkey being set. assert created_hda_1.dbkey == "?" + def test_collect_multiple_recurse(self): + self._replace_output_collectors(''' + + + ''') + path1 = self._setup_extra_file(filename="test1", subdir="subdir1") + path2 = self._setup_extra_file(filename="test2", subdir="subdir2/nested1/") + path3 = self._setup_extra_file(filename="test3", subdir="subdir2") + + datasets = self._collect() + assert DEFAULT_TOOL_OUTPUT in datasets + self.assertEquals(len(datasets[DEFAULT_TOOL_OUTPUT]), 3) + + # Test default order of collection. + assert list(datasets[DEFAULT_TOOL_OUTPUT].keys()) == ["test1", "test2", "test3"] + + created_hda_1 = datasets[DEFAULT_TOOL_OUTPUT]["test1"] + self.app.object_store.assert_created_with_path(created_hda_1.dataset, path1) + + created_hda_2 = datasets[DEFAULT_TOOL_OUTPUT]["test2"] + self.app.object_store.assert_created_with_path(created_hda_2.dataset, path2) + + created_hda_3 = datasets[DEFAULT_TOOL_OUTPUT]["test3"] + self.app.object_store.assert_created_with_path(created_hda_3.dataset, path3) + def test_collect_sorted_reverse(self): self._replace_output_collectors(''' From 3c7248a0884588826a4b5cc8fb699ad0e042d7ce Mon Sep 17 00:00:00 2001 From: Nuwan Goonasekera Date: Thu, 21 Dec 2017 23:40:55 +0530 Subject: [PATCH 047/112] Added schema entry for discover_datasets recurse attribute --- lib/galaxy/tools/xsd/galaxy.xsd | 5 +++++ 1 file changed, 5 insertions(+) diff --git a/lib/galaxy/tools/xsd/galaxy.xsd b/lib/galaxy/tools/xsd/galaxy.xsd index 506f0c0e812..7e8136b801f 100644 --- a/lib/galaxy/tools/xsd/galaxy.xsd +++ b/lib/galaxy/tools/xsd/galaxy.xsd @@ -3929,6 +3929,11 @@ More information can be found on Planemo's documentation for Directory (relative to working directory) to search for files. + + + Indicates that the specified directory should be searched recursively for matching files. + + Format (or datatype) of discovered datasets (an alias with ``ext``). From 640cfb1e7d8be8ceaba96920cfb1be72c48f4974 Mon Sep 17 00:00:00 2001 From: Bjoern Gruening Date: Thu, 4 Jan 2018 00:12:13 +0100 Subject: [PATCH 048/112] Bam to BAM --- lib/galaxy/datatypes/binary.py | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/lib/galaxy/datatypes/binary.py b/lib/galaxy/datatypes/binary.py index 4ed2a390e09..d73b3c9ad63 100644 --- a/lib/galaxy/datatypes/binary.py +++ b/lib/galaxy/datatypes/binary.py @@ -207,7 +207,7 @@ class BamNative(Binary): @staticmethod def merge(split_files, output_file): """ - Merges Bam files + Merges BAM files :param split_files: List of bam file paths to merge :param output_file: Write merged bam file to this location From e519f4e7efcbb055a66a861588ceabd09e0b9b58 Mon Sep 17 00:00:00 2001 From: Bjoern Gruening Date: Thu, 4 Jan 2018 00:27:22 +0100 Subject: [PATCH 049/112] rearrange sniffer --- lib/galaxy/datatypes/binary.py | 30 ++++++++++++++---------------- 1 file changed, 14 insertions(+), 16 deletions(-) diff --git a/lib/galaxy/datatypes/binary.py b/lib/galaxy/datatypes/binary.py index d73b3c9ad63..06f0a4f76e5 100644 --- a/lib/galaxy/datatypes/binary.py +++ b/lib/galaxy/datatypes/binary.py @@ -217,6 +217,17 @@ class BamNative(Binary): def init_meta(self, dataset, copy_from=None): Binary.init_meta(self, dataset, copy_from=copy_from) + def sniff(self, filename): + # BAM is compressed in the BGZF format, and must not be uncompressed in Galaxy. + # The first 4 bytes of any bam file is 'BAM\1', and the file is binary. + try: + header = gzip.open(filename).read(4) + if header == b'BAM\1': + return True + return False + except Exception: + return False + def set_meta(self, dataset, overwrite=True, **kwd): try: bam_file = pysam.AlignmentFile(dataset.file_name, mode='rb') @@ -256,12 +267,7 @@ class BamNative(Binary): return zip(file_paths, rel_paths) def get_chunk(self, trans, dataset, offset=0, ck_size=None): - index_file = dataset.metadata.bam_index - if index_file: - index_filename = index_file.file_name - else: - index_filename = None - with pysam.AlignmentFile(dataset.file_name, "rb", index_filename=index_filename) as bamfile: + with pysam.AlignmentFile(dataset.file_name, "rb") as bamfile: ck_size = 300 # 300 lines ck_data = "" header_line_count = 0 @@ -389,16 +395,8 @@ class Bam(BamNative): # fail metadata to end in the error state pass - def sniff(self, filename): - # BAM is compressed in the BGZF format, and must not be uncompressed in Galaxy. - # The first 4 bytes of any bam file is 'BAM\1', and the file is binary. - try: - header = gzip.open(filename).read(4) - if header == b'BAM\1': - return True - return False - except Exception: - return False + def sniff(self, file_name): + return super(Bam, self).sniff(file_name) and not self.dataset_content_needs_grooming(file_name) # ------------- Dataproviders # pipe through samtools view From 295e5712ee2c020292754ddcb75d6d5744c4ed10 Mon Sep 17 00:00:00 2001 From: Bjoern Gruening Date: Thu, 4 Jan 2018 00:45:02 +0100 Subject: [PATCH 050/112] adjust tests --- test/functional/tools/sam_to_bam_native.xml | 15 +++++++++++---- test/functional/tools/samples_tool_conf.xml | 1 + 2 files changed, 12 insertions(+), 4 deletions(-) diff --git a/test/functional/tools/sam_to_bam_native.xml b/test/functional/tools/sam_to_bam_native.xml index 578b40f3549..81222e2f309 100644 --- a/test/functional/tools/sam_to_bam_native.xml +++ b/test/functional/tools/sam_to_bam_native.xml @@ -1,18 +1,25 @@ + + samtools + '$outfile1' + samtools view + -b + -@ \${GALAXY_SLOTS:-2} + -o '${output}' + '$input' ]]> - + - + - + diff --git a/test/functional/tools/samples_tool_conf.xml b/test/functional/tools/samples_tool_conf.xml index 5bd62a7cbb8..c467eb82ee1 100644 --- a/test/functional/tools/samples_tool_conf.xml +++ b/test/functional/tools/samples_tool_conf.xml @@ -81,6 +81,7 @@ + From 2b5b6cf74fb29eb4608318477c062982d8ad955c Mon Sep 17 00:00:00 2001 From: mvdbeek Date: Thu, 4 Jan 2018 13:35:56 +0200 Subject: [PATCH 051/112] Fix test and add datatypes to test/functional/tools/sample_datatypes_conf.xml This test is still failing because `CONVERTER_sam_to_bam` will be invoked instead of CONVERTER_sam_to_bam_native. Possibly becasue Bam inherits from BamNative, so this isn't strictly speaking wrong, though not what one would expect. --- test/functional/tools/sam_to_bam_native.xml | 17 ++++++++++++++--- test/functional/tools/sample_datatypes_conf.xml | 10 +++++++++- 2 files changed, 23 insertions(+), 4 deletions(-) diff --git a/test/functional/tools/sam_to_bam_native.xml b/test/functional/tools/sam_to_bam_native.xml index 81222e2f309..df3a728d4a0 100644 --- a/test/functional/tools/sam_to_bam_native.xml +++ b/test/functional/tools/sam_to_bam_native.xml @@ -3,23 +3,34 @@ samtools - + + + - + + + + + + diff --git a/test/functional/tools/sample_datatypes_conf.xml b/test/functional/tools/sample_datatypes_conf.xml index 8b366098630..98991439526 100644 --- a/test/functional/tools/sample_datatypes_conf.xml +++ b/test/functional/tools/sample_datatypes_conf.xml @@ -14,8 +14,16 @@ - + + + + + + + + + From a8b3d23f1438f31436b86d24b48868fd3e133dad Mon Sep 17 00:00:00 2001 From: mvdbeek Date: Thu, 4 Jan 2018 14:11:11 +0200 Subject: [PATCH 052/112] Adjust sniffer test for unsorted bam --- lib/galaxy/datatypes/sniff.py | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/lib/galaxy/datatypes/sniff.py b/lib/galaxy/datatypes/sniff.py index 48ac2d46e6e..1d3681f97c4 100644 --- a/lib/galaxy/datatypes/sniff.py +++ b/lib/galaxy/datatypes/sniff.py @@ -337,7 +337,7 @@ def guess_ext(fname, sniff_order): 'bam' >>> fname = get_test_fname('3unsorted.bam') >>> guess_ext(fname, sniff_order) - 'bam' + 'bam_native' >>> fname = get_test_fname('test.idpDB') >>> guess_ext(fname, sniff_order) 'idpdb' From 446643159540f8db67dfd0752560b387b63fc4b8 Mon Sep 17 00:00:00 2001 From: Bjoern Gruening Date: Thu, 4 Jan 2018 23:10:38 +0100 Subject: [PATCH 053/112] resort the converters so that the accepted_formats are infront --- lib/galaxy/datatypes/registry.py | 17 ++++++++++++++++- 1 file changed, 16 insertions(+), 1 deletion(-) diff --git a/lib/galaxy/datatypes/registry.py b/lib/galaxy/datatypes/registry.py index b893f869b73..72f818e55e3 100644 --- a/lib/galaxy/datatypes/registry.py +++ b/lib/galaxy/datatypes/registry.py @@ -804,6 +804,7 @@ class Registry(object): converters = odict() source_datatype = type(self.get_datatype_by_extension(ext)) for ext2, converters_dict in self.datatype_converters.items(): + converter_datatype = type(self.get_datatype_by_extension(ext2)) if issubclass(source_datatype, converter_datatype): converters.update(converters_dict) @@ -822,7 +823,21 @@ class Registry(object): def find_conversion_destination_for_dataset_by_extensions(self, dataset, accepted_formats, converter_safe=True): """Returns ( target_ext, existing converted dataset )""" - for convert_ext in self.get_converters_by_datatype(dataset.ext): + + converters = self.get_converters_by_datatype(dataset.ext) + new_order = odict() + + accepted_format_keys = list() + for k in accepted_formats: + accepted_format_keys.append(k.file_ext) + if k.file_ext in converters: + new_order[k.file_ext] = converters[k.file_ext] + + for k,v in converters.items(): + if not k in accepted_format_keys: + new_order[k] = v + + for convert_ext in new_order: convert_ext_datatype = self.get_datatype_by_extension(convert_ext) if convert_ext_datatype is None: self.log.warning("Datatype class not found for extension '%s', which is used as target for conversion from datatype '%s'" % (convert_ext, dataset.ext)) From 8928b34506c1ba1f4856fad82dc42aef0f7c68f6 Mon Sep 17 00:00:00 2001 From: Bjoern Gruening Date: Sun, 7 Jan 2018 21:51:36 +0100 Subject: [PATCH 054/112] implement priority converters --- lib/galaxy/datatypes/registry.py | 41 +++++++++++++++++--------------- 1 file changed, 22 insertions(+), 19 deletions(-) diff --git a/lib/galaxy/datatypes/registry.py b/lib/galaxy/datatypes/registry.py index 72f818e55e3..0d2b14f3808 100644 --- a/lib/galaxy/datatypes/registry.py +++ b/lib/galaxy/datatypes/registry.py @@ -798,20 +798,34 @@ class Registry(object): tabular.CSV() ] - def get_converters_by_datatype(self, ext): - """Returns available converters by source type""" + def get_converters_by_datatype(self, ext, priority_formats=None): + """ + Returns available converters by source type. + `priority_formats` will contain a lis of format extensions that should + be handled with priority. This means they will end up infront of the + returned ordered dictionary. + """ if ext not in self._converters_by_datatype: converters = odict() + prio_converters = odict() source_datatype = type(self.get_datatype_by_extension(ext)) for ext2, converters_dict in self.datatype_converters.items(): - converter_datatype = type(self.get_datatype_by_extension(ext2)) if issubclass(source_datatype, converter_datatype): - converters.update(converters_dict) + for k, v in converters_dict.items(): + if k in priority_formats: + prio_converters[k] = v + else: + converters[k] = v # Ensure ext-level converters are present if ext in self.datatype_converters.keys(): - converters.update(self.datatype_converters[ext]) - self._converters_by_datatype[ext] = converters + for k, v in self.datatype_converters[ext].items(): + if k in priority_formats: + prio_converters[k] = v + else: + converters[k] = v + prio_converters.update(converters) + self._converters_by_datatype[ext] = prio_converters return self._converters_by_datatype[ext] def get_converter_by_target_type(self, source_ext, target_ext): @@ -824,20 +838,9 @@ class Registry(object): def find_conversion_destination_for_dataset_by_extensions(self, dataset, accepted_formats, converter_safe=True): """Returns ( target_ext, existing converted dataset )""" - converters = self.get_converters_by_datatype(dataset.ext) - new_order = odict() + converters = self.get_converters_by_datatype(dataset.ext, [k.file_ext for k in accepted_formats]) - accepted_format_keys = list() - for k in accepted_formats: - accepted_format_keys.append(k.file_ext) - if k.file_ext in converters: - new_order[k.file_ext] = converters[k.file_ext] - - for k,v in converters.items(): - if not k in accepted_format_keys: - new_order[k] = v - - for convert_ext in new_order: + for convert_ext in converters: convert_ext_datatype = self.get_datatype_by_extension(convert_ext) if convert_ext_datatype is None: self.log.warning("Datatype class not found for extension '%s', which is used as target for conversion from datatype '%s'" % (convert_ext, dataset.ext)) From b139726ed380192ecf03f10e91220a0488b573f3 Mon Sep 17 00:00:00 2001 From: Bjoern Gruening Date: Sun, 7 Jan 2018 21:54:44 +0100 Subject: [PATCH 055/112] fix spelling --- lib/galaxy/datatypes/registry.py | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/lib/galaxy/datatypes/registry.py b/lib/galaxy/datatypes/registry.py index 0d2b14f3808..426dcb492c1 100644 --- a/lib/galaxy/datatypes/registry.py +++ b/lib/galaxy/datatypes/registry.py @@ -801,7 +801,7 @@ class Registry(object): def get_converters_by_datatype(self, ext, priority_formats=None): """ Returns available converters by source type. - `priority_formats` will contain a lis of format extensions that should + `priority_formats` will contain a list of format extensions that should be handled with priority. This means they will end up infront of the returned ordered dictionary. """ From 542aa95fa40288b7b754d3908d87967a7ce92e34 Mon Sep 17 00:00:00 2001 From: Nate Coraor Date: Mon, 8 Jan 2018 14:24:43 -0500 Subject: [PATCH 056/112] uWSGI: Use --master when daemonizing (required when using http server w/ daemonization) and fix `run.sh --stop-daemon` --- scripts/common_startup_functions.sh | 9 +++++++-- 1 file changed, 7 insertions(+), 2 deletions(-) diff --git a/scripts/common_startup_functions.sh b/scripts/common_startup_functions.sh index 722429b7c96..e32237506e1 100644 --- a/scripts/common_startup_functions.sh +++ b/scripts/common_startup_functions.sh @@ -34,6 +34,7 @@ parse_common_args() { paster_args="$paster_args $1" fi uwsgi_args="$uwsgi_args --reload $PID_FILE" + restart_arg_set=1 daemon_or_restart_arg_set=1 shift ;; @@ -41,7 +42,7 @@ parse_common_args() { paster_args="$paster_args --pid-file $PID_FILE --log-file $LOG_FILE --daemon" # --daemonize2 waits until after the application has loaded # to daemonize, thus it stops if any errors are found - uwsgi_args="--daemonize2 $LOG_FILE --pidfile2 $PID_FILE $uwsgi_args" + uwsgi_args="--master --daemonize2 $LOG_FILE --pidfile2 $PID_FILE $uwsgi_args" daemon_or_restart_arg_set=1 shift ;; @@ -109,7 +110,11 @@ find_server() { [ "$server_config" != "none" ] && arg_getter_args="-c $server_config" [ -n "$server_app" ] && arg_getter_args="--app $server_app" run_server="$UWSGI" - server_args="$(python ./scripts/get_uwsgi_args.py $arg_getter_args) $uwsgi_args" + server_args= + if [ -z "$stop_daemon_arg_set" -a -z "$restart_arg_set" ]; then + server_args="$(python ./scripts/get_uwsgi_args.py $arg_getter_args)" + fi + server_args="$server_args $uwsgi_args" else run_server="python" server_args="./scripts/paster.py serve $server_config $paster_args" From 8d8bf5eaffeda0f229bf56cb45e4adbb05b12d57 Mon Sep 17 00:00:00 2001 From: John Chilton Date: Sun, 12 Mar 2017 23:40:45 -0400 Subject: [PATCH 057/112] Dockerized job integration testing. Add simple test cases for both mulled containers and explicit Docker image resolution. --- lib/galaxy/config.py | 2 +- test/base/driver_util.py | 2 + .../tools/mulled_example_explicit.xml | 22 ++++++++++ .../tools/mulled_example_simple.xml | 21 ++++++++++ test/functional/tools/samples_tool_conf.xml | 2 + test/integration/dockerized_job_conf.xml | 26 ++++++++++++ test/integration/test_dockerized_jobs.py | 41 +++++++++++++++++++ 7 files changed, 115 insertions(+), 1 deletion(-) create mode 100644 test/functional/tools/mulled_example_explicit.xml create mode 100644 test/functional/tools/mulled_example_simple.xml create mode 100644 test/integration/dockerized_job_conf.xml create mode 100644 test/integration/test_dockerized_jobs.py diff --git a/lib/galaxy/config.py b/lib/galaxy/config.py index 90dc5c1e293..7ff94d69a95 100644 --- a/lib/galaxy/config.py +++ b/lib/galaxy/config.py @@ -480,7 +480,7 @@ class Configuration(object): involucro_path = kwargs.get('involucro_path', None) if involucro_path is None: - involucro_path = os.path.join(tool_dependency_dir, "involucro") + involucro_path = os.path.join(tool_dependency_dir or "database", "involucro") self.involucro_path = resolve_path(involucro_path, self.root) self.involucro_auto_init = string_as_bool(kwargs.get('involucro_auto_init', True)) diff --git a/test/base/driver_util.py b/test/base/driver_util.py index 29e99a8aef7..95c702ee0e4 100644 --- a/test/base/driver_util.py +++ b/test/base/driver_util.py @@ -131,6 +131,8 @@ def setup_galaxy_config( log_format=None, ): """Setup environment and build config for test Galaxy instance.""" + # For certain docker operations this needs to be evaluated out - e.g. for cwltool. + tmpdir = os.path.realpath(tmpdir) if not os.path.exists(tmpdir): os.makedirs(tmpdir) file_path = os.path.join(tmpdir, 'files') diff --git a/test/functional/tools/mulled_example_explicit.xml b/test/functional/tools/mulled_example_explicit.xml new file mode 100644 index 00000000000..f341dae5bda --- /dev/null +++ b/test/functional/tools/mulled_example_explicit.xml @@ -0,0 +1,22 @@ + + + bwa + quay.io/biocontainers/bwa:0.7.15--0 + + + + + $output_1 2>&1 + ]]> + + + + + + + + + \ No newline at end of file diff --git a/test/functional/tools/mulled_example_simple.xml b/test/functional/tools/mulled_example_simple.xml new file mode 100644 index 00000000000..d061297a93f --- /dev/null +++ b/test/functional/tools/mulled_example_simple.xml @@ -0,0 +1,21 @@ + + + bwa + + + + + $output_1 2>&1 + ]]> + + + + + + + + + \ No newline at end of file diff --git a/test/functional/tools/samples_tool_conf.xml b/test/functional/tools/samples_tool_conf.xml index 25d646b1c33..512e2925aaa 100644 --- a/test/functional/tools/samples_tool_conf.xml +++ b/test/functional/tools/samples_tool_conf.xml @@ -159,6 +159,8 @@ + + diff --git a/test/integration/dockerized_job_conf.xml b/test/integration/dockerized_job_conf.xml new file mode 100644 index 00000000000..44097003630 --- /dev/null +++ b/test/integration/dockerized_job_conf.xml @@ -0,0 +1,26 @@ + + + + + + + + + + + + + true + false + + + + + + + + + + + + diff --git a/test/integration/test_dockerized_jobs.py b/test/integration/test_dockerized_jobs.py new file mode 100644 index 00000000000..88aa843938c --- /dev/null +++ b/test/integration/test_dockerized_jobs.py @@ -0,0 +1,41 @@ +"""Integration tests for running tools in Docker containers.""" + +import os + +from base import integration_util +from base.populators import ( + DatasetPopulator, +) + +SCRIPT_DIRECTORY = os.path.abspath(os.path.dirname(__file__)) +DOCKERIZED_JOB_CONFIG_FILE = os.path.join(SCRIPT_DIRECTORY, "dockerized_job_conf.xml") +# DOCKERIZED_JOB_DEPENDENCY_RESOLVERS_CONF = os.path.join(SCRIPT_DIRECTORY, "dockerzied_dependency_resolvers_conf.xml") + + +class DockerizedJobsIntegrationTestCase(integration_util.IntegrationTestCase): + + framework_tool_and_types = True + + @classmethod + def handle_galaxy_config_kwds(cls, config): + config["job_config_file"] = DOCKERIZED_JOB_CONFIG_FILE + # Disable tool dependency resolution. + config["tool_dependency_dir"] = "none" + config["enable_beta_mulled_containers"] = "true" + + def setUp(self): + super(DockerizedJobsIntegrationTestCase, self).setUp() + self.dataset_populator = DatasetPopulator(self.galaxy_interactor) + self.history_id = self.dataset_populator.new_history() + + def test_explicit(self): + self.dataset_populator.run_tool("mulled_example_explicit", {}, self.history_id) + self.dataset_populator.wait_for_history(self.history_id, assert_ok=True) + output = self.dataset_populator.get_history_dataset_content(self.history_id) + assert "0.7.15-r1140" in output + + def test_mulled_simple(self): + self.dataset_populator.run_tool("mulled_example_simple", {}, self.history_id) + self.dataset_populator.wait_for_history(self.history_id, assert_ok=True) + output = self.dataset_populator.get_history_dataset_content(self.history_id) + assert "0.7.15-r1140" in output From cd04ff30665ae6f15a6af35152af54d630458e60 Mon Sep 17 00:00:00 2001 From: John Chilton Date: Wed, 13 Sep 2017 16:38:00 -0400 Subject: [PATCH 058/112] Set group id in addition to user id when running docker containers by default. Noticed cwltool does this and it is a good idea. It wasn't the bug I was tracking but it is a solid improvement. --- lib/galaxy/tools/deps/docker_util.py | 9 +++++++-- 1 file changed, 7 insertions(+), 2 deletions(-) diff --git a/lib/galaxy/tools/deps/docker_util.py b/lib/galaxy/tools/deps/docker_util.py index 629cc59d81d..a28b2103e71 100644 --- a/lib/galaxy/tools/deps/docker_util.py +++ b/lib/galaxy/tools/deps/docker_util.py @@ -175,8 +175,13 @@ def build_docker_run_command( if set_user: user = set_user if set_user == DEFAULT_SET_USER: - user = str(os.geteuid()) - command_parts.extend(["-u", user]) + # If future-us is ever in here and fixing this for docker-machine just + # use cwltool.docker_id - it takes care of this default nicely. + euid = os.geteuid() + egid = os.getgid() + + user = "%d:%d" % (euid, egid) + command_parts.extend(["--user", user]) full_image = image if tag: full_image = "%s:%s" % (full_image, tag) From 4bf47d08770c14010bf925c73ccba2262dfe78ee Mon Sep 17 00:00:00 2001 From: John Chilton Date: Mon, 8 Jan 2018 16:35:44 -0500 Subject: [PATCH 059/112] Improved home and temp directory handling. Home Directory Handling ----------------------- - For profile < 18.01 tools: - If use_shared_home="false" is set on the command block - the tool will be given a clean $HOME directory. - If ``shared_home_dir`` is set in Galaxy's config or the job destination configuration, Galaxy will set $HOME in the tool's job environment to point at this directory. - For profile >= 18.01 tools, jobs will be given a clean home directory by default unless ``use_shared_home="true"`` is set. If that is set, the profile < 18.01 behavior is used. In addition to these changes for Galaxy tools, the tool framework itself has been updated to allow other potential behaviors including the CWL defaults. Integration tests for each of these cases has been added. Upgrading to 18.01 - we recommend dropping overriding ``HOME`` in any Galaxy environment configuration (e.g. env directives in job_conf.xml). If any such configuration is found, we recommend instead setting "shared_home_dir" for destinations to the that cluster destination's shared HOME directory. If all destinations share a single HOME directory, this can be set in galaxy.ini instead of job_conf.xml. Temp Directory Handling ----------------------- There were serious disagreements with how to proceed here. I felt we should aggressively isolate tool TMP directories and provide deployers options to tweak these through structured arguments. Nicola felt we should defer to the environment variables already being set job_conf.xml - but tweak their meanings by default. Nate fell somewhere in between. I think all sides have merit and could make sense depending on what you want to improve (easing cognative load, reducing out-of-box errors, easing advanced deployer configs, structured reasonsing of paths by Galaxy, etc...). I've navigated a path here that doesn't particularly reduce out of the box errors as I wanted by setting up a per-job temp directory by default but does make it possible and shouldn't break any existing configurations and doesn't make it anything more difficult to manage these things via environment variables. The new approach doesn't change any thing by default for Galaxy tools (regardless of tool profile version). The only way to achieve new behaviors is for the deployer to set a job_conf parameter called "tmp_dir". If this is set, it can be set to "True" (to default to a new, clean directory below the job directory) or to a shell expression to allow setting this dynamically at runtime to paths or paths beneath directories as needed on a per-destination basis. If a temp directory is set this way all three variables TMP, TMPDIR, and TEMP are set. Docker Environment Handling --------------------------- - Mirror the CWL behavior of mounting an external /tmp by default. - For newer tools, pass through the HOME, TMP, TMPDIR, and TEMP environment variables into the Docker container in addition to GALAXY_SLOTS. - Fix the pass through of environment variables into Docker containers. --- config/job_conf.xml.sample_advanced | 17 ++ lib/galaxy/config.py | 2 + lib/galaxy/jobs/__init__.py | 56 ++++++ lib/galaxy/jobs/rule_helper.py | 2 +- lib/galaxy/jobs/runners/__init__.py | 9 +- lib/galaxy/jobs/runners/pulsar.py | 10 ++ .../job_script/DEFAULT_JOB_FILE_TEMPLATE.sh | 5 + .../jobs/runners/util/job_script/__init__.py | 1 + lib/galaxy/tools/__init__.py | 15 ++ lib/galaxy/tools/deps/containers.py | 17 +- lib/galaxy/tools/deps/docker_util.py | 2 +- lib/galaxy/tools/evaluation.py | 9 + lib/galaxy/tools/parser/interface.py | 17 ++ lib/galaxy/tools/parser/xml.py | 21 +++ lib/galaxy/tools/xsd/galaxy.xsd | 5 + test/base/integration_util.py | 11 ++ .../tools/job_environment_default.xml | 23 +++ .../tools/job_environment_default_legacy.xml | 23 +++ .../job_environment_explicit_shared_home.xml | 23 +++ test/functional/tools/samples_tool_conf.xml | 3 + .../sets_tmp_dir_expression_job_conf.xml | 17 ++ .../sets_tmp_dir_to_true_job_conf.xml | 17 ++ test/integration/simple_job_conf.xml | 16 ++ test/integration/test_dockerized_jobs.py | 35 +++- test/integration/test_job_environments.py | 165 ++++++++++++++++++ test/unit/jobs/test_runner_local.py | 7 + test/unit/tools/test_evaluation.py | 14 ++ 27 files changed, 534 insertions(+), 8 deletions(-) create mode 100644 test/functional/tools/job_environment_default.xml create mode 100644 test/functional/tools/job_environment_default_legacy.xml create mode 100644 test/functional/tools/job_environment_explicit_shared_home.xml create mode 100644 test/integration/sets_tmp_dir_expression_job_conf.xml create mode 100644 test/integration/sets_tmp_dir_to_true_job_conf.xml create mode 100644 test/integration/simple_job_conf.xml create mode 100644 test/integration/test_job_environments.py diff --git a/config/job_conf.xml.sample_advanced b/config/job_conf.xml.sample_advanced index 89ae94aba71..9a26eaa1427 100644 --- a/config/job_conf.xml.sample_advanced +++ b/config/job_conf.xml.sample_advanced @@ -542,6 +542,23 @@ itself. --> + + + True + + + "$DRM_SET_VARIABLES_FOR_THIS_JOB" + + + $(mktemp -d /mnt/scratch/fastest/gxyjobXXXXXXXXXXX) + diff --git a/lib/galaxy/config.py b/lib/galaxy/config.py index 7ff94d69a95..0a34136983d 100644 --- a/lib/galaxy/config.py +++ b/lib/galaxy/config.py @@ -187,10 +187,12 @@ class Configuration(object): # Where dataset files are stored self.file_path = resolve_path(kwargs.get("file_path", "database/files"), self.root) + # new_file_path and legacy_home_dir can be overridden per destination in job_conf. self.new_file_path = resolve_path(kwargs.get("new_file_path", "database/tmp"), self.root) override_tempdir = string_as_bool(kwargs.get("override_tempdir", "True")) if override_tempdir: tempfile.tempdir = self.new_file_path + self.shared_home_dir = kwargs.get("shared_home_dir", None) self.openid_consumer_cache_path = resolve_path(kwargs.get("openid_consumer_cache_path", "database/openid_consumer_cache"), self.root) self.cookie_path = kwargs.get("cookie_path", "/") # Galaxy OpenID settings diff --git a/lib/galaxy/jobs/__init__.py b/lib/galaxy/jobs/__init__.py index de1c32538bc..703361cd9df 100644 --- a/lib/galaxy/jobs/__init__.py +++ b/lib/galaxy/jobs/__init__.py @@ -1110,6 +1110,15 @@ class JobWrapper(object, HasResourceParameters): if flush: self.sa_session.flush() + @property + def home_target(self): + home_target = self.tool.home_target + return home_target + + @property + def tmp_target(self): + return self.tool.tmp_target + def get_destination_configuration(self, key, default=None): """ Get a destination parameter that can be defaulted back in app.config if it needs to be applied globally. @@ -1603,6 +1612,39 @@ class JobWrapper(object, HasResourceParameters): return dp.dataset_id return None + @property + def tmp_dir_creation_statement(self): + tmp_dir = self.get_destination_configuration("tmp_dir", None) + if not tmp_dir or tmp_dir.lower() == "true": + working_directory = self.working_directory + return '$(mktemp -d "%s/tmp.XXXXXXXXX")' % working_directory + else: + return tmp_dir + + def home_directory(self): + home_target = self.home_target + return self._target_to_directory(home_target) + + def tmp_directory(self): + tmp_target = self.tmp_target + return self._target_to_directory(tmp_target) + + def _target_to_directory(self, target): + working_directory = self.working_directory + tmp_dir = self.get_destination_configuration("tmp_dir", None) + if target is None or (target == "job_tmp_if_explicit" and tmp_dir is None): + return None + elif target in ["job_tmp", "job_tmp_if_explicit"]: + return "$_GALAXY_JOB_TMP_DIR" + elif target == "shared_home": + return self.get_destination_configuration("shared_home_dir", None) + elif target == "job_home": + return "$_GALAXY_JOB_HOME_DIR" + elif target == "pwd": + return os.path.join(working_directory, "working") + else: + raise Exception("Unknown target type [%s]" % target) + def get_tool_provided_job_metadata(self): if self.tool_provided_job_metadata is not None: return self.tool_provided_job_metadata @@ -2027,6 +2069,14 @@ class ComputeEnvironment(object): be rewritten.) """ + @abstractmethod + def home_directory(self): + """Home directory of target job - none if HOME should not be set.""" + + @abstractmethod + def tmp_directory(self): + """Temp directory of target job - none if HOME should not be set.""" + class SimpleComputeEnvironment(object): @@ -2072,6 +2122,12 @@ class SharedComputeEnvironment(SimpleComputeEnvironment): def tool_directory(self): return os.path.abspath(self.job_wrapper.tool.tool_dir) + def home_directory(self): + return self.job_wrapper.home_directory() + + def tmp_directory(self): + return self.job_wrapper.tmp_directory() + class NoopQueue(object): """ diff --git a/lib/galaxy/jobs/rule_helper.py b/lib/galaxy/jobs/rule_helper.py index 3261d636703..b8664aa12fc 100644 --- a/lib/galaxy/jobs/rule_helper.py +++ b/lib/galaxy/jobs/rule_helper.py @@ -44,7 +44,7 @@ class RuleHelper(object): tool = self.app.toolbox.get_tool(job_or_tool.tool_id, tool_version=job_or_tool.tool_version) # Can't import at top because circular import between galaxy.tools and galaxy.jobs. import galaxy.tools.deps.containers - tool_info = galaxy.tools.deps.containers.ToolInfo(tool.containers, tool.requirements, tool.requires_galaxy_python_environment) + tool_info = galaxy.tools.deps.containers.ToolInfo(tool.containers, tool.requirements, tool.requires_galaxy_python_environment, tool.docker_env_pass_through) container_description = self.app.container_finder.find_best_container_description(["docker"], tool_info) return container_description is not None diff --git a/lib/galaxy/jobs/runners/__init__.py b/lib/galaxy/jobs/runners/__init__.py index cf568c4d323..ff9953b6304 100644 --- a/lib/galaxy/jobs/runners/__init__.py +++ b/lib/galaxy/jobs/runners/__init__.py @@ -327,7 +327,9 @@ class BaseJobRunner(object): for env in envs: env_setup_commands.append(env_to_statement(env)) command_line = job_wrapper.runner_command_line + tmp_dir_creation_statement = job_wrapper.tmp_dir_creation_statement options = dict( + tmp_dir_creation_statement=tmp_dir_creation_statement, job_instrumenter=job_instrumenter, galaxy_lib=job_wrapper.galaxy_lib_dir, galaxy_virtual_env=job_wrapper.galaxy_virtual_env, @@ -353,6 +355,7 @@ class BaseJobRunner(object): compute_working_directory=None, compute_tool_directory=None, compute_job_directory=None, + compute_tmp_directory=None, ): job_directory_type = "galaxy" if compute_working_directory is None else "pulsar" if not compute_working_directory: @@ -364,13 +367,17 @@ class BaseJobRunner(object): if not compute_tool_directory: compute_tool_directory = job_wrapper.tool.tool_dir + if not compute_tmp_directory: + compute_tmp_directory = job_wrapper.tmp_directory() + tool = job_wrapper.tool from galaxy.tools.deps import containers - tool_info = containers.ToolInfo(tool.containers, tool.requirements, tool.requires_galaxy_python_environment) + tool_info = containers.ToolInfo(tool.containers, tool.requirements, tool.requires_galaxy_python_environment, tool.docker_env_pass_through) job_info = containers.JobInfo( compute_working_directory, compute_tool_directory, compute_job_directory, + compute_tmp_directory, job_directory_type, ) diff --git a/lib/galaxy/jobs/runners/pulsar.py b/lib/galaxy/jobs/runners/pulsar.py index bc201e74626..5fa23cc1a16 100644 --- a/lib/galaxy/jobs/runners/pulsar.py +++ b/lib/galaxy/jobs/runners/pulsar.py @@ -871,6 +871,16 @@ class PulsarComputeEnvironment(ComputeEnvironment): def tool_directory(self): return self._tool_dir + def home_directory(self): + # TODO: revisit and implement this, won't break anything working in the + # meantime. + return None + + def tmp_directory(self): + # TODO: revisit and implement this, won't break anything working in the + # meantime. + return None + class UnsupportedPulsarException(Exception): diff --git a/lib/galaxy/jobs/runners/util/job_script/DEFAULT_JOB_FILE_TEMPLATE.sh b/lib/galaxy/jobs/runners/util/job_script/DEFAULT_JOB_FILE_TEMPLATE.sh index f817610559b..e475ade6067 100644 --- a/lib/galaxy/jobs/runners/util/job_script/DEFAULT_JOB_FILE_TEMPLATE.sh +++ b/lib/galaxy/jobs/runners/util/job_script/DEFAULT_JOB_FILE_TEMPLATE.sh @@ -12,7 +12,12 @@ _galaxy_setup_environment() { fi export PYTHONPATH fi + _GALAXY_JOB_HOME_DIR="$working_directory/home" + _GALAXY_JOB_TMP_DIR=$tmp_dir_creation_statement $env_setup_commands + # These don't get cleaned on a re-run but may in the future. + [ -z "$_GALAXY_JOB_TMP_DIR" -a ! -f "$_GALAXY_JOB_TMP_DIR" ] || mkdir -p "$_GALAXY_JOB_TMP_DIR" + [ -z "$_GALAXY_JOB_HOME_DIR" -a ! -f "$_GALAXY_JOB_HOME_DIR" ] || mkdir -p "$_GALAXY_JOB_HOME_DIR" if [ "$GALAXY_VIRTUAL_ENV" != "None" -a -f "$GALAXY_VIRTUAL_ENV/bin/activate" \ -a "`command -v python`" != "$GALAXY_VIRTUAL_ENV/bin/python" ]; then . "$GALAXY_VIRTUAL_ENV/bin/activate" diff --git a/lib/galaxy/jobs/runners/util/job_script/__init__.py b/lib/galaxy/jobs/runners/util/job_script/__init__.py index e58daa57bf3..73bfeb64852 100644 --- a/lib/galaxy/jobs/runners/util/job_script/__init__.py +++ b/lib/galaxy/jobs/runners/util/job_script/__init__.py @@ -52,6 +52,7 @@ OPTIONAL_TEMPLATE_PARAMS = { 'integrity_injection': INTEGRITY_INJECTION, 'shell': DEFAULT_SHELL, 'preserve_python_environment': True, + 'tmp_dir_creation_statement': '""', } diff --git a/lib/galaxy/tools/__init__.py b/lib/galaxy/tools/__init__.py index d9b3dc74dfc..6bbe8eefd7c 100755 --- a/lib/galaxy/tools/__init__.py +++ b/lib/galaxy/tools/__init__.py @@ -623,6 +623,21 @@ class Tool(object, Dictifiable): self.parse_command(tool_source) self.environment_variables = self.parse_environment_variables(tool_source) + self.tmp_directories = tool_source.parse_tmp_directories() + + home_target = tool_source.parse_home_target() + tmp_target = tool_source.parse_tmp_target() + # If a tool explicitly sets one of these variables just respect that and turn off + # explicit processing by Galaxy. + for environment_variable in self.environment_variables: + if environment_variable.get("name") == "HOME": + home_target = None + for tmp_directory in self.tmp_directories: + if environment_variable.get("name") == tmp_directory: + tmp_target = None + self.home_target = home_target + self.tmp_target = tmp_target + self.docker_env_pass_through = tool_source.parse_docker_env_pass_through() # Parameters used to build URL for redirection to external app redirect_url_params = tool_source.parse_redirect_url_params_elem() diff --git a/lib/galaxy/tools/deps/containers.py b/lib/galaxy/tools/deps/containers.py index ab00a1b0b1e..3e4998edfb2 100644 --- a/lib/galaxy/tools/deps/containers.py +++ b/lib/galaxy/tools/deps/containers.py @@ -283,21 +283,24 @@ class ToolInfo(object): # variables they can consume (e.g. JVM options, license keys, etc..) # and add these to env_path_through - def __init__(self, container_descriptions=[], requirements=[], requires_galaxy_python_environment=False): + def __init__(self, container_descriptions=[], requirements=[], requires_galaxy_python_environment=False, env_pass_through=["GALAXY_SLOTS"]): self.container_descriptions = container_descriptions self.requirements = requirements self.requires_galaxy_python_environment = requires_galaxy_python_environment - self.env_pass_through = ["GALAXY_SLOTS"] + self.env_pass_through = env_pass_through class JobInfo(object): - def __init__(self, working_directory, tool_directory, job_directory, job_directory_type): + def __init__( + self, working_directory, tool_directory, job_directory, tmp_directory, job_directory_type + ): self.working_directory = working_directory self.job_directory = job_directory # Tool files may be remote staged - so this is unintuitively a property # of the job not of the tool. self.tool_directory = tool_directory + self.tmp_directory = tmp_directory self.job_directory_type = job_directory_type # "galaxy" or "pulsar" @@ -394,6 +397,7 @@ class HasDockerLikeVolumes: variables[name] = os.path.abspath(value) add_var("working_directory", self.job_info.working_directory) + add_var("tmp_directory", self.job_info.tmp_directory) add_var("job_directory", self.job_info.job_directory) add_var("tool_directory", self.job_info.tool_directory) add_var("galaxy_root", self.app_info.galaxy_root_dir) @@ -408,6 +412,8 @@ class HasDockerLikeVolumes: defaults = "$galaxy_root:default_ro,$tool_directory:default_ro" if self.job_info.job_directory: defaults += ",$job_directory:default_ro" + if self.job_info.tmp_directory is not None: + defaults += ",$tmp_directory:rw" if self.app_info.outputs_to_working_directory: # Should need default_file_path (which is of course an estimate given # object stores anyway). @@ -454,6 +460,11 @@ class DockerContainer(Container, HasDockerLikeVolumes): preprocessed_volumes_str = preprocess_volumes(volumes_raw, self.container_type) # TODO: Remove redundant volumes... volumes = docker_util.DockerVolume.volumes_from_str(preprocessed_volumes_str) + # If a tool definitely has a temp directory available set it to /tmp in container for compat. + # with CWL. This is part of that spec and should make it easier to share containers between CWL + # and Galaxy. + if self.job_info.tmp_directory is not None: + volumes.append(docker_util.DockerVolume.volume_from_str("%s:/tmp:rw" % self.job_info.tmp_directory)) volumes_from = self.destination_info.get("docker_volumes_from", docker_util.DEFAULT_VOLUMES_FROM) docker_host_props = dict( diff --git a/lib/galaxy/tools/deps/docker_util.py b/lib/galaxy/tools/deps/docker_util.py index a28b2103e71..e97da9c737b 100644 --- a/lib/galaxy/tools/deps/docker_util.py +++ b/lib/galaxy/tools/deps/docker_util.py @@ -155,7 +155,7 @@ def build_docker_run_command( if terminal: command_parts.append("-t") for env_directive in env_directives: - command_parts.extend(["-e", shlex_quote(env_directive)]) + command_parts.extend(["-e", env_directive]) for volume in volumes: command_parts.extend(["-v", shlex_quote(str(volume))]) if volumes_from: diff --git a/lib/galaxy/tools/evaluation.py b/lib/galaxy/tools/evaluation.py index b4f3a44f4f4..1c190bc5880 100644 --- a/lib/galaxy/tools/evaluation.py +++ b/lib/galaxy/tools/evaluation.py @@ -521,6 +521,15 @@ class ToolEvaluator(object): environment_variable["raw"] = True environment_variables.append(environment_variable) + home_dir = self.compute_environment.home_directory() + tmp_dir = self.compute_environment.tmp_directory() + if home_dir: + environment_variable = dict(name="HOME", value='"%s"' % home_dir, raw=True) + environment_variables.append(environment_variable) + if tmp_dir: + for tmp_directory in self.tool.tmp_directories: + environment_variable = dict(name=tmp_directory, value='"%s"' % tmp_dir, raw=True) + environment_variables.append(environment_variable) self.environment_variables = environment_variables return environment_variables diff --git a/lib/galaxy/tools/parser/interface.py b/lib/galaxy/tools/parser/interface.py index 75e77a5b1bc..c7d809c8579 100644 --- a/lib/galaxy/tools/parser/interface.py +++ b/lib/galaxy/tools/parser/interface.py @@ -91,6 +91,23 @@ class ToolSource(object): """ Return environment variable templates to expose. """ + def parse_home_target(self): + """Should be "job_home", "shared_home", "job_tmp", "pwd", or None. + """ + return "pwd" + + def parse_tmp_target(self): + """Should be "pwd", "shared_home", "job_tmp", "job_tmp_if_explicit", or None. + """ + return "job_tmp" + + def parse_tmp_directories(self): + """Directories to override if a tmp_target is not None.""" + return ["TMPDIR", "TMP", "TEMP"] + + def parse_docker_env_pass_through(self): + return ["GALAXY_SLOTS", "HOME"] + self.parse_tmp_directories() + @abstractmethod def parse_interpreter(self): """ Return string containing the interpreter to prepend to the command diff --git a/lib/galaxy/tools/parser/xml.py b/lib/galaxy/tools/parser/xml.py index d6de65c88af..86f932b2318 100644 --- a/lib/galaxy/tools/parser/xml.py +++ b/lib/galaxy/tools/parser/xml.py @@ -126,6 +126,27 @@ class XmlToolSource(ToolSource): ) return environment_variables + def parse_home_target(self): + target = "job_home" if self.parse_profile() >= "18.01" else "shared_home" + command_el = self._command_el + command_legacy = (command_el is not None) and command_el.get("use_shared_home", None) + if command_legacy is not None: + target = "shared_home" if string_as_bool(command_legacy) else "job_home" + return target + + def parse_tmp_target(self): + # Default to not touching TMPDIR et. al. but if job_tmp is set + # in job_conf then do. This is a very conservative approach that shouldn't + # break or modify any configurations by default. + return "job_tmp_if_explicit" + + def parse_docker_env_pass_through(self): + if self.parse_profile() < "18.01": + return ["GALAXY_SLOTS"] + else: + # Pass home, etc... + return super(XmlToolSource, self).parse_docker_env_pass_through() + def parse_interpreter(self): interpreter = None command_el = self._command_el diff --git a/lib/galaxy/tools/xsd/galaxy.xsd b/lib/galaxy/tools/xsd/galaxy.xsd index 56b24d6a584..92eacf6f422 100644 --- a/lib/galaxy/tools/xsd/galaxy.xsd +++ b/lib/galaxy/tools/xsd/galaxy.xsd @@ -2706,6 +2706,11 @@ deprecated and using the ``$__tool_directory__`` variable is superior. Only used if ``detect_errors="exit_code", tells Galaxy the specified exit code indicates an out of memory error. Galaxy instances may be configured to retry such jobs on resources with more memory. + + + When running a job for this tool, do not isolate its $HOME directory within the job's directory - use either the shared_home_dir setting in Galaxy or the default $HOME specified in the job's default environment. + + This attribute defines the programming language in which the tool's executable file is written. Any language can be used (tools can be written in Python, C, Perl, Java, etc.). The executable file must be in the same directory of the XML file. If instead this attribute is not specified, the tag content should be a Bash command calling executable(s) available in the $PATH. diff --git a/test/base/integration_util.py b/test/base/integration_util.py index 4339436a9b4..363b19a32bf 100644 --- a/test/base/integration_util.py +++ b/test/base/integration_util.py @@ -7,6 +7,7 @@ tessting configuration. import os from unittest import skip, TestCase +from galaxy.tools.deps.commands import which from .api import UsesApiTestCaseMixin from .driver_util import GalaxyTestDriver @@ -21,6 +22,16 @@ def skip_if_jenkins(cls): return cls +def skip_unless_executable(executable): + if which(executable): + return lambda func: func + return skip("PATH doesn't contain executable %s" % executable) + + +def skip_unless_docker(): + return skip_unless_executable("docker") + + class IntegrationTestCase(TestCase, UsesApiTestCaseMixin): """Unit test case with utilities for spinning up Galaxy.""" diff --git a/test/functional/tools/job_environment_default.xml b/test/functional/tools/job_environment_default.xml new file mode 100644 index 00000000000..4b0d1cf8dc9 --- /dev/null +++ b/test/functional/tools/job_environment_default.xml @@ -0,0 +1,23 @@ + + + busybox:ubuntu-14.04 + + '$user_id'; + echo `id -g` > '$group_id'; + echo `pwd` > '$pwd'; + echo "\$HOME" > '$home'; + echo "\$TMP" > '$tmp'; + ]]> + + + + + + + + + + + + diff --git a/test/functional/tools/job_environment_default_legacy.xml b/test/functional/tools/job_environment_default_legacy.xml new file mode 100644 index 00000000000..62be15999b6 --- /dev/null +++ b/test/functional/tools/job_environment_default_legacy.xml @@ -0,0 +1,23 @@ + + + busybox:ubuntu-14.04 + + '$user_id'; + echo `id -g` > '$group_id'; + echo `pwd` > '$pwd'; + echo "\$HOME" > '$home'; + echo "\$TMP" > '$tmp'; + ]]> + + + + + + + + + + + + diff --git a/test/functional/tools/job_environment_explicit_shared_home.xml b/test/functional/tools/job_environment_explicit_shared_home.xml new file mode 100644 index 00000000000..45c168c00cb --- /dev/null +++ b/test/functional/tools/job_environment_explicit_shared_home.xml @@ -0,0 +1,23 @@ + + + busybox:ubuntu-14.04 + + '$user_id'; + echo `id -g` > '$group_id'; + echo `pwd` > '$pwd'; + echo "\$HOME" > '$home'; + echo "\$TMP" > '$tmp'; + ]]> + + + + + + + + + + + + diff --git a/test/functional/tools/samples_tool_conf.xml b/test/functional/tools/samples_tool_conf.xml index 512e2925aaa..859e93af5f6 100644 --- a/test/functional/tools/samples_tool_conf.xml +++ b/test/functional/tools/samples_tool_conf.xml @@ -51,6 +51,9 @@ --> + + + diff --git a/test/integration/sets_tmp_dir_expression_job_conf.xml b/test/integration/sets_tmp_dir_expression_job_conf.xml new file mode 100644 index 00000000000..ac7e5b1b233 --- /dev/null +++ b/test/integration/sets_tmp_dir_expression_job_conf.xml @@ -0,0 +1,17 @@ + + + + + + + + + + + + + $(mktemp cooltmpXXXXXXXXXXXX) + + + + diff --git a/test/integration/sets_tmp_dir_to_true_job_conf.xml b/test/integration/sets_tmp_dir_to_true_job_conf.xml new file mode 100644 index 00000000000..e976483f389 --- /dev/null +++ b/test/integration/sets_tmp_dir_to_true_job_conf.xml @@ -0,0 +1,17 @@ + + + + + + + + + + + + + True + + + + diff --git a/test/integration/simple_job_conf.xml b/test/integration/simple_job_conf.xml new file mode 100644 index 00000000000..abcb0768234 --- /dev/null +++ b/test/integration/simple_job_conf.xml @@ -0,0 +1,16 @@ + + + + + + + + + + + + + + + + diff --git a/test/integration/test_dockerized_jobs.py b/test/integration/test_dockerized_jobs.py index 88aa843938c..e868d13c24d 100644 --- a/test/integration/test_dockerized_jobs.py +++ b/test/integration/test_dockerized_jobs.py @@ -1,23 +1,28 @@ """Integration tests for running tools in Docker containers.""" import os +import tempfile from base import integration_util from base.populators import ( DatasetPopulator, ) +from .test_job_environments import RunsEnvironmentJobs + SCRIPT_DIRECTORY = os.path.abspath(os.path.dirname(__file__)) DOCKERIZED_JOB_CONFIG_FILE = os.path.join(SCRIPT_DIRECTORY, "dockerized_job_conf.xml") -# DOCKERIZED_JOB_DEPENDENCY_RESOLVERS_CONF = os.path.join(SCRIPT_DIRECTORY, "dockerzied_dependency_resolvers_conf.xml") -class DockerizedJobsIntegrationTestCase(integration_util.IntegrationTestCase): +@integration_util.skip_unless_docker() +class DockerizedJobsIntegrationTestCase(integration_util.IntegrationTestCase, RunsEnvironmentJobs): framework_tool_and_types = True @classmethod def handle_galaxy_config_kwds(cls, config): + cls.jobs_directory = tempfile.mkdtemp() + config["jobs_directory"] = cls.jobs_directory config["job_config_file"] = DOCKERIZED_JOB_CONFIG_FILE # Disable tool dependency resolution. config["tool_dependency_dir"] = "none" @@ -39,3 +44,29 @@ class DockerizedJobsIntegrationTestCase(integration_util.IntegrationTestCase): self.dataset_populator.wait_for_history(self.history_id, assert_ok=True) output = self.dataset_populator.get_history_dataset_content(self.history_id) assert "0.7.15-r1140" in output + + def test_docker_job_enviornment(self): + job_env = self._run_and_get_environment_properties("job_environment_default") + + euid = os.geteuid() + egid = os.getgid() + + assert job_env.user_id == str(euid), job_env.user_id + assert job_env.group_id == str(egid), job_env.group_id + assert job_env.pwd.startswith(self.jobs_directory) + assert job_env.pwd.endswith("/working") + assert job_env.home == job_env.pwd, job_env.home + + def test_docker_job_environment_legacy(self): + job_env = self._run_and_get_environment_properties("job_environment_default_legacy") + + euid = os.geteuid() + egid = os.getgid() + + assert job_env.user_id == str(euid), job_env.user_id + assert job_env.group_id == str(egid), job_env.group_id + assert job_env.pwd.startswith(self.jobs_directory) + assert job_env.pwd.endswith("/working") + # Should we change env_pass_through to just always include TMP and HOME for docker? + # I'm not sure, if yes this would change. + assert job_env.home == "/", job_env.home diff --git a/test/integration/test_job_environments.py b/test/integration/test_job_environments.py new file mode 100644 index 00000000000..46def1a1114 --- /dev/null +++ b/test/integration/test_job_environments.py @@ -0,0 +1,165 @@ +"""Integration tests for the Pulsar embedded runner.""" + +import collections +import os +import tempfile + +from base import integration_util +from base.populators import ( + DatasetPopulator, + skip_without_tool, +) + +SCRIPT_DIRECTORY = os.path.abspath(os.path.dirname(__file__)) +SIMPLE_JOB_CONFIG_FILE = os.path.join(SCRIPT_DIRECTORY, "simple_job_conf.xml") +SETS_TMP_DIR_TO_TRUE_JOB_CONFIG = os.path.join(SCRIPT_DIRECTORY, "sets_tmp_dir_to_true_job_conf.xml") +SETS_TMP_DIR_AS_EXPRESSION_JOB_CONFIG = os.path.join(SCRIPT_DIRECTORY, "sets_tmp_dir_expression_job_conf.xml") + +JobEnviromentProperties = collections.namedtuple("JobEnvironmentProperties", [ + "user_id", + "group_id", + "pwd", + "home", + "tmp", +]) + + +class RunsEnvironmentJobs: + + def _run_and_get_environment_properties(self, tool_id="job_environment_default"): + with self.dataset_populator.test_history() as history_id: + self.dataset_populator.run_tool(tool_id, {}, history_id) + self.dataset_populator.wait_for_history(history_id, assert_ok=True) + return self._environment_properties(history_id) + + def _environment_properties(self, history_id): + user_id = self.dataset_populator.get_history_dataset_content(history_id, hid=1).strip() + group_id = self.dataset_populator.get_history_dataset_content(history_id, hid=2).strip() + pwd = self.dataset_populator.get_history_dataset_content(history_id, hid=3).strip() + home = self.dataset_populator.get_history_dataset_content(history_id, hid=4).strip() + tmp = self.dataset_populator.get_history_dataset_content(history_id, hid=5).strip() + + return JobEnviromentProperties(user_id, group_id, pwd, home, tmp) + + +class BaseJobEnvironmentIntegrationTestCase(integration_util.IntegrationTestCase, RunsEnvironmentJobs): + + framework_tool_and_types = True + + def setUp(self): + super(BaseJobEnvironmentIntegrationTestCase, self).setUp() + self.dataset_populator = DatasetPopulator(self.galaxy_interactor) + + +class DefaultJobEnvironmentIntegrationTestCase(BaseJobEnvironmentIntegrationTestCase): + + @classmethod + def handle_galaxy_config_kwds(cls, config): + cls.jobs_directory = tempfile.mkdtemp() + config["jobs_directory"] = cls.jobs_directory + config["job_config_file"] = SIMPLE_JOB_CONFIG_FILE # Ensure no Docker for these tests + + @skip_without_tool("job_environment_default") + def test_default_environment_1801(self): + job_env = self._run_and_get_environment_properties() + + euid = os.geteuid() + egid = os.getgid() + + assert job_env.user_id == str(euid), job_env.user_id + assert job_env.group_id == str(egid), job_env.group_id + assert job_env.pwd.startswith(self.jobs_directory) + assert job_env.pwd.endswith("/working") + + # Newer tools have isolated home directories in job_directory/home + job_directory = os.path.dirname(job_env.pwd) + assert job_env.home == os.path.join(job_directory, "home"), job_env.home + + # Since job_conf doesn't set tmp_dir parameter - temp isn't in job_directory + assert not job_env.tmp.startswith(job_directory) + + @skip_without_tool("job_environment_default_legacy") + def test_default_environment_legacy(self): + job_env = self._run_and_get_environment_properties("job_environment_default_legacy") + + euid = os.geteuid() + egid = os.getgid() + home = os.getenv("HOME") + + assert job_env.user_id == str(euid), job_env.user_id + assert job_env.group_id == str(egid), job_env.group_id + assert job_env.home == home, job_env.home + + @skip_without_tool("job_environment_explicit_shared_home") + def test_default_environment_force_legacy_home(self): + # Home should not overridden because we haven't set legacy_home_dir in job_conf + # or app, so it should just HOME. + job_env = self._run_and_get_environment_properties("job_environment_explicit_shared_home") + home = os.getenv("HOME") + assert job_env.home == home, job_env.home + + +class TmpDirToTrueJobEnvironmentIntegrationTestCase(BaseJobEnvironmentIntegrationTestCase): + + @classmethod + def handle_galaxy_config_kwds(cls, config): + cls.jobs_directory = tempfile.mkdtemp() + config["jobs_directory"] = cls.jobs_directory + config["job_config_file"] = SETS_TMP_DIR_TO_TRUE_JOB_CONFIG + + @skip_without_tool("job_environment_default") + def test_default_environment_1801(self): + job_env = self._run_and_get_environment_properties() + + job_directory = os.path.dirname(job_env.pwd) + + # Since job_conf sets tmp_dir parameter to True - temp is in job_directory + assert job_env.tmp.startswith(job_directory) + + +class TmpDirAsShellCommandJobEnvironmentIntegrationTestCase(BaseJobEnvironmentIntegrationTestCase): + + @classmethod + def handle_galaxy_config_kwds(cls, config): + cls.jobs_directory = tempfile.mkdtemp() + config["jobs_directory"] = cls.jobs_directory + config["job_config_file"] = SETS_TMP_DIR_AS_EXPRESSION_JOB_CONFIG + + @skip_without_tool("job_environment_default") + def test_default_environment_1801(self): + job_env = self._run_and_get_environment_properties() + + # Since job_conf sets tmp_dir parameter to $(mktemp cooltmpXXXXXXXXXXXX) should + # start with cooltmp. + basename = os.path.basename(job_env.tmp) + assert basename.startswith("cooltmp"), job_env.tmp + + +class SharedHomeJobEnvironmentIntegrationTestCase(BaseJobEnvironmentIntegrationTestCase): + + @classmethod + def handle_galaxy_config_kwds(cls, config): + cls.jobs_directory = tempfile.mkdtemp() + cls.shared_home_directory = tempfile.mkdtemp() + config["jobs_directory"] = cls.jobs_directory + config["job_config_file"] = SIMPLE_JOB_CONFIG_FILE # Ensure no Docker for these tests + config["shared_home_dir"] = cls.shared_home_directory + + @skip_without_tool("job_environment_default") + def test_default_environment(self): + # Test shared_home_dir ignored for newer tools by default + job_env = self._run_and_get_environment_properties() + job_directory = os.path.dirname(job_env.pwd) + assert job_env.home == os.path.join(job_directory, "home"), job_env.home + + @skip_without_tool("job_environment_default_legacy") + def test_default_environment_legacy(self): + # shared_home_dir used by default for older tools + job_env = self._run_and_get_environment_properties("job_environment_default_legacy") + assert job_env.home == self.shared_home_directory, job_env.home + + @skip_without_tool("job_environment_explicit_shared_home") + def test_default_environment_force_legacy_home(self): + # shared_home_dir used for newer tools if forced in tool XML + job_env = self._run_and_get_environment_properties("job_environment_explicit_shared_home") + assert job_env.home == self.shared_home_directory, job_env.home diff --git a/test/unit/jobs/test_runner_local.py b/test/unit/jobs/test_runner_local.py index 6b3c26cc9ce..2a5955d2389 100644 --- a/test/unit/jobs/test_runner_local.py +++ b/test/unit/jobs/test_runner_local.py @@ -147,6 +147,7 @@ class MockJobWrapper(object): self.galaxy_virtual_env = None self.shell = "/bin/bash" self.cleanup_job = "never" + self.tmp_dir_creation_statement = "" # Cruft for setting metadata externally, axe at some point. self.external_output_metadata = bunch.Bunch( @@ -210,3 +211,9 @@ class MockJobWrapper(object): self.stdout = stdout self.stderr = stderr self.exit_code = exit_code + + def tmp_directory(self): + return None + + def home_directory(self): + return None diff --git a/test/unit/tools/test_evaluation.py b/test/unit/tools/test_evaluation.py index 08db6eb8cb2..e40242e9227 100644 --- a/test/unit/tools/test_evaluation.py +++ b/test/unit/tools/test_evaluation.py @@ -243,6 +243,12 @@ class TestComputeEnviornment(SimpleComputeEnvironment): def working_directory(self): return self._working_directory + def home_directory(self): + return self._working_directory + + def tmp_directory(self): + return self._working_directory + def new_file_path(self): return self._new_file_path @@ -293,6 +299,14 @@ class MockTool(object): output1=ToolOutput("output1"), ) + @property + def config_file(self): + return self._config_files[0] + + @property + def tmp_directories(self): + return ["TMP"] + @property def config_files(self): return self._config_files From db0633eb8965306f4a7a8cca36e882cffc73ad55 Mon Sep 17 00:00:00 2001 From: John Chilton Date: Tue, 9 Jan 2018 09:27:21 -0500 Subject: [PATCH 060/112] Follow up on comments for #5193. --- lib/galaxy/jobs/__init__.py | 2 +- lib/galaxy/tools/__init__.py | 8 +++++--- lib/galaxy/tools/deps/docker_util.py | 2 ++ lib/galaxy/tools/evaluation.py | 4 ++-- lib/galaxy/tools/parser/interface.py | 4 ++-- test/integration/test_dockerized_jobs.py | 3 ++- test/integration/test_job_environments.py | 2 +- test/unit/tools/test_evaluation.py | 2 +- 8 files changed, 16 insertions(+), 11 deletions(-) diff --git a/lib/galaxy/jobs/__init__.py b/lib/galaxy/jobs/__init__.py index 703361cd9df..559dbcb6c7d 100644 --- a/lib/galaxy/jobs/__init__.py +++ b/lib/galaxy/jobs/__init__.py @@ -1617,7 +1617,7 @@ class JobWrapper(object, HasResourceParameters): tmp_dir = self.get_destination_configuration("tmp_dir", None) if not tmp_dir or tmp_dir.lower() == "true": working_directory = self.working_directory - return '$(mktemp -d "%s/tmp.XXXXXXXXX")' % working_directory + return '''$([ ! -e '{0}/tmp' ] || mv '{0}/tmp' '{0}'/tmp.$(date +%Y%m%d-%H%M%S) ; mkdir '{0}/tmp'; echo '{0}/tmp')'''.format(working_directory) else: return tmp_dir diff --git a/lib/galaxy/tools/__init__.py b/lib/galaxy/tools/__init__.py index 6bbe8eefd7c..f7837be5110 100755 --- a/lib/galaxy/tools/__init__.py +++ b/lib/galaxy/tools/__init__.py @@ -623,7 +623,7 @@ class Tool(object, Dictifiable): self.parse_command(tool_source) self.environment_variables = self.parse_environment_variables(tool_source) - self.tmp_directories = tool_source.parse_tmp_directories() + self.tmp_directory_vars = tool_source.parse_tmp_directory_vars() home_target = tool_source.parse_home_target() tmp_target = tool_source.parse_tmp_target() @@ -632,9 +632,11 @@ class Tool(object, Dictifiable): for environment_variable in self.environment_variables: if environment_variable.get("name") == "HOME": home_target = None - for tmp_directory in self.tmp_directories: - if environment_variable.get("name") == tmp_directory: + continue + for tmp_directory_var in self.tmp_directory_vars: + if environment_variable.get("name") == tmp_directory_var: tmp_target = None + break self.home_target = home_target self.tmp_target = tmp_target self.docker_env_pass_through = tool_source.parse_docker_env_pass_through() diff --git a/lib/galaxy/tools/deps/docker_util.py b/lib/galaxy/tools/deps/docker_util.py index e97da9c737b..5e3e83416f6 100644 --- a/lib/galaxy/tools/deps/docker_util.py +++ b/lib/galaxy/tools/deps/docker_util.py @@ -155,6 +155,8 @@ def build_docker_run_command( if terminal: command_parts.append("-t") for env_directive in env_directives: + # e.g. -e "GALAXY_SLOTS=$GALAXY_SLOTS" + # These are environment variable expansions so we don't quote these. command_parts.extend(["-e", env_directive]) for volume in volumes: command_parts.extend(["-v", shlex_quote(str(volume))]) diff --git a/lib/galaxy/tools/evaluation.py b/lib/galaxy/tools/evaluation.py index 1c190bc5880..25f5804a50b 100644 --- a/lib/galaxy/tools/evaluation.py +++ b/lib/galaxy/tools/evaluation.py @@ -527,8 +527,8 @@ class ToolEvaluator(object): environment_variable = dict(name="HOME", value='"%s"' % home_dir, raw=True) environment_variables.append(environment_variable) if tmp_dir: - for tmp_directory in self.tool.tmp_directories: - environment_variable = dict(name=tmp_directory, value='"%s"' % tmp_dir, raw=True) + for tmp_directory_var in self.tool.tmp_directory_vars: + environment_variable = dict(name=tmp_directory_var, value='"%s"' % tmp_dir, raw=True) environment_variables.append(environment_variable) self.environment_variables = environment_variables return environment_variables diff --git a/lib/galaxy/tools/parser/interface.py b/lib/galaxy/tools/parser/interface.py index c7d809c8579..626a8f2114c 100644 --- a/lib/galaxy/tools/parser/interface.py +++ b/lib/galaxy/tools/parser/interface.py @@ -101,12 +101,12 @@ class ToolSource(object): """ return "job_tmp" - def parse_tmp_directories(self): + def parse_tmp_directory_vars(self): """Directories to override if a tmp_target is not None.""" return ["TMPDIR", "TMP", "TEMP"] def parse_docker_env_pass_through(self): - return ["GALAXY_SLOTS", "HOME"] + self.parse_tmp_directories() + return ["GALAXY_SLOTS", "HOME"] + self.parse_tmp_directory_vars() @abstractmethod def parse_interpreter(self): diff --git a/test/integration/test_dockerized_jobs.py b/test/integration/test_dockerized_jobs.py index e868d13c24d..a9bb909b09e 100644 --- a/test/integration/test_dockerized_jobs.py +++ b/test/integration/test_dockerized_jobs.py @@ -55,7 +55,8 @@ class DockerizedJobsIntegrationTestCase(integration_util.IntegrationTestCase, Ru assert job_env.group_id == str(egid), job_env.group_id assert job_env.pwd.startswith(self.jobs_directory) assert job_env.pwd.endswith("/working") - assert job_env.home == job_env.pwd, job_env.home + assert job_env.home.startswith(self.jobs_directory) + assert job_env.home.endswith("/home") def test_docker_job_environment_legacy(self): job_env = self._run_and_get_environment_properties("job_environment_default_legacy") diff --git a/test/integration/test_job_environments.py b/test/integration/test_job_environments.py index 46def1a1114..7d2ef8cffa2 100644 --- a/test/integration/test_job_environments.py +++ b/test/integration/test_job_environments.py @@ -114,7 +114,7 @@ class TmpDirToTrueJobEnvironmentIntegrationTestCase(BaseJobEnvironmentIntegratio job_directory = os.path.dirname(job_env.pwd) # Since job_conf sets tmp_dir parameter to True - temp is in job_directory - assert job_env.tmp.startswith(job_directory) + assert job_env.tmp.startswith(job_directory), job_env class TmpDirAsShellCommandJobEnvironmentIntegrationTestCase(BaseJobEnvironmentIntegrationTestCase): diff --git a/test/unit/tools/test_evaluation.py b/test/unit/tools/test_evaluation.py index e40242e9227..0aaa3aeb038 100644 --- a/test/unit/tools/test_evaluation.py +++ b/test/unit/tools/test_evaluation.py @@ -304,7 +304,7 @@ class MockTool(object): return self._config_files[0] @property - def tmp_directories(self): + def tmp_directory_vars(self): return ["TMP"] @property From 36ecca47e7c859a980c4e775db0ebedbb1c02cef Mon Sep 17 00:00:00 2001 From: Nate Coraor Date: Tue, 9 Jan 2018 18:21:22 -0500 Subject: [PATCH 061/112] Major updates to the scaling doc for uWSGI --- doc/source/admin/scaling.md | 640 +++++++++++++++++++++++++----------- 1 file changed, 439 insertions(+), 201 deletions(-) diff --git a/doc/source/admin/scaling.md b/doc/source/admin/scaling.md index 251b7169d09..40f1b4e632c 100644 --- a/doc/source/admin/scaling.md +++ b/doc/source/admin/scaling.md @@ -1,17 +1,30 @@ # Scaling and Load Balancing -The Galaxy framework is written in Python and makes extensive use of threads. However, one of the drawbacks of Python is the [Global Interpreter Lock](http://docs.python.org/c-api/init.html#thread-state-and-the-global-interpreter-lock), which prevents more than one thread from being on CPU at a time. Because of this, having a multi-core system will not improve the Galaxy framework's performance out of the box since Galaxy can use (at most) one core at a time in its default configuration. However, Galaxy can easily run in multiple separate processes, which solves this problem. For a more thorough explanation of this problem and why you will almost surely want to switch to the multiprocess configuration if running for more than a small handful of users, see the [production configuration](production.html) page. +The Galaxy framework is written in Python and makes extensive use of threads. However, one of the drawbacks of Python +is the [Global Interpreter Lock](http://docs.python.org/c-api/init.html#thread-state-and-the-global-interpreter-lock), +which prevents more than one thread from being on CPU at a time. Because of this, having a multi-core system will not +improve the Galaxy framework's performance out of the box since Galaxy can use (at most) one core at a time in its +default configuration. However, Galaxy can easily run in multiple separate processes, which solves this problem. For a +more thorough explanation of this problem and why you will almost surely want to switch to the multiprocess +configuration if running for more than a small handful of users, see the [production configuration](production.html) +page. -Just to be clear: increasing the values of `threadpool_workers` in `galaxy.yml` or the number of plugin workers in `job_conf.xml` will not make you Galaxy server much more responsive. The key to scaling Galaxy is the ability to run *multiple* Galaxy servers which co-operatively work on the same database. +Just to be clear: increasing the values of `threadpool_workers` in `galaxy.yml` or the number of plugin workers in +`job_conf.xml` will not make you Galaxy server much more responsive. The key to scaling Galaxy is the ability to run +*multiple* Galaxy servers which co-operatively work on the same database. ## Terminology * **web worker** - Galaxy server process responsible for servicing web requests for the UI/API -* **job handler** - Galaxy server process responsible for starting and monitoring jobs, submitting jobs to a cluster (if configured), and for setting metadata (if not set on the cluster) +* **job handler** - Galaxy server process responsible for setting up, starting, and monitoring jobs, submitting jobs to + a cluster (if configured), for setting metadata (if not set on the cluster), and cleaning up after jobs * **[uWSGI][uwsgi]** - Powerful application server written in C that implements the HTTP and Python WSGI protocols - * **[Mules][uwsgi-mules]** - uWSGI processes started after the main application (Galaxy) that can run separate code and receive messages from uWSGI web workers - * **[Zerg Mode][uwsgi-zerg-mode]** - uWSGI configuration where multiple copies of the same application can be started simultaneously in order to maintain availability during application restarts - * **[Emperor Mode][uwsgi-emperor-mode]** - uWSGI configuration where multiple distinct applications can be started by a single master uWSGI process + * **[Mules][uwsgi-mules]** - uWSGI processes started after the main application (Galaxy) that can run separate code + and receive messages from uWSGI web workers + * **[Zerg Mode][uwsgi-zerg-mode]** - uWSGI configuration where multiple copies of the same application can be started + simultaneously in order to maintain availability during application restarts + * **[Emperor Mode][uwsgi-emperor-mode]** - uWSGI configuration where multiple distinct applications can be started by + a single master uWSGI process * **Webless Galaxy application** - The Galaxy application run as a standalone Python application with no web/WSGI server * **[Paste][paste]** - Application server written in pure Python that implements the HTTP and Python WSGI protocols @@ -21,187 +34,497 @@ Just to be clear: increasing the values of `threadpool_workers` in `galaxy.yml` [uwsgi-emperor-mode]: http://uwsgi-docs.readthedocs.io/en/latest/Emperor.html [paste]: http://paste.readthedocs.io/ -### Deployment Options +## Application Servers -There are multiple deployment strategies for the Galaxy application that you can choose from. The right one depends on the configuration of the infrastructure on which you are deploying. +It is possible to run the Galaxy server in many different ways, including under different web application frameworks, or +as a standalone server with no web stack. For most of its modern life, prior to the 18.01 release, Galaxy (by default) +used the [Python Paste][paste] web stack, and ran in a single process. -#### uWSGI with jobs handled by web workers (default configuration) +Beginning with Galaxy release 18.01, the default application server for new installations of Galaxy is [uWSGI][uwsgi]. +Prior to 18.01, it was possible (and indeed, recommended for production Galaxy servers) to run Galaxy under uWSGI, but +it was necessary to install and configure uWSGI separately from Galaxy. uWSGI is now provided with Galaxy as a Python +Wheel and installed in to its virtualenv, as described in detail in the [Framework +Dependencies](framework_dependencies.html) documentation. + +uWSGI has numerous benefits over Python Paste for our purposes: -* Easily runs multiple processes by increasing `processes` config option -* Load balanced internally -* Speaks native uWSGI protocol supported by nginx and Apache or direct HTTP (and SSL) * Written in C and designed to be high performance -* Supports WebSockets, which enable Galaxy Interactive Environments out-of-the-box without a proxy server or Node.js +* Easily runs multiple processes by increasing `processes` config option +* Load balances multiple processes internally rather than requiring load balancing in the proxy server +* Offload engine for serving static content +* Speaks high performance native protocol between uWSGI and proxy server +* Can speak HTTP and HTTPS protocols without proxy server * Incredibly featureful, supports a wide array of deployment scenarios -* The default as of Galaxy Release 18.01 -* Jobs are handled by uWSGI web workers (but all Galaxy job features such as [running on a cluster](cluster.html) are still supported) +* Supports WebSockets, which enable Galaxy Interactive Environments out-of-the-box without a proxy server or Node.js -Under this strategy, jobs will be handled by the web worker that receives the job request from the UI/API. Having web processes handle jobs will negatively impact UI/API performance. +## Deployment Options -#### uWSGI for web serving with Mules as job handlers +There are multiple deployment strategies for the Galaxy application that you can choose from. The right one depends on +the configuration of the infrastructure on which you are deploying. In all cases, all Galaxy job features such as +[running on a cluster](cluster.html) are supported. + +Although uWSGI implements nearly all the features that were previously the responsibility of an upstream proxy server, +at this time, it is still recomended to place a proxy server in front of uWSGI and utilize it for all of its traditional +roles (serving static content, serving dataset downloads, etc.) as described in the [production +configuration](production.html) documentation. + +When using uWSGI with a proxy server, it is recommended that you use the native high performance uWSGI protocol +(supported by both [Apache](special_topics/apache.html) and [nginx](special_topics/nginx.html)) between uWSGI and the +proxy server, rather than HTTP. + +### uWSGI with jobs handled by web workers (default configuration) + +Referred to in this documentation as the **uWSGI all-in-one** strategy. + +* Job handlers and web workers are the same processes and cannot be separated +* The web worker that receives the job request from the UI/API will be the job handler for that job + +Under this strategy, jobs will be handled by uWSGI web workers. Having web processes handle jobs will negatively impact +UI/API performance. + +This is the default out-of-the-box configuration as of Galaxy Release 18.01. + +### uWSGI for web serving with Mules as job handlers + +Referred to in this documentation as the **uWSGI + Mules** strategy. * Job handlers run as children of the uWSGI process * Jobs are dispatched from web workers to job handlers via native *mule messaging* * Jobs can only be dispatched to mules on the same host * Trivially easy to enable (disabled by default for simplicity reasons) -Under this strategy, job handling is offloaded to dedicated non-web-serving processes that are started and stopped directly by the master uWSGI process. As a benefit of using mule messaging, only job handlers that are alive will be selected to run jobs. +Under this strategy, job handling is offloaded to dedicated non-web-serving processes that are started and stopped +directly by the master uWSGI process. As a benefit of using mule messaging, only job handlers that are alive will be +selected to run jobs. -**uWSGI + Mule job handlers is the recommended deployment strategy** for Galaxy servers that run web servers and job handlers **on the same host**. +This is the recommended deployment strategy for Galaxy servers that run web servers and job handlers **on the same +host**. -#### uWSGI for web serving and Webless Galaxy applications as job handlers +### uWSGI for web serving and Webless Galaxy applications as job handlers -* Galaxy is started as a standalone Python application with no web stack +Referred to in this documentation as the **uWSGI + Webless** strategy. + +* Job handlers are started as standalone Python applications with no web stack * Jobs are dispatched from web workers to job handlers via the Galaxy database * Jobs can be dispatched to job handlers running on any host * The recommended deployment strategy for production Galaxy instances prior to 18.01 -Like mules, under this strategy, job handling is offloaded to dedicated non-web-serving processes, but those processes are [managed by the administrator](#starting-and-stopping). Because the handler is randomly assigned by the web worker when the job is submitted via the UI/API, jobs may be assigned to dead handlers. +Like mules, under this strategy, job handling is offloaded to dedicated non-web-serving processes, but those processes +are [managed by the administrator](#starting-and-stopping). Because the handler is randomly assigned by the web worker +when the job is submitted via the UI/API, jobs may be assigned to dead handlers. -**uWSGI + Webless job handlers is the recommended deployment strategy** for Galaxy servers that run web servers and job handlers **on different hosts**. +This is the recommended deployment strategy for Galaxy servers that run web servers and job handlers **on different +hosts**. -#### Legacy Deployment Options +## Legacy Deployment Options -Certain deployment strategies were commonly used prior to the introduction of new features described above. These are still possible but should no longer be used. +Certain deployment strategies were commonly used prior to the introduction of new features described above. These are +still possible but should no longer be used. -##### uWSGI for web serving with Paste Galaxy applications as job handlers +### uWSGI for web serving with Paste Galaxy applications as job handlers -This is essentially the same as **uWSGI + Webless job handlers** but needlessly starts handlers with a web stack. This was recommended before the Webless method existed +This is essentially the same as **uWSGI + Webless** but needlessly starts handlers with a web stack. This was +recommended before the Webless method existed. -##### Paste for web serving with Paste or Webless job handlers +### Paste for web serving with Paste or Webless job handlers -Unlike uWSGI, Paste cannot start multiple server processes on its own. Prior to uWSGI support, this was the only way to run multiple Galaxy processes, but each web worker and job handler process had to be configured and managed separately. +Unlike uWSGI, Paste cannot start multiple server processes on its own. Prior to uWSGI support, this was the only way to +run multiple Galaxy processes, but each web worker and job handler process had to be configured and managed separately. -##### Paste web serving and job handling in a single process +### Paste web serving and job handling in a single process (default configuration, releases prior to 18.01) -This was the default configuration prior to the 18.01 Galaxy release and offered the simplest out-of-the-box setup at the expense of performance and scalability. +This was the default configuration prior to the 18.01 Galaxy release and offered the simplest out-of-the-box setup at +the expense of performance and scalability. -#### uWSGI +## Configuration -In `galaxy.ini`, define a `[uwsgi]` section: +### uWSGI + +Although this document goes in to significant detail about uWSGI configuration, many more options are available, as well +as additional documentation about options described here. Consult the uWSGI documentation for more: + +* [Configuring uWSGI](https://uwsgi-docs.readthedocs.io/en/latest/Configuration.html) +* [uWSGI Options](https://uwsgi-docs.readthedocs.io/en/latest/Options.html) +* [Quickstart for Python/WSGI applications](https://uwsgi-docs.readthedocs.io/en/latest/WSGIquickstart.html) + +Configuration is performed in the `uwsgi` section of `galaxy.yml`. You will find that the default, if copied from +`galaxy.yml.sample`, is commented out. The default configuration options are provided to uWSGI on the command line by +Galaxy's `run.sh` script. + +Galaxy releases prior to 18.01 (or upgraded-to-18.01+ servers which have not migrated their configuration to the YAML +format) used an INI-format configuration file, `galaxy.ini`. + +Note that uWSGI's YAML parser is hand-coded and not actually conformant to the YAML standard. Specifically: + +* Multiple identical keys with unique values can exist in the same dictionary/hash, as with `hook-master-start` in the + example below. +* Quoting values (with single or double quotes) is unncessary since the parser treats all values as strings. The parser + does not correctly handle these quote characters, resulting in invalid values. + +If using `galaxy.ini`, the option names and values are the same but in INI format, for example: ```ini [uwsgi] -processes = 8 -stats = 127.0.0.1:9191 +processes = 4 socket = 127.0.0.1:4001 -pythonpath = lib -threads = 4 -logto = /path/to/uwsgi.log -master = True +... ``` +#### Configuration common to all uWSGI deployment styles -Port numbers for `stats` and `socket` can be adjusted as desired. Moreover, in the `[app:main]` section, you must set: +In `galaxy.yml`, define a `uwsgi` section. Shown below are the options common to all deployment scenarios: -```ini -static_enabled = False -track_jobs_in_database = True +```yaml +uwsgi: + + # required in order to start the galaxy application + module: galaxy.webapps.galaxy.buildapp:uwsgi_app() + virtualenv: .venv + pythonpath: lib + + # performance options + master: true + enable-threads: true + processes: 2 + threads: 4 + offload-threads: 1 + + # fix up signal handling + die-on-term: true + hook-master-start: unix_signal:2 gracefully_kill_them_all + hook-master-start: unix_signal:5 gracefully_kill_them_all + + # listening options + + # job handling options ``` +Some of these options warrant explanation: -You will also need to have uWSGI installed. There are a variety of ways to do this. It can be installed system-wide by installing from your system's package manager (on Debian and Ubuntu systems, the `uwsgi` and `uwsgi-plugin-python` provide the necessary components), or with the `easy_install` or `pip` commands (which will install it to the system's Python `site-packages` directory). Alternatively, if you are already running Galaxy from a Python virtualenv, you can use `pip install uwsgi` with that virtualenv's copy of `pip` to install to that virtualenv as your unprivileged Galaxy user. +* `master`: Instructs uWSGI to first start a master process manager and then fork web workers, mules, http servers (if + enabled), and any others from the master. This is required for certain operational modes such as daemonization, but + can interfere with the use of `+` to shut down Galaxy when running in the foreground on the command line, and + so is not enabled by default (except when `run.sh --daemon` is used). Its use is strongly recommended for all + production deployments. +* `processes`: Controls the number of Galaxy application processes uWSGI will spawn. Increased web performance can be + attained by increasing this value. +* `threads`: Controls the number of web worker threads each application process will spawn. +* `offload-threads`: uWSGI can use a dedicated threadpool for serving static content and handling internal routing, + setting this value automatically enables such offloading. -Also, make sure you have installed PasteDeploy, you can follow the same ways from above. +Additional options are explained in the [uWSGI Minutiae](#uwsgi-minutiae) below. -The web processes can then be started under uWSGI using: +Note that the performance option values given above are just examples and should be tuned per your specific needs. +However, as given, they are a good place to start. -```console -% cd /path/to/galaxy-dist -% PYTHONPATH=eggs/PasteDeploy-1.5.0-py2.7.egg uwsgi --ini-paste config/galaxy.ini +Due to the Python GIL, increasing the value of `threads` has diminishing returns on web performance while increasing the +memory footprint of each application process. Increasing it is most useful on servers experiencing a high amount of IO +waiting, but the greatest performance gain comes from increasing `processes` as appropriate for the hardware on which +Galaxy is running. + +#### Listening and proxy options + +**With a proxy server:** + +To use the native uWSGI protocol, set the `socket` option: + +```yaml + # listening options + socket: unix:///srv/galaxy/var/uwsgi.sock ``` +Here we've used a UNIX domain socket because there's less overhead than a TCP socket and it can be secured by filesystem +permissions, but you can also listen on a port: -The `--daemonize` option can be used to start in the background. uWSGI has an astounding number of options, see [its documentation](http://uwsgi.readthedocs.org/) for help. - -Once started, a proxy server (typically Apache or nginx) must be configured to proxy requests to uWSGI (using uWSGI's native protocol). Configuration details for these can be found below. - -### Job Handler(s) - -In `galaxy.ini`, define one or more additional `[server:...]` sections: - -```ini -[server:handler0] -use = egg:Paste#http -port = 8090 -host = 127.0.0.1 -use_threadpool = true -threadpool_workers = 5 - -[server:handler1] -use = egg:Paste#http -port = 8091 -host = 127.0.0.1 -use_threadpool = true -threadpool_workers = 5 +```yaml + # listening options + socket: 127.0.0.1:4001 ``` +The choice of port 4001 is arbitrary, but in both cases, the socket location must match whatever socket the proxy server +is configured to communicate with. If using a UNIX domain socket, be sure that the proxy server's user has read/write +permission on the socket (uWSGI's `chmod-socket` option can help here). -Using web processes as handlers is possible, but it is not recommended since handler operations can impact web UI performance. +You can consult the Galaxy documentation for [Apache](special_topics/apache.html) or [nginx](special_topics/nginx.html) +for help with the proxy-side configuration. -### Remaining configuration options +**Without a proxy server** or with a proxy server that does not speak the uWSGI native protocol: -If you do not have a `job_conf.xml` file, you will need to create one. There are samples for a basic configuration and an advanced configuration provided in the distribution. Please note that creating `job_conf.xml` overrides any legacy job running settings in `galaxy.yml`. See the [jobs configuration documentation](jobs.html) for more detail on job configuration. +uWSGI can be configured to serve HTTP and/or HTTPS directly: -In `job_conf.xml`, create `` tags with `id` attributes that match the handler server names you defined in `galaxy.yml`. For example, using the configuration above, the `` section of `job_conf.xml` would look like: +```yaml + # listening options + http: :8080 + https: :8443,server.crt,server.key + static-map: /static/style=static/style/blue + static-map: /static=static +``` + +To bind to ports < 1024 (e.g. if you want to bind to the standard HTTP/HTTPS ports 80/443), you must bind as the `root` +user and drop privileges to the Galaxy user with a configuration such as: + +```yaml + # listening options + shared-socket: :80 + shared-socket: :443,server.crt,server.key + http: =0 + https: =1 + uid: galaxy + gid: galaxy + static-map: /static/style=static/style/blue + static-map: /static=static +``` + +To redirect HTTP traffic to the HTTPS port rather than serving Galaxy over HTTP, change `http: =0` in the above example +to `http-to-https: =0`. + +Because `run.sh` performs setup steps, **it should not be run as `root`**. Instead, you can run uWSGI directly as root +with: + +```sh-session +# cd /srv/galaxy/server +# ./.venv/bin/uwsgi --yaml config/galaxy.yml +``` + +You can run the startup-time setup steps as the galaxy user after upgrading Galaxy with `sh +./scripts/common_startup.sh`. + +#### uWSGI all-in-one job handling + +Ensure that no `` section exists in your `job_conf.xml` (or no `job_conf.xml` exists at all) and start Galaxy +normally. No additional configuration is required. To increase the number of web workers/job handlers, increase the +value of `processes`. + +By default, a job will be handled by the web worker that receives the job setup request (via the UI/API). Jobs can be +explicitly mapped to specific workers as described in the [Job configuration documentation](jobs.html) by using the +handler IDs `main.web.N`, where `N` is the web worker ID, starting at 1 and incrementing for each process defined by the +value of `processes`. Each worker that you wish to explicitly map jobs to should be defined in the `` section +of `job_conf.xml`. *Do not* define a default handler. + +For example, to have the 3rd web worker handle the `test1` tool, you would set the following in `job_conf.xml` +(irrelevant options are not shown): ```xml - - - - + + + + + + + + ``` +#### uWSGI + Mule job handling -Any tool not set to an explicit job destination will then be serviced by one of the handlers with the `handlers` tag. It is possible to dedicate handlers to specific destinations or tools. For details on how to do this, please see the [job configuration documentation](jobs.html). +Ensure that no `` section exists in your `job_conf.xml` (or no `job_conf.xml` exists at all) and add the +following to the `uwsgi` section of `galaxy.yml` to start a single job handler mule: + +```yaml + # job handling options + mule: lib/galaxy/main.py + farm: job-handlers:1 +``` + +Then start Galaxy normally. To add additional mule handlers, add additional `mule` options and add their ID(s), comma +separated, to the `job-handlers` farm. For example, 3 handlers are defined like so: + +```yaml + # job handling options + mule: lib/galaxy/main.py + mule: lib/galaxy/main.py + mule: lib/galaxy/main.py + farm: job-handlers:1,2,3 +``` + +By default, a job will be handled by whatever mule currently has the lock on the mule message queue. After receiving a +message, it will release the lock, giving other mules a chance to handle future jobs. Jobs can be explicitly mapped to +specific mules as described in the [Job configuration documentation](jobs.html) by using the handler IDs +`main.job-handlers.N`, where `N` is the mule's position in the farm, starting at 1 and incrementing for each mule in the +farm (this is not necessarily the mule ID, but it will be if you only define one farm and you add mules to that farm in +sequential order). Each worker that you wish to explicitly map jobs to should be defined in the `` section +of `job_conf.xml`. *Do not* define a default handler. + +For example, to have the 2nd mule in the three-mule job-handlers farm shown above handle the `test1` tool, you would set +the following in `job_conf.xml` (irrelevant options are not shown): + +```xml + + + + + + + + +``` + +#### uWSGI + Webless job handling + +Define a `` section in `job_conf.xml` defining the webless handlers you plan to start. In this case, unlike +the uWSGI job handling strategies, you will need to define a default: + +```xml + + + + + + + + + + +``` + +The definition of a default handler prevents uWSGI web workers from starting the Galaxy job handling code. `run.sh` will +start the uWSGI process(es), but you will need to start the webless handler processes yourself. This is done on the +command line like so: + +```sh-session +$ cd /srv/galaxy/server +$ ./scripts/galaxy-main -c config/galaxy.yml --server-name handler0 --daemonize +$ ./scripts/galaxy-main -c config/galaxy.yml --server-name handler1 --daemonize +$ ./scripts/galaxy-main -c config/galaxy.yml --server-name handler2 --daemonize +``` + +However, a better option to managing processes by hand is to use a process manager as documented in the [Starting and +Stopping](#starting-and-stopping) section. + +#### uWSGI Minutiea + +**Threads** + +Although `enable-threads` was explicitly set in our example, in reality, as long as any value is set for the `threads` +option, `enable-threads` is set implicitly. This option enables the Python GIL and application threads (threads started +by Galaxy itself for various non-web tasks), which Galaxy uses extensively. Setting it explicitly, however, is harmless +and can prevent strange difficult-to-debug situations if `threads` is accidentally unset. + +**Signals** + +The signal handling options (`die-on-term` and `hook-master-start` with `unix_signal` values) are not required but, if +set, will override [uWSGI's unconventional signal handling](https://uwsgi-docs.readthedocs.io/en/latest/Management.html) +and cause `SIGTERM` to kill the server rather than restart it, and the uWSGI master process to gracefully shut down its +web workers and job handler mules (i.e. the various Galaxy application processes) when it receives a `SIGINT` (signal 2) +or `SIGTERM` (signal 15) signal (e.g. from `kill(1)` or `+`). When shutting down gracefully, uWSGI will wait 60 +seconds (by default, but this can be changed with the `reload-mercy`, `worker-reload-mercy` and `mule-reload-mercy` +options) for child processes to die before forcefully killing them with `SIGKILL` (signal 9). Alternatively, you may +prefer to have it shut down gracefully on `SIGTERM` but forcefully on `SIGINT` (forceful shutdown by uWSGI is still +slightly cleaner than `kill -9` of the master process since it can attempt to release sockets cleanly) or vice-versa, +which you can do by setting one of the signals to call `kill_them_all` rather than `gracefully_kill_them_all`: + +```yaml + # fix up signal handling + die-on-term: true + hook-master-start: unix_signal:2 kill_them_all + hook-master-start: unix_signal:15 gracefully_kill_them_all +``` + +More details on the `unix_signal` hook can be found in [uWSGI Issue #849](https://github.com/unbit/uwsgi/issues/849). + +**Logging and daemonization** + +It's possible to configure uWSGI to log to a file with the `logto` or `logto2` options (when running in the foreground, +the default), but more advanced logging options that split log files for each process are possible and described in the +Galaxy [Logging Configuration documentation](config_logging.html) + +When running as a daemon with `run.sh --daemon`, output is logged to `galaxy.log` and the pid is written to +`galaxy.pid`. These can be controlled with the `daemonize` and `pidfile` arguments (their `daemonize2` and `pidfile2` +counterparts wait until after the application successfully loads to open and write the files). If you set a `daemonize*` +option, you should not use the `--daemon` argument to `run.sh` (or not use `run.sh` at all, and start Galaxy directly +with `uwsgi` on the command line). + +**External uwsgi binary:** + +It is still possible to run Galaxy using an external copy of uWSGI (for example, installed from APT under +Debian/Ubuntu). This was the recommended installation method in the past. To use an external uWSGI, you'll need simply +need to start with uWSGI directly, rather than using the `run.sh` script. Once you have configured Galaxy/uWSGI, you can +start it with: + +```sh-session +$ cd /srv/galaxy/server +$ uwsgi --yaml config/galaxy.yml +``` + +When installing uWSGI, be sure to install the Python plugin, as this is not always contained in the same package (such +as when installing from APT under Debian/Ubuntu). With the APT packages, you will also need to add `--plugin python` to +the command line (or `plugin: python` to the `uwsgi` section of `galaxy.yml`). + +**Other options** + +The `py-call-osafterfork` option may only be needed when mule messaging is in use, but it [seems to have no negative +effect](https://github.com/unbit/uwsgi/issues/643) and may solve other situations with starting a complex threaded +Python application. + +The `chdir` option is useful if you are not using `run.sh`, to be able to call `uwsgi` from anywhere without having to +`cd` to the Galaxy directory first. ## Starting and Stopping -Since you need to run multiple processes, the typical `run.sh` method for starting and stopping Galaxy won't work. The current recommended way to manage these multiple processes is with [Supervisord](http://supervisord.org/). You can use a supervisord config file like the following or be inspired by [this example](https://github.com/galaxyproject/galaxy/blob/dev/contrib/galaxy_supervisor.conf). Be sure to `supervisord restart` or `supervisord reread && supervisord update` whenever you make configuration changes. +If you are using the **uWSGI + Webless job handlers** deployment strategy or want to run your Galaxy server as a +persistent service, you can control it through a process manager. The current recommended process manager is +[Supervisord](http://supervisord.org/). If you are comfortable with systemd and are running a relatively modern Linux +distribution, you can also configure Galaxy as a service directly in systemd. + +### Supervisord + +You can use a supervisord config file like the following or be inspired by [this +example](https://github.com/galaxyproject/galaxy/blob/dev/contrib/galaxy_supervisor.conf). Be sure to `supervisord +update` or `supervisord reread && supervisord restart` whenever you make configuration changes. ```ini -[program:galaxy_uwsgi] -command = /usr/bin/uwsgi --plugin python --ini-paste /path/to/galaxy/config/galaxy.ini -directory = /path/to/galaxy +[program:web] +command = /srv/galaxy/venv/bin/uwsgi --yaml /srv/galaxy/config/galaxy.yml +directory = /srv/galaxy/server umask = 022 autostart = true autorestart = true startsecs = 10 -user = gxprod -environment = PATH=/path/to/galaxy/venv:/usr/local/sbin:/usr/local/bin:/usr/sbin:/usr/bin:/sbin:/bin,PYTHON_EGG_CACHE=/path/to/galaxy/.python-eggs,PYTHONPATH=/path/to/galaxy/eggs/PasteDeploy-1.5.0-py2.7.egg +user = galaxy numprocs = 1 stopsignal = INT ``` +This configuration defines a "program" named `web` which represents our Galaxy uWSGI frontend. You'll notice that we've +set a command, a directory, a umask, all of which you should be familiar with. Additionally we've specified that the +process should `autostart` on boot, and `autorestart` if it ever crashes. We specify `startsecs` to say "the process +must stay up for this long before we consider it OK. If the process crashes sooner than that (e.g. bad changes you've +made to your local installation) supervisord will try again a couple of times to restart the process before giving up +and marking it as failed. This is one of the many ways supervisord is much friendly for managing these sorts of tasks. -This configuration defines a "program" named "galaxy_uwsgi" which represents our galaxy uWSGI frontend. You'll notice that we've set a command, a directory, a umask, all of which you should be familiar with. Additionally we've specified that the process should **autostart** on boot, and **autorestart** if it ever crashes. We specify **startsecs** to say "the process must stay up for this long before we consider it OK. If the process crashes sooner than that (e.g. bad changes you've made to your local installation) supervisord will try again a couple of times to restart the process before giving up and marking it as failed. This is one of the many ways supervisord is much friendly for managing these sorts of tasks. - -Next, we set up our job handlers: +If using the **uWSGI + Webless** scenario, you'll need to addtionally define job handlers to start: ```ini [program:handler] -command = /path/to/galaxy/venv/bin/python ./scripts/paster.py serve config/galaxy.ini --server-name=handler%(process_num)s --pid-file=/path/to/galaxy/handler%(process_num)s.pid --log-file=/path/to/galaxy/handler%(process_num)s.log -directory = /path/to/galaxy +command = python ./scripts/galaxy-main -c /srv/galaxy/config/galaxy.yml --server-name=handler%(process_num)s --pid-file=/srv/galaxy/var/handler%(process_num)s.pid --log-file=/srv/galaxy/log/handler%(process_num)s.log +directory = /srv/galaxy/server process_name = handler%(process_num)s -numprocs = 2 +numprocs = 3 umask = 022 autostart = true autorestart = true startsecs = 15 -user = gxprod -environment = PYTHON_EGG_CACHE=/path/to/galaxy/.python-eggs,SGE_ROOT=/var/lib/gridengine +user = galaxy ``` +This is similar to the "web" definition above, however, you'll notice that we use `%(process_num)s`. That's a variable +substitution in the `command` and `process_name` fields. We've set `numprocs = 3`, which says to launch three handler +processes. Supervisord will loop over `0..numprocs` and launch `handler0`, `handler1`, and `handler2` processes +automatically for us, templating out the command string so each handler receives a different log file and name. -Nearly all of this is the same as above, however, you'll notice that we use `$(process_num)s`. That's a variable substitution in the command and process_name fields. We've set **numproces=2** which says to launch two handler processes. Supervisord will launch loop over `0..numprocs` and launch a `handler0` and `handler1` process automatically for us, templating out the command string so each handler receives a different log file and name. - -Lastly, we collect the two tasks above into a single group: +Lastly, collect the tasks defined above into a single group. If you are not using webless handlers this is as simple as: ```ini [group:galaxy] -programs = handler, galaxy_uwsgi +programs = web ``` +With webless handlers, it is: + +```ini +[group:galaxy] +programs = web, handler +``` This will let us manage these tasks more globally with the `supervisorctl` command line tool: @@ -209,123 +532,38 @@ This will let us manage these tasks more globally with the `supervisorctl` comma # supervisorctl status galaxy:handler0 RUNNING pid 7275, uptime 16:32:17 galaxy:handler1 RUNNING pid 7276, uptime 16:32:17 -galaxy:uwsgi RUNNING pid 7299, uptime 16:32:16 +galaxy:handler2 RUNNING pid 7277, uptime 16:32:17 +galaxy:web RUNNING pid 7299, uptime 16:32:16 ``` - -This command shows us the status of our jobs, and we can easily restart all of the processes at once by naming the group. Familiar commands like start and stop are also available. +This command shows us the status of our jobs, and we can easily restart all of the processes at once by naming the +group. Familiar commands like start and stop are also available. ```console # supervisorctl restart galaxy: galaxy:handler0: stopped galaxy:handler1: stopped -galaxy:uwsgi: stopped -galaxy:uwsgi: started +galaxy:handler2: stopped +galaxy:web: stopped +galaxy:web: started galaxy:handler0: started galaxy:handler1: started +galaxy:handler2: started ``` -### Transparent restart - Zerg Mode +### Systemd + +TODO: write this section. + +### Transparent Restart - Zerg Mode The standard uWSGI operation mode allows you to restart the Galaxy application while blocking client connections. Zerg Mode does away with the waiting by running a special Zerg Pool process, and connecting Zergling workers (aka Galaxy application processes) to the pool. As long as at least one is connected, requests can be served. See the [GCC2017 Admin Training session](https://github.com/galaxyproject/dagobah-training/blob/2017-montpellier/sessions/10-uwsgi/ex2-zerg-mode.md) on how to set this up. -## Proxy Server +## Notes on Legacy Configurations -If using only one web process, you can proxy as per the normal instructions for a [production configuration page](production.html). Otherwise, you'll need to set up load balancing. - -If you have specified a separate job runner and you want to use the "Manage jobs" interface as administrator you also have to define a proxy for the job runner as shown [below](#manage-jobs). - -### Apache - -Be sure to consult the [Apache proxy documentation](special_topics/apache.html) for additional features such as proxying static content and accelerated downloads. - -#### Standalone Paste-based processes - -To balance on Apache, you'll need to enable `mod_proxy_balancer` in addition to `mod_proxy`, which is available in Apache 2.2 (but not older versions such as 1.3 or 2.0). Add the following to your Apache configuration to set up balancing for the two example web servers defined above: - -```apache - - BalancerMember http://localhost:8080 - BalancerMember http://localhost:8081 - -``` - - -And replace the following line from the [regular proxy configuration](special_topics/apache.html): - -```apache -RewriteRule ^(.*) http://localhost:8080$1 [P] -``` - - -With: - -```apache -RewriteRule ^(.*) balancer://galaxy$1 [P] -``` - - -#### uWSGI - -mod_uwsgi is available in apache2.4 and later. This means you *must* be on Ubuntu 14.04 or later. There are ways to do this on older systems, which is outside the scope of this documentation. You'll need to enable `mod_uwsgi`, and then add the following to your Apache configuration: - -```apache - -Sethandler uwsgi-handler -uWSGISocket 127.0.0.1:4001 -uWSGImaxVars 512 - -``` - - -### nginx - -Be sure to consult the [nginx proxy documentation](special_topics/nginx.html) for additional features such as proxying static content and accelerated downloads. - -#### Standalone Paste-based processes - -To proxy with nginx, you'll simply need to add all of the web applications to the `upstream` section, [which already exists](special_topics/nginx.html). The relevant parts of the configuration would look like this: - -```nginx -http { - upstream galaxy_app { - server localhost:8080; - server localhost:8081; - } - server { - location / { - proxy_pass http://galaxy_app; - proxy_set_header X-Forwarded-Host $host; - proxy_set_header X-Forwarded-For $proxy_add_x_forwarded_for; - } - } -} -``` - - -#### uWSGI - -uWSGI support is built in to nginx, so no extra modules or recompiling should be required. To proxy to Galaxy, use the following configuration: - -```nginx -uwsgi_read_timeout 180; - -location / { - uwsgi_pass 127.0.0.1:4001; - uwsgi_param UWSGI_SCHEME $scheme; - include uwsgi_params; -} -``` - - -`uwsgi_read_timeout` can be adjusted as appropriate for your site. This is the amount of time connections will block between while nginx waits for a response from uWSGI and is useful for holding client (browser) connections while uWSGI is restarting Galaxy subprocesses. - -## Notes on legacy configurations - -Previously it was necessary to create two separate Galaxy config files to use multiple processes. This is no longer necessary, and if you have multiple config files in your existing installation, it is suggested that you merge them in to a single file. - -Galaxy previously used a single "job manager" process to assign jobs to handlers. This is no longer necessary as handlers are selected by the web processes at the time of job creation. - -The `track_jobs_in_database` option in `galaxy.ini` can still be set but should be unnecessary. If there are more than one `[server:...]` sections in the file, database job tracking will be enabled automatically. +The `track_jobs_in_database` option in the Galaxy config file can still be set, but doing so is unnecessary as it now +defaults to "enabled" under all scenarios. Galaxy's in-memory job tracking can still be used when using the **uWSGI +all-in-one** deployment strategy by setting the option to `false`. In-memory tracking can be slightly more responsive +and thus can be useful in development, but should not be used in production. From a5cef0fe681552df6876ef88bdc46ce0b7e36e6a Mon Sep 17 00:00:00 2001 From: Dannon Baker Date: Wed, 10 Jan 2018 12:04:32 -0500 Subject: [PATCH 062/112] Fixes the --no-client-build startup option (and renames it --skip-client-build, too) --- scripts/common_startup.sh | 4 ++-- scripts/common_startup_functions.sh | 2 +- 2 files changed, 3 insertions(+), 3 deletions(-) diff --git a/scripts/common_startup.sh b/scripts/common_startup.sh index 25a3d59fe98..b635b5beb72 100755 --- a/scripts/common_startup.sh +++ b/scripts/common_startup.sh @@ -29,7 +29,7 @@ for arg in "$@"; do [ "$arg" = "--replace-pip" ] && REPLACE_PIP=1 [ "$arg" = "--stop-daemon" ] && FETCH_WHEELS=0 [ "$arg" = "--skip-samples" ] && COPY_SAMPLE_FILES=0 - [ "$arg" = "--no-client-build" ] && SKIP_CLIENT_BUILD=1 + [ "$arg" = "--skip-client-build" ] && SKIP_CLIENT_BUILD=1 done SAMPLES=" @@ -83,7 +83,7 @@ if [ $SKIP_CLIENT_BUILD -eq 0 ]; then fi if [ $SKIP_CLIENT_BUILD -eq 0 ]; then echo "The Galaxy client build is out of date. Please run 'make client' or your choice of client build target (client-*)." - echo "If you're sure you'd like to skip this check, you can run galaxy with the --no-client-build flag, though this is not recommended as the client and server code will potentially be out of sync." + echo "If you're sure you'd like to skip this check, you can run galaxy with the --skip-client-build flag, though this is not recommended as the client and server code will potentially be out of sync." echo "See ./client/README.md in the Galaxy repository for more information, including how to get help if you're having trouble." exit 1 fi diff --git a/scripts/common_startup_functions.sh b/scripts/common_startup_functions.sh index 6acdf5bead4..72f02a1d5d1 100644 --- a/scripts/common_startup_functions.sh +++ b/scripts/common_startup_functions.sh @@ -6,7 +6,7 @@ parse_common_args() { while : do case "$1" in - --skip-eggs|--skip-wheels|--skip-samples|--dev-wheels|--no-create-venv|--no-replace-pip|--replace-pip) + --skip-eggs|--skip-wheels|--skip-samples|--dev-wheels|--no-create-venv|--no-replace-pip|--replace-pip|--skip-client-build) common_startup_args="$common_startup_args $1" shift ;; From 18b3599207b12ff3019d7d1032101b6bdb99eb75 Mon Sep 17 00:00:00 2001 From: Nate Coraor Date: Wed, 10 Jan 2018 16:20:11 -0500 Subject: [PATCH 063/112] Remove emperor mode reference --- doc/source/admin/scaling.md | 3 --- 1 file changed, 3 deletions(-) diff --git a/doc/source/admin/scaling.md b/doc/source/admin/scaling.md index 40f1b4e632c..1bec027128b 100644 --- a/doc/source/admin/scaling.md +++ b/doc/source/admin/scaling.md @@ -23,15 +23,12 @@ Just to be clear: increasing the values of `threadpool_workers` in `galaxy.yml` and receive messages from uWSGI web workers * **[Zerg Mode][uwsgi-zerg-mode]** - uWSGI configuration where multiple copies of the same application can be started simultaneously in order to maintain availability during application restarts - * **[Emperor Mode][uwsgi-emperor-mode]** - uWSGI configuration where multiple distinct applications can be started by - a single master uWSGI process * **Webless Galaxy application** - The Galaxy application run as a standalone Python application with no web/WSGI server * **[Paste][paste]** - Application server written in pure Python that implements the HTTP and Python WSGI protocols [uwsgi]: http://uwsgi-docs.readthedocs.io/ [uwsgi-mules]: http://uwsgi-docs.readthedocs.io/en/latest/Mules.html [uwsgi-zerg-mode]: http://uwsgi-docs.readthedocs.io/en/latest/Zerg.html -[uwsgi-emperor-mode]: http://uwsgi-docs.readthedocs.io/en/latest/Emperor.html [paste]: http://paste.readthedocs.io/ ## Application Servers From daa7845580c08f7ded43af2aa1ff183fc95c5a05 Mon Sep 17 00:00:00 2001 From: Nate Coraor Date: Wed, 10 Jan 2018 16:21:03 -0500 Subject: [PATCH 064/112] Add docstring to LOGGING_CONFIG_DEFAULT so that it is part of the autodoc generated docs, so that it can be linked from statically written docs. --- lib/galaxy/config.py | 1 + 1 file changed, 1 insertion(+) diff --git a/lib/galaxy/config.py b/lib/galaxy/config.py index 66a9008e3d4..556ab229b3a 100644 --- a/lib/galaxy/config.py +++ b/lib/galaxy/config.py @@ -120,6 +120,7 @@ LOGGING_CONFIG_DEFAULT = { }, }, } +"""Default value for logging configuration, passed to :func:`logging.config.dictConfig`""" def resolve_path(path, root): From 9204916ac8ffbfb5dad3734275fa3d4843300d20 Mon Sep 17 00:00:00 2001 From: Nate Coraor Date: Wed, 10 Jan 2018 16:23:54 -0500 Subject: [PATCH 065/112] Galaxy config doc corrections --- doc/source/admin/config.rst | 14 +++++++------- 1 file changed, 7 insertions(+), 7 deletions(-) diff --git a/doc/source/admin/config.rst b/doc/source/admin/config.rst index 3ff53213b84..8df4fa2c4a8 100644 --- a/doc/source/admin/config.rst +++ b/doc/source/admin/config.rst @@ -84,7 +84,7 @@ Additional configuration files and their purposes are: interface when searching for new tools. - ``workflow_schedulers_conf.xml``: Similar to the job configuration, controls the scheduling of workflows as jobs. -.. _standardize and unify configuration formats: https://github.com/galaxyproject/galaxy/issues/... +.. _standardize and unify configuration formats: https://github.com/galaxyproject/galaxy/issues/5148 .. _Installing Tools into Galaxy: https://galaxyproject.org/admin/tools/add-tool-from-toolshed-tutorial/ .. _Datatypes documentation: https://galaxyproject.org/learn/datatypes/ .. _Cluster documentation: https://galaxyproject.org/admin/config/performance/cluster/ @@ -107,14 +107,14 @@ Configuration Basics - uWSGI has a `large number of options`_. The Galaxy documentation refers to some of them, but many additional advanced deployment scenarios are available. -- Run Galaxy in a uWSGI server with ``GALAXY_UWSGI=1 sh run.sh`` +- Run Galaxy with ``sh run.sh`` - Use a web browser and go to the address you configured in ``galaxy.yml`` (defaults to http://localhost:8080/) .. _uWSGI YAML configuration file: http://uwsgi-docs.readthedocs.io/en/latest/Configuration.html .. _large number of options: http://uwsgi-docs.readthedocs.io/en/latest/Options.html -.. ---------------------------- -.. Configuration Options -.. ---------------------------- -.. -.. .. include:: galaxy_options.rst +---------------------------- +Configuration Options +---------------------------- + +.. include:: galaxy_options.rst From e0891cac355d062711b645e5e4859cddd6f14cdd Mon Sep 17 00:00:00 2001 From: Nate Coraor Date: Wed, 10 Jan 2018 16:25:26 -0500 Subject: [PATCH 066/112] Add intersphinx mapping to the Python 2.7 documentation --- doc/source/conf.py | 4 +++- 1 file changed, 3 insertions(+), 1 deletion(-) diff --git a/doc/source/conf.py b/doc/source/conf.py index 180e84fa323..01abfbbebd4 100644 --- a/doc/source/conf.py +++ b/doc/source/conf.py @@ -46,7 +46,7 @@ sys.path.insert(1, os.path.abspath(os.path.join(os.path.dirname(__file__), os.pa # Add any Sphinx extension module names here, as strings. They can be extensions # coming with Sphinx (named 'sphinx.ext.*') or your custom ones. -extensions = ['sphinx.ext.autodoc'] +extensions = ['sphinx.ext.autodoc', 'sphinx.ext.intersphinx'] if not SKIP_SOURCE: extensions += ['sphinx.ext.doctest', 'sphinx.ext.todo', 'sphinx.ext.coverage', 'sphinx.ext.viewcode'] @@ -132,6 +132,8 @@ pygments_style = 'sphinx' # A list of ignored prefixes for module index sorting. #modindex_common_prefix = [] +# Intersphinx mapping to Python 2.7 documentation +intersphinx_mapping = {'python': ('https://docs.python.org/2.7', None)} # -- Options for HTML output --------------------------------------------------- From db00f97175c2870300617a8de8a5adac16e7b0d5 Mon Sep 17 00:00:00 2001 From: Nate Coraor Date: Wed, 10 Jan 2018 16:26:09 -0500 Subject: [PATCH 067/112] Finish Galaxy logging configuration documentation --- .gitignore | 1 + doc/Makefile | 8 +- doc/source/admin/config_logging.rst | 228 +++++++++++++++++++++------- 3 files changed, 177 insertions(+), 60 deletions(-) diff --git a/.gitignore b/.gitignore index 439dad9bc09..fb52c848587 100644 --- a/.gitignore +++ b/.gitignore @@ -132,6 +132,7 @@ client/galaxy/scripts/libs/* # Documentation build files. doc/build doc/schema.md +doc/source/admin/config_logging_default_yaml.rst doc/source/dev/schema.rst # Misc diff --git a/doc/Makefile b/doc/Makefile index 5334cba15b0..8675ed8f41e 100644 --- a/doc/Makefile +++ b/doc/Makefile @@ -15,7 +15,7 @@ ALLSPHINXOPTS = -d $(BUILDDIR)/doctrees $(PAPEROPT_$(PAPER)) $(SPHINXOPTS) sou # the i18n builder cannot share the environment and doctrees with the others I18NSPHINXOPTS = $(PAPEROPT_$(PAPER)) $(SPHINXOPTS) source -GENERATED_RST = source/api/api.rst source/api/ts_api.rst source/dev/schema.rst +GENERATED_RST = source/api/api.rst source/api/ts_api.rst source/dev/schema.rst source/admin/config_logging_default_yaml.rst .PHONY: help clean html dirhtml singlehtml pickle json htmlhelp qthelp devhelp epub latex latexpdf text man changes linkcheck doctest gettext updaterst @@ -61,6 +61,12 @@ source/dev/schema.rst: schema.md ## Convert Galaxy Tool XSD Markdown docs into r pandoc schema.md -f markdown_github-hard_line_breaks -s -o $@ ./fix_schema_rst.sh $@ +source/admin/config_logging_default_yaml.rst: ../lib/galaxy/config.py + printf '.. code-block:: yaml\n\n' > $@ + printf ' galaxy:\n' >> $@ + printf ' logging:\n ' >> $@ + PYTHONPATH=../lib ../.venv/bin/python -c 'import yaml, galaxy.config; print "\n ".join(yaml.dump(galaxy.config.LOGGING_CONFIG_DEFAULT, indent=4, default_flow_style=False).splitlines())' >> $@ + # might also want to do # cd source/lib; hg revert; rm *.rst.orig; or not. clean: diff --git a/doc/source/admin/config_logging.rst b/doc/source/admin/config_logging.rst index 43da5f85f98..dea55bf0cf0 100644 --- a/doc/source/admin/config_logging.rst +++ b/doc/source/admin/config_logging.rst @@ -4,96 +4,206 @@ Logging Configuration Overview ---------------------------- -Logging in Galaxy is performed through the Python `logging`_ module. Traditionally, and on Galaxy releases prior to -18.01, customization of the logging could be performed in two ways: +There are two ways in which you can configure logging for Galaxy servers: 1. Basic/automatic configuration with control over log level and log destination (standard output or a named log file). -2. More complex configuration using `logging.config.fileConfig`_. +2. More complex configuration using the Python :mod:`logging` module's :func:`logging.config.dictConfig` or :func:`logging.config.fileConfig`. -Starting with release 18.01, it's possible to use the more featureful `logging.config.dictConfig`_ format, with a few -Galaxy-specific extensions described below. +By default, Galaxy logs all messages to standard output at the ``DEBUG`` logging level, unless the ``--daemon`` argument +is passed to ``run.sh``, in which case, output is logged to the file ``galaxy.log`` in the current directory. -By default, Galaxy logs all messages to standard output at the ``DEBUG`` logging level. +The way in which you configure logging depends on whether you are using a YAML or INI configuration file, and also on +whether you are using the uWSGI application server, or Python Paste. Galaxy servers that were created starting with +Galaxy Release 18.01 or later use a YAML configuration file with uWSGI. Galaxy servers that were created with 17.09 or +older use an INI configuration file, and Python Paste by default, but they could be configured to run under uWSGI (and +this was the recommendation for production servers). If you upgrade a pre-18.01 server running under Paste to 18.01 or +later but do not convert your INI config (``galaxy.ini``) to a YAML config (``galaxy.yml``), the INI config and Paste +will still be used. -.. .. The way in which logging is configured depends on whether you are using Python Paste or uWSGI. See :ref:`Application -.. .. Server ` for help figuring out what you're using. If using uWSGI, it also depends on whether you are -.. .. using an INI or YAML configuration file. - -The way in which logging is configured depends on whether you are using an YAML or INI configuration file. Galaxy -servers that were created starting with Galaxy Release 18.01 or later use a YAML configuration file. Galaxy servers that -were created with 17.09 or older use an INI configuration file. If you upgrade a pre-18.01 server to 18.01 or later but -do not convert your INI config (``galaxy.ini``) to a YAML config (``galaxy.yml``), the INI config will still be used. +uWSGI, Paste, and related terminology are explained in detail in the :doc:`Scaling and Load Balancing ` +documentation. Basic Configuration ---------------------------- -YAML -~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +Basic logging configuration can be used to modify the level of log messages and the file to which Galaxy logs. The level +is controlled by the ``log_level`` configuration option. + +If not set, Galaxy logs all messages at the ``DEBUG`` level (versions prior to 18.01 defaulted to ``INFO`` if unset, but +the default config file shipped with ``log_level`` explicitly set to ``DEBUG`` for development purposes). + +Galaxy logs all messages to standard output by default if running in the foreground. If running in the background (``sh +run.sh --daemon``) under uWSGI, the log is written to ``galaxy.log`` in the current directory. If running in the +background under Paste, the log is written to ``paster.log``. **Setting the log level:** -```yaml -galaxy: - log_level: LEVEL -``` +In ``galaxy.yml``, set ``log_level``: -Where ``LEVEL`` is one of the `logging levels`_ documented in the `logging`_ module. +.. code-block:: yaml + + galaxy: + log_level: LEVEL + + +Or if using ``galaxy.ini``: + +.. code-block:: ini + + [app:main] + log_level = LEVEL + + +Where ``LEVEL`` is one of the `logging levels`_ documented in the :mod:`logging` module. **Logging to a file:** -When using ``run.sh --daemon``, the log is written to ``galaxy.log`` in the current directory. To change this: +To change the log file name or location, use the ``$GALAXY_LOG`` environment variable like so: -INI -~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +.. code-block:: shell-session -Setting the log level: + $ GALAXY_LOG=/path/to/galaxy/logfile sh run.sh --daemon -```ini -[app:main] -log_level = LEVEL -``` - -**Logging to a file:** - -Where ``LEVEL`` is one of the `logging levels`_ documented in the `logging`_ module. - -When using ``run.sh --daemon``, the log is written to ``paster.log`` in the current directory. To change this: - Advanced Configuration ---------------------------- +With the improved uWSGI support added in Galaxy release 18.01, additional fields identifying the uWSGI worker ID and +mule ID can be added to log messages. These are implemented as the custom Python logging filter +:class:`galaxy.web.stack.UWSGILogFilter` which provides two new Python :class:`logging.LogRecord` attributes: +``%(worker_id)s`` and ``%(mule_id)s``. These aid in identifying which log messages are being emitted by which process +and are used in the default message format when running under uWSGI, but are available to you if you wish to change the +message format. The default message format under uWSGI can be found in +:data:`galaxy.web.stack.UWSGIApplicationStack.log_format`. + +Additionally, because uWSGI can start multiple distinct Galaxy processes (e.g. job handler mules) from a single config +file, by default it would not be possible to log each process to a separate file, meaning that the combined log file +could be quite verbose. In order to alleviate this, a ``filename_template`` attribute has been added to +:class:`logging.FileHandler` (or derivative classes) definitions so that multiple file logging is possible. + +If you are still using Paste or an INI configuration file, it is still possible to use :func:`logging.config.fileConfig` +logging, but ``filename_template`` is not available in this scenario. + YAML ~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +The full syntax of Python's :func:`logging.config.dictConfig` is available under the ``logging`` key in the ``galaxy`` +section of ``galaxy.yml``. The default as of this release can be found in the +:data:`galaxy.config.LOGGING_CONFIG_DEFAULT` constant and has been converted to YAML format here: + +.. include:: config_logging_default_yaml.rst + +Using ``run.sh --daemon`` causes Galaxy to log to ``galaxy.log``, but this is done using uWSGI's logging functionality +and does not allow for splitting logging in to multiple files. The following logging definition will cause the creation +of log files ``galaxy_web_0.log`` (the combined messages of all web workers) and ``galaxy_job-handlers_N.log`` where +``N`` is the instance ID of the server process in its pool (aka the mule's position in its farm argument): + +.. code-block:: yaml + + galaxy: + logging: + filters: + stack: + (): galaxy.web.stack.application_stack_log_filter + formatters: + stack: + (): galaxy.web.stack.application_stack_log_formatter + handlers: + console: + class: logging.StreamHandler + level: DEBUG + formatter: generic + stream: ext://sys.stderr + files: + class: logging.FileHandler + level: DEBUG + formatter: generic + filename: galaxy_default.log + filename_template: galaxy_{pool_name}_{server_id}.log + loggers: + galaxy: + handlers: + - console + - files + level: DEBUG + propagate: 0 + qualname: galaxy + paste.httpserver.ThreadPool: + level: WARN + qualname: paste.httpserver.ThreadPool + routes.middleware: + level: WARN + qualname: routes.middleware + root: + handlers: + - console + - files + level: INFO + version: 1 + + +The list of available template facts for all Galaxy application server types, and their values under the various +possible :doc:`server deployment scenarios ` are given below: + ++-------------------+-----------------------------------------------------------------------------------------------+ +| Fact | Application server | ++-------------------+-------------------------------+-------------------------------+-------------------------------+ +| | Paste/webless | uWSGI web worker | uWSGI mule | ++===================+===============================+===============================+===============================+ +| ``server_name`` | ``NAME`` for | ``main``, but can be modified with ``server_name`` in | +| | ``[server:]`` in | ``galaxy.yml`` | +| | ``galaxy.ini`` | | ++-------------------+-------------------------------+-------------------------------+-------------------------------+ +| ``server_id`` | ``None`` | 1-based worker ID | 1-based mule ID | ++-------------------+-------------------------------+-------------------------------+-------------------------------+ +| ``pool_name`` | ``None`` | ``web`` | Mule's farm name | ++-------------------+-------------------------------+-------------------------------+-------------------------------+ +| ``instance_id`` | ``None`` | Same as ``server_id`` | Mule's 1-based position in | +| | | | its defined farm | ++-------------------+-------------------------------+-------------------------------+-------------------------------+ +| ``fqdn`` | Fully-qualified domain name of the host on which Galaxy is running | ++-------------------+-----------------------------------------------------------------------------------------------+ +| ``hostname`` | "Short" hostname (with domain portion stripped) of the host on which Galaxy is running | ++-------------------+-----------------------------------------------------------------------------------------------+ + INI ~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +With an INI galaxy configuration, it is possible to use Python's :func:`logging.config.fileConfig` configuration method for +advanced logging configuration. For example: + +.. code-block:: ini + + [loggers] + keys = root, galaxy + + [handlers] + keys = console + + [formatters] + keys = generic + + [logger_root] + level = INFO + handlers = console + + [logger_galaxy] + level = DEBUG + handlers = console + qualname = galaxy + propagate = 0 + + [handler_console] + class = StreamHandler + args = (sys.stderr,) + level = DEBUG + formatter = generic + + [formatter_generic] + format = %(name)s %(levelname)-5.5s %(asctime)s [p:%(process)s,w:%(worker_id)s,m:%(mule_id)s] [%(threadName)s] %(message)s +However, the ``filename_template`` Galaxy extension is not available with this method. - - - -On Galaxy servers older than 18.01, or newer servers still running under Paste (see :ref:`Application Server - Date: Wed, 10 Jan 2018 16:27:22 -0500 Subject: [PATCH 068/112] Add missing generated docs to .gitignore --- .gitignore | 2 ++ 1 file changed, 2 insertions(+) diff --git a/.gitignore b/.gitignore index fb52c848587..7f619d96efc 100644 --- a/.gitignore +++ b/.gitignore @@ -133,6 +133,8 @@ client/galaxy/scripts/libs/* doc/build doc/schema.md doc/source/admin/config_logging_default_yaml.rst +doc/source/api/api.rst +doc/source/api/ts_api.rst doc/source/dev/schema.rst # Misc From 1e275e84f8d1ce2d1afb5974d62d988ccc0e2bfe Mon Sep 17 00:00:00 2001 From: Nate Coraor Date: Wed, 10 Jan 2018 16:28:00 -0500 Subject: [PATCH 069/112] Add loggging configuration to admin docs TOC and move the cluster docs after the scaling docs --- doc/source/admin/index.rst | 3 ++- 1 file changed, 2 insertions(+), 1 deletion(-) diff --git a/doc/source/admin/index.rst b/doc/source/admin/index.rst index dab90b3965f..328f761360f 100644 --- a/doc/source/admin/index.rst +++ b/doc/source/admin/index.rst @@ -7,9 +7,10 @@ This documentation is in the midst of being ported and unified based on resource :maxdepth: 2 config + config_logging production - cluster scaling + cluster jobs tool_panel authentication From 35b1e2c9e7ce349f8cc37d363bb637b96a37266b Mon Sep 17 00:00:00 2001 From: Nate Coraor Date: Wed, 10 Jan 2018 16:47:09 -0500 Subject: [PATCH 070/112] Correct the handlers section of the job conf documentation. --- doc/source/admin/jobs.md | 3 +-- doc/source/admin/scaling.md | 4 ++++ 2 files changed, 5 insertions(+), 2 deletions(-) diff --git a/doc/source/admin/jobs.md b/doc/source/admin/jobs.md index 1a06222fd4b..bbe06669bfd 100644 --- a/doc/source/admin/jobs.md +++ b/doc/source/admin/jobs.md @@ -46,8 +46,7 @@ The collection contains `` elements. ```eval_rst id - A server name (e.g. a ``[server:]`` in config/galaxy.ini such as ``[server:main]``) that should be used to run jobs. - required + A server name that should be used to run jobs. Server names are dependent on your application server deployment scenario and are explained in the :ref:`configuration section of the scaling documentation `. tags A comma-separated set of strings that optional define tags to which this handler belongs. diff --git a/doc/source/admin/scaling.md b/doc/source/admin/scaling.md index 1bec027128b..4c9f7148630 100644 --- a/doc/source/admin/scaling.md +++ b/doc/source/admin/scaling.md @@ -133,6 +133,10 @@ run multiple Galaxy processes, but each web worker and job handler process had t This was the default configuration prior to the 18.01 Galaxy release and offered the simplest out-of-the-box setup at the expense of performance and scalability. +```eval_rst +.. _scaling-configuration: +``` + ## Configuration ### uWSGI From 49dd02f4090b525beba735fc9ff16e32388b3fcd Mon Sep 17 00:00:00 2001 From: mvdbeek Date: Thu, 11 Jan 2018 14:10:49 +0100 Subject: [PATCH 071/112] Keep header when converting sam to bam Otherwise the converted datasets are not valid BAM files. --- lib/galaxy/datatypes/converters/sam_to_bam_native.xml | 1 + test/functional/tools/sam_to_bam_native.xml | 1 + 2 files changed, 2 insertions(+) diff --git a/lib/galaxy/datatypes/converters/sam_to_bam_native.xml b/lib/galaxy/datatypes/converters/sam_to_bam_native.xml index 363a3b57b68..5e8475ea52a 100644 --- a/lib/galaxy/datatypes/converters/sam_to_bam_native.xml +++ b/lib/galaxy/datatypes/converters/sam_to_bam_native.xml @@ -6,6 +6,7 @@ Date: Thu, 11 Jan 2018 14:14:15 +0100 Subject: [PATCH 072/112] Revert "fix spelling" This reverts commit b139726ed380192ecf03f10e91220a0488b573f3. --- lib/galaxy/datatypes/registry.py | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/lib/galaxy/datatypes/registry.py b/lib/galaxy/datatypes/registry.py index 426dcb492c1..0d2b14f3808 100644 --- a/lib/galaxy/datatypes/registry.py +++ b/lib/galaxy/datatypes/registry.py @@ -801,7 +801,7 @@ class Registry(object): def get_converters_by_datatype(self, ext, priority_formats=None): """ Returns available converters by source type. - `priority_formats` will contain a list of format extensions that should + `priority_formats` will contain a lis of format extensions that should be handled with priority. This means they will end up infront of the returned ordered dictionary. """ From 38c5f711983033bb01072a769e6a618528724955 Mon Sep 17 00:00:00 2001 From: mvdbeek Date: Thu, 11 Jan 2018 14:14:33 +0100 Subject: [PATCH 073/112] Revert "implement priority converters" This reverts commit 8928b34506c1ba1f4856fad82dc42aef0f7c68f6. --- lib/galaxy/datatypes/registry.py | 41 +++++++++++++++----------------- 1 file changed, 19 insertions(+), 22 deletions(-) diff --git a/lib/galaxy/datatypes/registry.py b/lib/galaxy/datatypes/registry.py index 0d2b14f3808..72f818e55e3 100644 --- a/lib/galaxy/datatypes/registry.py +++ b/lib/galaxy/datatypes/registry.py @@ -798,34 +798,20 @@ class Registry(object): tabular.CSV() ] - def get_converters_by_datatype(self, ext, priority_formats=None): - """ - Returns available converters by source type. - `priority_formats` will contain a lis of format extensions that should - be handled with priority. This means they will end up infront of the - returned ordered dictionary. - """ + def get_converters_by_datatype(self, ext): + """Returns available converters by source type""" if ext not in self._converters_by_datatype: converters = odict() - prio_converters = odict() source_datatype = type(self.get_datatype_by_extension(ext)) for ext2, converters_dict in self.datatype_converters.items(): + converter_datatype = type(self.get_datatype_by_extension(ext2)) if issubclass(source_datatype, converter_datatype): - for k, v in converters_dict.items(): - if k in priority_formats: - prio_converters[k] = v - else: - converters[k] = v + converters.update(converters_dict) # Ensure ext-level converters are present if ext in self.datatype_converters.keys(): - for k, v in self.datatype_converters[ext].items(): - if k in priority_formats: - prio_converters[k] = v - else: - converters[k] = v - prio_converters.update(converters) - self._converters_by_datatype[ext] = prio_converters + converters.update(self.datatype_converters[ext]) + self._converters_by_datatype[ext] = converters return self._converters_by_datatype[ext] def get_converter_by_target_type(self, source_ext, target_ext): @@ -838,9 +824,20 @@ class Registry(object): def find_conversion_destination_for_dataset_by_extensions(self, dataset, accepted_formats, converter_safe=True): """Returns ( target_ext, existing converted dataset )""" - converters = self.get_converters_by_datatype(dataset.ext, [k.file_ext for k in accepted_formats]) + converters = self.get_converters_by_datatype(dataset.ext) + new_order = odict() - for convert_ext in converters: + accepted_format_keys = list() + for k in accepted_formats: + accepted_format_keys.append(k.file_ext) + if k.file_ext in converters: + new_order[k.file_ext] = converters[k.file_ext] + + for k,v in converters.items(): + if not k in accepted_format_keys: + new_order[k] = v + + for convert_ext in new_order: convert_ext_datatype = self.get_datatype_by_extension(convert_ext) if convert_ext_datatype is None: self.log.warning("Datatype class not found for extension '%s', which is used as target for conversion from datatype '%s'" % (convert_ext, dataset.ext)) From 1daa2ae6e5b11843912e2c42af2a0040a32d6030 Mon Sep 17 00:00:00 2001 From: Nate Coraor Date: Thu, 11 Jan 2018 13:56:05 -0500 Subject: [PATCH 074/112] Fix support for proxy prefix under uWSGI. --- scripts/get_uwsgi_args.py | 6 ++++-- 1 file changed, 4 insertions(+), 2 deletions(-) diff --git a/scripts/get_uwsgi_args.py b/scripts/get_uwsgi_args.py index d8fbc0e505e..9ec8468113c 100644 --- a/scripts/get_uwsgi_args.py +++ b/scripts/get_uwsgi_args.py @@ -20,6 +20,7 @@ ALIASES = { 'virtualenv': ('home', 'venv', 'pyhome'), 'pythonpath': ('python-path', 'pp'), 'http': ('httprouter', 'socket', 'uwsgi-socket', 'suwsgi-socket', 'ssl-socket'), + 'module': ('mount',), # mount is not actually an alias for module, but we don't want to set module if mount is set } DEFAULT_ARGS = { '_all_': ('virtualenv', 'pythonpath', 'threads', 'http', 'static-map', 'die-on-term', 'hook-master-start', 'enable-threads'), @@ -77,7 +78,6 @@ def __add_config_file_arg(args, config_file, app): __add_arg(args, ext, config_file) if has_logging: __add_arg(args, 'paste-logger', True) - __add_arg(args, 'module', 'galaxy.webapps.{app}.buildapp:uwsgi_app()'.format(app=app)) def _get_uwsgi_args(cliargs, kwargs): @@ -85,7 +85,6 @@ def _get_uwsgi_args(cliargs, kwargs): config_file = cliargs.config_file or kwargs.get('__file__') uwsgi_kwargs = load_app_properties(config_file=config_file, config_section='uwsgi') args = [] - __add_config_file_arg(args, config_file, cliargs.app) defaults = { 'virtualenv': os.environ.get('VIRTUAL_ENV', './.venv'), 'pythonpath': 'lib', @@ -99,6 +98,9 @@ def _get_uwsgi_args(cliargs, kwargs): 'unix_signal:15 gracefully_kill_them_all'), 'py-call-osafterfork': True, } + __add_config_file_arg(args, config_file, cliargs.app) + if not __arg_set('module', uwsgi_kwargs): + __add_arg(args, 'module', 'galaxy.webapps.{app}.buildapp:uwsgi_app()'.format(app=cliargs.app)) for arg in DEFAULT_ARGS['_all_'] + DEFAULT_ARGS[cliargs.app]: if not __arg_set(arg, uwsgi_kwargs): __add_arg(args, arg, defaults[arg]) From 1b583fb851ebfc476f53daff7447b37ee8477561 Mon Sep 17 00:00:00 2001 From: Nate Coraor Date: Thu, 11 Jan 2018 13:56:23 -0500 Subject: [PATCH 075/112] Update nginx documentation for uWSGI --- doc/source/admin/index.rst | 1 + doc/source/admin/nginx.md | 462 ++++++++++++++++++++++ doc/source/admin/production.md | 6 +- doc/source/admin/scaling.md | 12 +- doc/source/admin/special_topics/index.rst | 1 - doc/source/admin/special_topics/nginx.md | 309 --------------- 6 files changed, 475 insertions(+), 316 deletions(-) create mode 100644 doc/source/admin/nginx.md delete mode 100644 doc/source/admin/special_topics/nginx.md diff --git a/doc/source/admin/index.rst b/doc/source/admin/index.rst index 328f761360f..032064a6ac9 100644 --- a/doc/source/admin/index.rst +++ b/doc/source/admin/index.rst @@ -10,6 +10,7 @@ This documentation is in the midst of being ported and unified based on resource config_logging production scaling + nginx cluster jobs tool_panel diff --git a/doc/source/admin/nginx.md b/doc/source/admin/nginx.md new file mode 100644 index 00000000000..2c71c679c51 --- /dev/null +++ b/doc/source/admin/nginx.md @@ -0,0 +1,462 @@ +# Proxying Galaxy with NGINX + +[NGINX](http://nginx.org/en/) is a lightweight http server designed with high performance proxying in mind. The public +Galaxy sites ([Main](https://galaxyproject.org/main/) and [Test](https://galaxyproject.org/test/)) as well as the +[Docker Galaxy project](https://github.com/bgruening/docker-galaxy-stable) use nginx to proxy rather than Apache for its +simple, fast load balancing and other features. + +```eval_rst +.. warning:: Please note that Galaxy should *never* be located on disk inside nginx's document root. By default, this + would expose all of Galaxy (including datasets) to anyone on the web. +``` + +## Prerequisites + +Make sure that inbound (and outbound) traffic to the TCP protocol HTTP on port 80 (and HTTPS on port 443 if using SSL) +is permitted by your server's firewall/security. + +For the purposes of this example, we assume that: + +- the Galaxy server is installed at `/srv/galaxy/server` +- nginx runs as the user `www-data` (this is the default under Debian-based Linux distributions) +- Galaxy runs as the user `galaxy` with primary group `galaxy` +- Galaxy is served from the hostname `galaxy.example.org` + +Throughout the configuration examples in this document, in order to avoid reptition, `#...` is used to denote a location +where existing or previously given configuration statements would appear. + +## Basic Configuration + +The use of SSL is **strongly encouraged** to avoid exposure of confidential information such as datasets and user +credentials to eavesdroppers. The instructions in this document are for setting an SSL-enabled Galaxy server. + +When setting up an SSL server, simply enabling SSL with the default options is not enough. In most cases, the +configuration is weak and vulnerable to one or more of the multitude of SSL attacks that have been recently prevalent. +The [Qualys SSL/TLS Deployment Best Practices](https://www.ssllabs.com/projects/best-practices/) is an excellent and +up-to-date guide covering everything necessary for securing an SSL server. In addition, the [Mozilla SSL Configuration +Generator](https://mozilla.github.io/server-side-tls/ssl-config-generator/) can provide you with a best practices config +tailored to your desired security level and software versions. + +Finally, Google's [PageSpeed Insights](https://developers.google.com/speed/pagespeed/insights/) tool is helpful for +determining how you can improve responsiveness as related to proxying, such as verifying that caching and compression +are configured properly. + +If you need to run more than one site on your Galaxy server, there are two options: + +- Run them on the same server but serve them on different hostnames +- Serve them from different URL prefixes on a single hostname + +The former option is typically cleaner, but if serving more than one SSL site, you will need an SSL certificate with +[subjectAltName](http://wiki.cacert.org/FAQ/subjectAltName)s for each hostname served by the server. + +### Serving Galaxy at the Web Server Root + +This configuration assumes that Galaxy will be the only site on your server using the given hostname (e.g. +`https://galaxy.example.org`). + +Beginning with Galaxy Release 18.01, the default application server that Galaxy runs under is uWSGI. Because of this, +the native high performance uWSGI protocol should be used for communication between the proxy server and Galaxy, rather +than HTTP. Legacy instructions for proxying via HTTP can be found in the [Galaxy Release 17.09 nginx +documentation](https://docs.galaxyproject.org/en/release_17.09/admin/special_topics/nginx.html). + +uWSGI protocol support is built in to nginx, so (unlike Apache) no extra modules or recompiling should be required. + +Since nginx is more efficient than uWSGI at serving static content, it is best to serve it directly, reducing the load +on the Galaxy process and allowing for more effective compression (if enabled), caching, and pipelining. Directives to +do so are included in the example below. + +The following configuration is not exhaustive, only the portions most relevant to serving Galaxy are shown, these should +be incorporated with your existing/default nginx config as is appropriate for your server: + +```nginx +http { + + #... + + # compress responses whenever possible + gzip on; + gzip_http_version 1.1; + gzip_vary on; + gzip_comp_level 4; + gzip_proxied any; + gzip_types text/plain text/css application/json application/x-javascript text/xml application/xml application/xml+rss text/javascript; + gzip_comp_level 6; + gzip_buffers 16 8k; + + # allow up to 3 minutes for Galaxy to respond to slow requests before timing out + uwsgi_read_timeout 180; + + # maximum file upload size + client_max_body_size 10g; + + # allowable SSL protocols + ssl_protocols TLSv1 TLSv1.1 TLSv1.2; + + # use secure ciphers + ssl_ciphers + ECDHE-ECDSA-AES128-GCM-SHA256:ECDHE-ECDSA-AES256-GCM-SHA384:ECDHE-ECDSA-AES128-SHA:ECDHE-ECDSA-AES256-SHA:ECDHE-ECDSA-AES128-SHA256:ECDHE-ECDSA-AES256-SHA384:ECDHE-RSA-AES128-GCM-SHA256:ECDHE-RSA-AES256-GCM-SHA384:ECDHE-RSA-AES128-SHA:ECDHE-RSA-AES256-SHA:ECDHE-RSA-AES128-SHA256:ECDHE-RSA-AES256-SHA384:DHE-RSA-AES128-GCM-SHA256:DHE-RSA-AES256-GCM-SHA384:DHE-RSA-AES128-SHA:DHE-RSA-AES256-SHA:DHE-RSA-AES128-SHA256:DHE-RSA-AES256-SHA256; + ssl_dhparam /etc/nginx/ssl/dhparams.pem; + ssl_prefer_server_ciphers on; + + # enable session reuse + ssl_session_cache shared:SSL:8m; + ssl_session_timeout 5m; + + # cert/key + ssl_certificate /etc/nginx/ssl/server.crt; + ssl_certificate_key /etc/nginx/ssl/server.key; + + # OCSP stapling + ssl_stapling on; + ssl_stapling_verify on; + ssl_trusted_certificate /etc/nginx/ssl/ca.crt; + + + server { + listen 80 default_server; + listen [::]:80 default_server; + server_name _; + + return 301 https://$host$request_uri; + } + + server { + listen 443 default_server; + listen [::]:443 default_server; + server_name _; + + # use a variable for convenience + set $galaxy_root /srv/galaxy/server; + + # Enable HSTS + add_header Strict-Transport-Security "max-age=15552000; includeSubdomains"; + + # proxy all requests not matching other locations to uWSGI + location / { + uwsgi_pass unix:///srv/galaxy/var/uwsgi.sock + uwsgi_param UWSGI_SCHEME $scheme; + include uwsgi_params; + } + + # serve framework static content + location /static/style { + alias $galaxy_root/static/style/blue; + expires 24h; + } + location /static { + alias $galaxy_root/static; + expires 24h; + } + location /robots.txt { + alias $galaxy_root/static/robots.txt; + expires 24h; + } + location /favicon.ico { + alias $galaxy_root/static/favicon.ico; + expires 24h; + } + + # serve visualization and interactive environment plugin static content + location ~ ^/plugins/(?.+?)/(?.+?)/static/(?.*?)$ { + alias $galaxy_root/config/plugins/$plug_type/$vis_name/static/$static_file; + expires 24; + } + } +} +``` + +Be sure to set `$galaxy_root` to the path to your copy of Galaxy and modify the value of `uwsgi_pass` to match your +uWSGI socket path. With the default configuration, uWSGI will bind to a random TCP socket, so you will need to set it to +a fixed value as described in the [Scaling and Load Balancing](scaling.html) documentation. If using a UNIX domain +socket, be sure to pay particular attention to the discussion of users and permissions. + +### Implementation-specific Notes + +It is possible to perform the entire configuration in the main nginx configuration file (typically +`/etc/nginx/nginx.conf`), however, nginx packages as provided by Linux distribution package managers typically provide a +slightly more complex layout that is designed to prevent conflicts in `nginx.conf` when updating the package. + +On Debian-based Linux distributions (Debian, Ubuntu, etc.), the nginx package's default configuration contains two +include directives in the `http {}` block: + +- One which includes any configuration files with the `.conf` extension in the `/etc/nginx/conf.d` directory, where you + would place directives that belong in the `http {}` block. +- One which includes all files in the `/etc/nginx/sites-enabled` directory, which contains symlinks to + `/etc/nginx/sites-available`, where you would place the `server {}` configurations for websites hosted by this nginx + server. + +On EL-based Linux distributions (RedHat Enterprise Linux, CentOS, etc.), the EPEL nginx package's default configuration +contains a directive in the `http {}` block that includes any configuration files with the `.conf` extension in the +`/etc/nginx/conf.d` directory. + +Thus, on both Debian- and EL-based distributions, you might put the `http` directives in +`/etc/nginx/conf.d/galaxy_http_options.conf`. Note that these are **not** enclosed in an `http {}` block themselves, as +they are already enclosed by the `http {}` block in `/etc/nginx/nginx.conf`: + +```nginx +uwsgi_read_timeout 180; +client_max_body_size 10g; +ssl_certificate /etc/nginx/ssl/server.crt; +ssl_certificate_key /etc/nginx/ssl/server.key; +#... +``` + +Then for the site configurations, you might create: + +- `/etc/nginx/conf.d/galaxy_site.conf` on EL-based distributions +- `/etc/nginx/sites-available/galaxy` on Debian-based distributions + +With the `server {}` blocks (again, not enclosed in an `http {}`): + +```nginx +server { + listen 80 default_server; + listen [::]:80 default_server; + server_name _; + #... +} + +server { + listen 443 default_server; + listen [::]:443 default_server; + server_name _; + #... +} +``` + +On Debian-based distribution, you'd then need to symlink the config with: + +```shell-session +# ln -s /etc/nginx/sites-available/galaxy /etc/nginx/sites-enabled/galaxy +``` + +### Additional Notes + +- **Do not** simply copy the SSL configuration directives and expect them to work on your server or to be secure! These + are provided as examples of some of the best practices as of the time of writing, but will not always be up to date. + Use the guides referenced in [basic configuration](#basic-configuration) section to configure SSL properly. +- If your existing nginx configuration contains a line or included config file defining a default server, be sure to + disable it by commenting its `server {}` or preventing its inclusion (under Debian-based operating systems, this + is done by removing its symlink from `/etc/nginx/sites-enabled`. +- `uwsgi_read_timeout` can be adjusted as appropriate for your site. This is the amount of time allowed for + communication between nginx and uWSGI to block while waiting for a response from Galaxy, and is useful for holding + client (browser) connections while uWSGI is restarting Galaxy subprocesses or Galaxy is performing a slow operation. +- The parameter `client_max_body_size` specifies the maximum upload size that can be handled by POST requests through + nginx. You should set this to the largest file size that you wish to allow for upload and that could be reasonably + handled by your site. It defaults to 1MB, so it will need to be increased if you are dealing with genome sized + datasets. +- If you must serve Galaxy without SSL, you would simply replace the `listen` directives in the SSL `server {}` block + with the `listen` directives from the non-SSL `server {}` block and remove the non-SSL block and SSL directives from + the `http {}` block. +- If the proxy works but you are getting 404 errors for Galaxy's static content, be sure that the user that nginx runs + as has access to Galaxy's `static/` directory (and all its parent directories) on the filesystem. You can test this on + the command line with e.g. `sudo -u www-data ls /srv/galaxy/server/static`. + +### Serving Galaxy at a URL Prefix + +It may be necessary to serve Galaxy from an address other than the web server root (`https://www.example.org/galaxy`), +instead of `https://galaxy.example.org`). To do this, you need to make the following changes to the configuration in the +previous section: + +1. In the nginx config, prefix all of the location directives with your prefix and redirect requests from `/prefix` to + `/prefix/` like so: + + ```nginx + #... + + # proxy all requests not matching other locations to uWSGI + location /galaxy { + uwsgi_pass unix:///srv/galaxy/var/uwsgi.sock + uwsgi_param UWSGI_SCHEME $scheme; + include uwsgi_params; + } + + # serve framework static content + location /galaxy/static/style { + alias $galaxy_root/static/style/blue; + expires 24h; + } + + # additional static locations... + + # redirect /prefix -> /prefix/ + rewrite ^/galaxy$ /galaxy/ last; + ``` + +2. The Galaxy application needs to be aware that it is running with a prefix (for generating URLs in dynamic pages). + This is accomplished by configuring uWSGI and Galaxy (the `uwsgi` and `galaxy` sections in `config/galaxy.yml` + respectively) like so and restarting Galaxy: + + ```yaml + uwsgi: + #... + socket: unix:///srv/galaxy/var/uwsgi.sock + mount: /galaxy=galaxy.webapps.galaxy.buildapp:uwsgi_app() + manage-script-name: true + # `module` MUST NOT be set when `mount` is in use + #module: galaxy.webapps.galaxy.buildapp:uwsgi_app() + + galaxy: + #... + cookie_path: /galaxy + ``` + + `cookie_path` should be set to prevent Galaxy's session cookies from clobbering each other if you are running more + than one instance of Galaxy under different URL prefixes on the same hostname. + + Be sure to consult the [Scaling and Load Balancing](scaling.html) documentation, other options unrelated to proxying + should also be set in the `uwsgi` section of the config. + +## Advanced Configuration Topics + +### Sending Files With Nginx + +Galaxy sends files (e.g. dataset downloads) by opening the file and streaming it in chunks through the proxy server. +However, this ties up the Galaxy process, which can impact the performance of other operations (see [Production Server +Configuration](/src/admin/config/performance/production-server/index.md) for a more in-depth explanation). + +Nginx can assume this task instead and as an added benefit, speed up downloads. This is accomplished through the use of +the special `X-Accel-Redirect` header. Dataset security is maintained in this configuration because nginx will still +check with Galaxy to ensure that the requesting user has permission to access the dataset before sending it. + +To enable it, add the following to your Galaxy's `server {}` block: + +```nginx + location /_x_accel_redirect/ { + internal; + alias /; + } +``` + +Next, edit `galaxy.yml` and make the following change before restarting Galaxy: + +```yaml +galaxy: + #... + nginx_x_accel_redirect_base: '/_x_accel_redirect' +``` + +For this to work, the user under which your nginx server runs will need read access to Galaxy's `files_path` directory +(by default, `database/files/`) and its contents. This is most easily done by adding the nginx user to the Galaxy user's +primary group and setting the `umask(2)` to create files with the group read permission set. If you start Galaxy from +the command line, you can do this like so: + +```shell-session +admin@server$ sudo usermod -a -G galaxy www-data # add `www-data` user to `galaxy` group +admin@server$ sudo -iu galaxy +galaxy@server$ umask 027 +galaxy@server$ sh run.sh +``` + +If you start Galaxy from supervisord, you can set the `umask` option in the [program +section](http://supervisord.org/configuration.html#program-x-section-settings) after adding the nginx user to the Galaxy +group as shown above. + +### Receiving Files With Nginx + +Galaxy receives files (e.g. dataset uploads) by streaming them in chunks through the proxy server and writing the files +to disk. However, this again ties up the Galaxy process. nginx can assume this task instead and as an added benefit, +speed up uploads. This is accomplished through the use of +[nginx_upload_module](http://www.grid.net.ru/nginx/upload.en.html), a 3rd-party nginx module. + +To enable it, you must first download, compile and install nginx with the upload module, since prior to NGINX 1.11.5, +nginx did not support shared modules, and the upload module is not yet shared-compatible. Because this is a tedious +and complicated process, the Galaxy Committers team maintains (for some platforms) versions of nginx modified from their +upstream package sources (APT, EPEL, etc.) to include the upload module: + +- [Ubuntu (PPA)](https://launchpad.net/~galaxyproject/+archive/ubuntu/nginx) +- [Enterprise Linux](https://depot.galaxyproject.org/yum/) + +To contribute support for additional platforms, please see the [Galaxy +Starforge](https://github.com/galaxyproject/starforge) project, which is used to do the repackaging. + + +Once nginx with the upload module is installed, create a directory in which to store uploads (ideally, for performance +reasons, on the same filesystem as Galaxy's datasets) and add the necessary directives to `nginx.conf`: + +```nginx +user galaxy; + +http { + + #... + + server { + + #... + + # handle file uploads via the upload module + location /_upload { + upload_store /srv/galaxy/upload_store; + upload_store_access user:rw group:rw; + upload_pass_form_field ""; + upload_set_form_field "__${upload_field_name}__is_composite" "true"; + upload_set_form_field "__${upload_field_name}__keys" "name path"; + upload_set_form_field "${upload_field_name}_name" "$upload_file_name"; + upload_set_form_field "${upload_field_name}_path" "$upload_tmp_path"; + upload_pass_args on; + upload_pass /_upload_done; + } + + # once upload is complete, redirect to the proper galaxy path + location /_upload_done { + set $dst /api/tools; + if ($args ~ nginx_redir=([^&]+)) { + set $dst $1; + } + rewrite "" $dst; + } +} +``` + +Note the `user` directive at the top, outside of the `http {}` block. To ensure that Galaxy has write permission on the +uploaded files, nginx's workers will need to run as the same user as Galaxy. + +When serving Galaxy at a URL prefix as described in the [Serving Galaxy at a URL +prefix](#serving-galaxy-at-a-url-prefix) section, you will need to change `set $dst /api/tools;` to `set $dst +/prefix/api/tools;` (e.g. `set $dst /galaxy/api/tools;`). + +Finally, edit `galaxy.yml` and make the following change before restarting Galaxy: + +```yaml +galaxy: + #... + nginx_upload_store: /srv/galaxy/upload_store + nginx_upload_path: '/_upload' +``` + +### Use Galaxy Authentication to Protect Custom Paths + +You may find it useful to require authentication for access to certain paths on your server. For example, Galaxy can +run a separate reports app which gives useful information about your Galaxy instance. See the [Reports Configuration +documentation](reports.html) and [Peter Briggs' blog post on the +subject](http://galacticengineer.blogspot.com/2015/06/exposing-galaxy-reports-via-nginx-in.html) for more. + +After succesfully following the blog post, Galaxy reports should be available at e.g. `https://galaxy.example.org/reports`. +To secure this page to only Galaxy administrators, adjust your nginx config accordingly: + +**TODO:** This is not valid for the uWSGI proxy method and needs to be updated. -nate 2018-01-11 + +```nginx + location /reports { + #... + satisfy any; # only one auth method needs to succeed + deny all; # host-based auth is not allowed + auth_request /_auth; # forward authentication + } + + location /_auth { + #internal; probably? + # The used galaxy api endpoint is only available to galaxy admins and thus limits the access + # to only logged in admins. + proxy_pass http://localhost/api/configuration/dynamic_tool_confs; + proxy_pass_request_body off; + proxy_set_header Content-Length ""; + proxy_set_header X-Original-URI $request_uri; + } +``` + +### External User Authentication + +- [Nginx for External Authentication](https://galaxyproject.org/admin/config/nginx-external-user-auth/) +- [Built-in Galaxy External Authentication](../authentication.html) diff --git a/doc/source/admin/production.md b/doc/source/admin/production.md index 54091f5135a..ae6310f25ce 100644 --- a/doc/source/admin/production.md +++ b/doc/source/admin/production.md @@ -7,7 +7,7 @@ The [basic installation instructions](https://getgalaxy.org) are suitable for de By default, Galaxy: * Uses [SQLite](http://www.sqlite.org/) (a serverless database), so you don't have to run/configure a database server for quick or basic development. However, while SQLite [supports concurrent access](https://sqlite.org/lockingv3.html) it does not support multiple concurrent writes, which can reduce system throughput. -* Uses a built-in HTTP server, written in Python. Much of the work performed by this server can be moved to [nginx](special_topics/nginx.html) or Apache, which will increase performance. +* Uses a built-in HTTP server, written in Python. Much of the work performed by this server can be moved to [nginx](nginx.html) or Apache, which will increase performance. * Runs all tools locally. Moving to a [cluster](cluster.html) will greatly increase capacity. * Runs in a single process, which is a performance problem in [CPython](http://en.wikipedia.org/wiki/CPython). @@ -96,7 +96,7 @@ Downloading and uploading data can also be moved to the proxy server. This is e Virtually any server that proxies HTTP should work, although we provide configuration examples for: * [Apache](special_topics/apache.html), and -* [nginx](special_topics/nginx.html), a high performance reverse proxy, used by our public Galaxy sites +* [nginx](nginx.html), a high performance reverse proxy, used by our public Galaxy sites ### Using a compute cluster @@ -163,4 +163,4 @@ Finally, if you are using Galaxy <= release_2014.06.02, we recommend that you in ### Make the proxy handle uploads and downloads -By default, Galaxy receives file uploads as a stream from the proxy server and then writes this file to disk. Likewise, it sends files as a stream to the proxy server. This occupies the GIL in that Galaxy process and will decrease responsiveness for other operations in that process. To solve this problem, you can configure your proxy server to serve downloads directly, involving Galaxy only for the task of authorizing that the user has permission to read the dataset. If using nginx as the proxy, you can configure it to receive uploaded files and write them to disk itself, only notifying Galaxy of the upload once it's completed. All the details on how to configure these can be found on the [Apache](special_topics/apache.html) and [nginx](special_topics/nginx.html) proxy instruction pages. +By default, Galaxy receives file uploads as a stream from the proxy server and then writes this file to disk. Likewise, it sends files as a stream to the proxy server. This occupies the GIL in that Galaxy process and will decrease responsiveness for other operations in that process. To solve this problem, you can configure your proxy server to serve downloads directly, involving Galaxy only for the task of authorizing that the user has permission to read the dataset. If using nginx as the proxy, you can configure it to receive uploaded files and write them to disk itself, only notifying Galaxy of the upload once it's completed. All the details on how to configure these can be found on the [Apache](special_topics/apache.html) and [nginx](nginx.html) proxy instruction pages. diff --git a/doc/source/admin/scaling.md b/doc/source/admin/scaling.md index 4c9f7148630..02c40562ee9 100644 --- a/doc/source/admin/scaling.md +++ b/doc/source/admin/scaling.md @@ -66,7 +66,7 @@ roles (serving static content, serving dataset downloads, etc.) as described in configuration](production.html) documentation. When using uWSGI with a proxy server, it is recommended that you use the native high performance uWSGI protocol -(supported by both [Apache](special_topics/apache.html) and [nginx](special_topics/nginx.html)) between uWSGI and the +(supported by both [Apache](special_topics/apache.html) and [nginx](nginx.html)) between uWSGI and the proxy server, rather than HTTP. ### uWSGI with jobs handled by web workers (default configuration) @@ -244,11 +244,17 @@ permissions, but you can also listen on a port: The choice of port 4001 is arbitrary, but in both cases, the socket location must match whatever socket the proxy server is configured to communicate with. If using a UNIX domain socket, be sure that the proxy server's user has read/write -permission on the socket (uWSGI's `chmod-socket` option can help here). +permission on the socket. Because Galaxy and the proxy server most likely run as different users, this is not likely to +be the case by default. One common solution is to add the proxy server's user to the Galaxy user's primary group. +uWSGI's `chmod-socket` option can also help here. -You can consult the Galaxy documentation for [Apache](special_topics/apache.html) or [nginx](special_topics/nginx.html) +You can consult the Galaxy documentation for [Apache](special_topics/apache.html) or [nginx](nginx.html) for help with the proxy-side configuration. +By setting the `socket` option, `run.sh` will no longer automatically serve Galaxy via HTTP (since it is assumed that +you are setting a socket to serve Galaxy via a proxy server). If you wish to continue serving HTTP directly with uWSGI +while `socket` is set, you can use the `http` option as shown in the directions below. + **Without a proxy server** or with a proxy server that does not speak the uWSGI native protocol: uWSGI can be configured to serve HTTP and/or HTTPS directly: diff --git a/doc/source/admin/special_topics/index.rst b/doc/source/admin/special_topics/index.rst index de56dbb527e..507e2b4cffe 100644 --- a/doc/source/admin/special_topics/index.rst +++ b/doc/source/admin/special_topics/index.rst @@ -5,7 +5,6 @@ Special Topics .. toctree:: :maxdepth: 2 - nginx apache ftp interactive_environments diff --git a/doc/source/admin/special_topics/nginx.md b/doc/source/admin/special_topics/nginx.md deleted file mode 100644 index 20e0a3a5588..00000000000 --- a/doc/source/admin/special_topics/nginx.md +++ /dev/null @@ -1,309 +0,0 @@ -# Proxying Galaxy with NGINX - -[NGINX](http://nginx.org/en/) is a lightweight http server designed with high performance proxying in mind. The public Galaxy sites ([Main](https://galaxyproject.org/main/) and [Test](https://galaxyproject.org/test/)) as well as the [Docker Galaxy project](https://github.com/bgruening/docker-galaxy-stable) use nginx to proxy rather than Apache for its simple, fast load balancing and other features. - -Galaxy should _never_ be located on disk inside nginx's `root`. By default, this would expose all of Galaxy (including datasets) to anyone on the web. - -## Prerequisites - -Make sure that inbound (and outbound) traffic to the TCP protocol HTTP on port 80 (and HTTPS on port 443 if using SSL) is permitted by your server's firewall/security. - -```eval_rst -.. warning:: Please note that Galaxy should *never* be located on disk inside Nginx's document root. By default, this would expose all of Galaxy (including datasets) to anyone on the web. -``` - -## Basic configuration - -### Serving Galaxy at the web server root (/) - -For a default Galaxy configuration running on [http://localhost:8080/](http://localhost:8080/) (see [SSL](https://github.com/VJalili/galaxy-site/blob/patch-1/src/admin/config/nginxProxy/index.md#ssl) section for HTTPS), the following lines in the nginx configuration will proxy requests to the Galaxy application: - -```nginx -http { - ... - - upstream galaxy_app { - server localhost:8080; - } - - proxy_next_upstream off; - server { - client_max_body_size 10G; - # ... other server stuff ... - location / { - proxy_pass http://galaxy_app; - proxy_set_header X-Forwarded-Host $host; - proxy_set_header X-Forwarded-For $proxy_add_x_forwarded_for; - } - - # serve static content for visualization and interactive environment plugins - location ~ ^/plugins/(?.+?)/(?.+?)/static/(?.*?)$ { - alias $GALAXY_ROOT/config/plugins/$plug_type/$vis_name/static/$static_file; - } - } -} -``` - - -**Notes:** - -Make sure that you either comment out or modify line containing default configuration for enabled sites. - -``` -include /etc/nginx/sites-enabled/*; -``` - -- The `proxy_next_upstream off;` disables nginx's round-robin scheme to prevent it from submitting POST requests more than once. This is unsafe, and is useful when using more than one upstream. -- Replace `$GALAXY_ROOT` with the path to your copy of Galaxy. -- The parameter `client_max_body_size` specifies the maximum upload size that can be handled by POST requests through nginx. You should set this to the largest file size that could be reasonable handled by your network. It defaults to 1M files, so will probably need to be increased if you are dealing with genome sized datasets. - -Since nginx is more efficient at serving static content, it is best to serve it directly, reducing the load on the Galaxy process and allowing for more effective compression (if enabled), caching, and pipelining. To do so, add the following to your existing `server { }` block, replacing `$GALAXY_ROOT` with the correct path.: - -```nginx -http { - server { - location /static { - alias $GALAXY_ROOT/static; - } - location /static/style { - alias $GALAXY_ROOT/static/style/blue; - } - location /static/scripts { - alias $GALAXY_ROOT/static/scripts; - } - location /favicon.ico { - alias $GALAXY_ROOT/static/favicon.ico; - } - location /robots.txt { - alias $GALAXY_ROOT/static/robots.txt; - } - } -} -``` - -You'll need to ensure that filesystem permissions are set such that the user running your nginx server has access to the Galaxy static/ directory. - - -### Serving Galaxy at a sub directory (such as /galaxy) - -It may be necessary to house Galaxy at an address other than the web server root (`http://www.example.org/galaxy`), instead of `http://www.example.org`). To do this, you need to make the following changes: - -1. In the nginx config, prefix all of the location directives with your prefix, like so: - -```nginx -http { - server { - ... - - location /galaxy { - proxy_pass http://galaxy_app; - proxy_set_header X-Forwarded-Host $host; - proxy_set_header X-Forwarded-For $proxy_add_x_forwarded_for; - } - location /galaxy/static { - alias $GALAXY_ROOT/static; - } - - ... - } -} -``` - -2. The Galaxy application needs to be aware that it is running with a prefix (for generating URLs in dynamic pages). This is accomplished by configuring a Paste proxy-prefix filter in the `galaxy` section of `config/galaxy.ini` and restarting Galaxy: - - -```ini -[filter:proxy-prefix] -use = egg:PasteDeploy#prefix -prefix = /galaxy - -[app:main] -filter-with = proxy-prefix -cookie_path = /galaxy -``` - -`cookie_prefix` should be set to prevent Galaxy's session cookies from clobbering each other if running more than one instance of Galaxy in different subdirectories on the same hostname. - - -### SSL - -If you place Galaxy behind a proxy address that uses SSL (i.e., `https://` URLs), edit your galaxy location block (e.g. `location /` when served at the root, or something else like `location /galaxy` when served under a prefix) - -```nginx -location / { - ... - proxy_set_header X-URL-SCHEME https; - ... -} -``` - -Setting `X-URL-SCHEME` makes Galaxy aware of what type of URL it should generate for external sites like Biomart. This should be added to the existing `location / { } ` block if you already have one, and adjusted accordingly if you're serving Galaxy from a subdirectory. - -## Advanced Configuration Topics - -### Compression and caching - -All of Galaxy's static content can be cached on the client side, and everything (including dynamic content) can be compressed on the fly. This will decrease download and page load times for your clients, as well as decrease server load and bandwidth usage. To enable, you'll need nginx gzip support (which is standard unless compiled with `--without-http_gzip_module`), and the following in your `nginx.conf`: - -```nginx -http { - ... - gzip on; - gzip_http_version 1.1; - gzip_vary on; - gzip_comp_level 4; - gzip_proxied any; - gzip_types text/plain text/css application/x-javascript text/xml application/xml text/javascript application/json application/javascript; - gzip_buffers 16 8k; - gzip_disable "MSIE [1-6].(?!.*SV1)"; - ... -} -``` - -For caching, you'll need to add an `expires` directive to the `location /static { }` blocks: - -```nginx -http { - server { - location /static { - alias $GALAXY_ROOT/static; - expires 24h; - } - location /static/style { - alias $GALAXY_ROOT/static/style/blue; - expires 24h; - } - } -} -``` - -The contents of `location /static { }` should be adjusted accordingly if you're serving Galaxy from a subdirectory. - -### Sending files using Nginx - -Galaxy sends files (e.g. dataset downloads) by opening the file and streaming it in chunks through the proxy server. However, this ties up the Galaxy process, which can impact the performance of other operations (see [Production Server Configuration](/src/admin/config/performance/production-server/index.md) for a more in-depth explanation). - -Nginx can assume this task instead and as an added benefit, speed up downloads. This is accomplished through the use of the special `X-Accel-Redirect` header. Dataset security is maintained in this configuration because nginx will still check with Galaxy to ensure that the requesting user has permission to access the dataset before sending it. - -To enable it, add the following to your `nginx.conf`: - -```nginx -http { - server { - location /_x_accel_redirect/ { - internal; - alias /; - } - } -} -``` - -Finally edit your `$GALAXY_ROOT/config/galaxy.yml` and make the following change before restarting Galaxy: - -```yaml -galaxy: - #... - nginx_x_accel_redirect_base: '/_x_accel_redirect' -``` - -For this to work, the user under which your nginx server runs will need read access to Galaxy's `$GALAXY_ROOT/database/files/` directory and its contents. - -### Receiving files using nginx - -Galaxy receives files (e.g. dataset uploads) by streaming them in chunks through the proxy server and writing the files to disk. However, this again ties up the Galaxy process. nginx can assume this task instead and as an added benefit, speed up uploads. This is accomplished through the use of `nginx_upload_module`, a 3rd-party nginx module. - -To enable it, you must first [download](http://www.grid.net.ru/nginx/upload.en.html), compile and install `nginx_upload_module`. This means recompiling nginx. Once done, add the necessary directives to `nginx.conf`: - -```nginx -user galaxy; -http { - server { - ... - - location /_upload { - upload_store $GALAXY_ROOT/database/tmp/upload_store; - upload_pass_form_field ""; - upload_set_form_field " __${upload_field_name}__ is_composite" "true"; - upload_set_form_field " __${upload_field_name}__ keys" "name path"; - upload_set_form_field "${upload_field_name}_name" "$upload_file_name"; - upload_set_form_field "${upload_field_name}_path" "$upload_tmp_path"; - upload_pass_args on; - upload_pass /_upload_done; - } - - location /_upload_done { - set $dst /api/tools; - if ($args ~ nginx_redir=([^&]+)) { - set $dst $1; - } - rewrite "" $dst; - } - - ... - } -} -``` - -Note the `user` directive. To ensure that Galaxy has write permission on the uploaded files, nginx's workers will need to run as the same user as Galaxy. - -Finally edit your `$GALAXY_ROOT/config/galaxy.yml` and make the following change before restarting Galaxy: - -```yaml -galaxy: - #... - nginx_upload_store: database/tmp/upload_store - nginx_upload_path: '/_upload' -``` - -When serving Galaxy with a prefix, as described in the serving Galaxy in a sub-directory section above, you will need to change one line in the `\_upload\_done` section. If your galaxy instance is available from `/galaxy`, then the first line should include this prefix: - -```nginx -set $dst /galaxy/api/tools; -``` - -### Protect Galaxy Reports - -Galaxy can run a separate reports app which gives useful information about your Galaxy instance. -To setup this reports app, have a look here https://docs.galaxyproject.org/en/master/admin/reports.html and here http://galacticengineer.blogspot.de/2015/06/exposing-galaxy-reports-via-nginx-in.html - -After succesfully following the blogpost you will have your galaxy reports available at e.g. http://yourgalaxy/reports -To secure this page to only galaxy administrators, adjust your nginx config with the following snippets: - -```nginx -# Add these snippets to your galaxy nginx configuration to make the reports -# daemon running on the default port 9001 available under the same address -# as your galaxy instance. In addition, the reports app will only be available -# to admins logged in to the galaxy instance. - -upstream reports { - server localhost:9001; -} - -server { # This you should already have. - listen 80; - (..) # The rest of your nginx configuration for galaxy - - location /reports { # the section to make reports available - proxy_pass http://reports; # on the same host as your galaxy at e.g. http://galaxy/reports - proxy_set_header X-Forwarded-Host $host; - proxy_set_header X-Forwarded-For $proxy_add_x_forwarded_for; - satisfy any; # Restrict access - deny all; - auth_request /auth; - } - location /auth { - # The used galaxy api endpoint is only available to galaxy admins and thus limits the access - # to only logged in admins. - proxy_pass http://localhost/api/configuration/dynamic_tool_confs; - proxy_pass_request_body off; - proxy_set_header Content-Length ""; - proxy_set_header X-Original-URI $request_uri; - } - (..) -} -``` - -### External User Authentication - -- [Nginx for External Authentication](https://galaxyproject.org/admin/config/nginx-external-user-auth/) -- [Built-in Galaxy External Authentication](../authentication.html) From 5a0d60537cdf9417c347921f06ae9b22e577274c Mon Sep 17 00:00:00 2001 From: Nate Coraor Date: Thu, 11 Jan 2018 16:38:48 -0500 Subject: [PATCH 076/112] Update Apache documentation for uWSGI --- doc/source/admin/apache.md | 410 ++++++++++++++++++ doc/source/admin/index.rst | 1 + doc/source/admin/nginx.md | 13 +- doc/source/admin/production.md | 4 +- doc/source/admin/scaling.md | 4 +- doc/source/admin/special_topics/apache.md | 228 ---------- doc/source/admin/special_topics/index.rst | 1 - .../webapps/galaxy/api/configuration.py | 3 + 8 files changed, 425 insertions(+), 239 deletions(-) create mode 100644 doc/source/admin/apache.md delete mode 100644 doc/source/admin/special_topics/apache.md diff --git a/doc/source/admin/apache.md b/doc/source/admin/apache.md new file mode 100644 index 00000000000..50b7faf3c53 --- /dev/null +++ b/doc/source/admin/apache.md @@ -0,0 +1,410 @@ +# Proxying Galaxy with Apache + +For various reasons (performance, authentication, etc.) in a production environment, it's recommended to run Galaxy +behind a web server proxy. Although any proxy could work, Apache is a common choice. Alternatively, we use +[nginx](http://nginx.net/) for our public sites and open source infrastructure, and [details are +available](nginx.html) for it, too. + +Currently, the only recommended way to run Galaxy with Apache is using `mod_rewrite`, `mod_proxy`, and +`mod_proxy_uwsgi`. These modules must be enabled in the Apache config. The main proxy directives, `ProxyRequests` and +`ProxyVia` do **not** need to be enabled. + +## Prerequisites + +Make sure that inbound (and outbound) traffic to the TCP protocol HTTP on port 80 (and HTTPS on port 443 if using SSL) +is permitted by your server's firewall/security. + +These directions are written for Apache 2.4+. Apache 2.4 for Enterprise Linux (EL) 6 can be obtained from the [CentOS +SCLo SIG Repo](https://wiki.centos.org/SpecialInterestGroup/SCLo/CollectionsList). + +Ensure that the `mod_headers`, `mod_rewrite`, `mod_proxy`, and `mod_proxy_uwsgi` modules are loaded. Although not +required, the configuration examples also use `mod_deflate` and `mod_expires` for increased client/server performance, +so these should also be enabled. On Debian-based Linux distributions, you can do this with: + +```shell-session +# apt-get install apache2 libapache2-mod-proxy-uwsgi +# a2enmod headers deflate expires rewrite proxy proxy_uwsgi +Enabling module headers. +Considering dependency filter for deflate: +Module filter already enabled +Module deflate already enabled +Enabling module expires. +Enabling module rewrite. +Enabling module proxy. +Considering dependency proxy for proxy_uwsgi: +Module proxy already enabled +Enabling module proxy_uwsgi. +To activate the new configuration, you need to run: + service apache2 restart +``` + +On EL-based distributions, you will need to enable the [EPEL](https://fedoraproject.org/wiki/EPEL) repository and then: + +```shell-session +# yum install httpd mod_proxy_uwsgi +# echo "LoadModule proxy_uwsgi_module modules/mod_proxy_uwsgi.so" > /etc/httpd/conf.modules.d/10-proxy-uwsgi.conf +``` + +For the purposes of this example, we assume that: + +- the Galaxy server is installed at `/srv/galaxy/server` +- Apache runs as the user `www-data` (this is the default under Debian-based Linux distributions) +- Galaxy runs as the user `galaxy` with primary group `galaxy` +- Galaxy is served from the hostname `galaxy.example.org` + +Throughout the configuration examples in this document, in order to avoid reptition, `#...` is used to denote a location +where existing or previously given configuration statements would appear. + +```eval_rst +.. warning:: Please note that Galaxy should *never* be located on disk inside Apache's `DocumentRoot`. By default, this + would expose all of Galaxy (including datasets) to anyone on the web. +``` + +## Basic configuration + +The use of SSL is **strongly encouraged** to avoid exposure of confidential information such as datasets and user +credentials to eavesdroppers. The instructions in this document are for setting an SSL-enabled Galaxy server. + +When setting up an SSL server, simply enabling SSL with the default options is not enough. In most cases, the +configuration is weak and vulnerable to one or more of the multitude of SSL attacks that have been recently prevalent. +The [Qualys SSL/TLS Deployment Best Practices](https://www.ssllabs.com/projects/best-practices/) is an excellent and +up-to-date guide covering everything necessary for securing an SSL server. In addition, the [Mozilla SSL Configuration +Generator](https://mozilla.github.io/server-side-tls/ssl-config-generator/) can provide you with a best practices config +tailored to your desired security level and software versions. + +Finally, Google's [PageSpeed Insights](https://developers.google.com/speed/pagespeed/insights/) tool is helpful for +determining how you can improve responsiveness as related to proxying, such as verifying that caching and compression +are configured properly. + +If you need to run more than one site on your Galaxy server, there are two options: + +- Run them on the same server but serve them on different hostnames +- Serve them from different URL prefixes on a single hostname + +The former option is typically cleaner, but if serving more than one SSL site, you will need an SSL certificate with +[subjectAltName](http://wiki.cacert.org/FAQ/subjectAltName)s for each hostname served by the server. + +### Serving Galaxy at the Web Server Root + +This configuration assumes that Galaxy will be the only site on your server using the given hostname (e.g. +`https://galaxy.example.org`). + +Beginning with Galaxy Release 18.01, the default application server that Galaxy runs under is uWSGI. Because of this, +the native high performance uWSGI protocol should be used for communication between the proxy server and Galaxy, rather +than HTTP. Legacy instructions for proxying via HTTP can be found in the [Galaxy Release 17.09 Apache +documentation](https://docs.galaxyproject.org/en/release_17.09/admin/special_topics/apache.html). + +Since Apache is more efficient than uWSGI at serving static content, it is best to serve it directly, reducing the load +on the Galaxy process and allowing for more effective compression (if enabled), caching, and pipelining. Directives to +do so are included in the example below. + +The following configuration is not exhaustive, only the portions most relevant to serving Galaxy are shown, these should +be incorporated with your existing/default Apache config as is appropriate for your server: + +```apache +SSLProtocol all -SSLv3 +SSLCipherSuite ECDHE-ECDSA-AES128-GCM-SHA256:ECDHE-ECDSA-AES256-GCM-SHA384:ECDHE-ECDSA-AES128-SHA:ECDHE-ECDSA-AES256-SHA:ECDHE-ECDSA-AES128-SHA256:ECDHE-ECDSA-AES256-SHA384:ECDHE-RSA-AES128-GCM-SHA256:ECDHE-RSA-AES256-GCM-SHA384:ECDHE-RSA-AES128-SHA:ECDHE-RSA-AES256-SHA:ECDHE-RSA-AES128-SHA256:ECDHE-RSA-AES256-SHA384:DHE-RSA-AES128-GCM-SHA256:DHE-RSA-AES256-GCM-SHA384:DHE-RSA-AES128-SHA:DHE-RSA-AES256-SHA:DHE-RSA-AES128-SHA256:DHE-RSA-AES256-SHA256 +SSLHonorCipherOrder on +SSLCompression off +SSLSessionTickets off + +# OCSP stapling +SSLUseStapling on +SSLStaplingResponderTimeout 5 +SSLStaplingReturnResponderErrors off +SSLStaplingCache shmcb:/var/run/ocsp(128000) + + + Redirect permanent / https://galaxy.example.org + + + + SSLEngine on + SSLCertificateFile /etc/apache2/ssl/server.crt + SSLCertificateKeyFile /etc/apache2/ssl/server.key + + # Enable HSTS + Header always set Strict-Transport-Security "max-age=15552000; includeSubdomains" + + # use a variable for convenience + Define galaxy_root /srv/galaxy/server + + # don't decode encoded slashes in path info + AllowEncodedSlashes NoDecode + + # enable compression on all relevant types + AddOutputFilterByType DEFLATE text/html text/plain text/xml + AddOutputFilterByType DEFLATE text/css + AddOutputFilterByType DEFLATE application/x-javascript application/javascript application/ecmascript + AddOutputFilterByType DEFLATE application/rss+xml + AddOutputFilterByType DEFLATE application/xml + AddOutputFilterByType DEFLATE application/json + + # allow access to static content + + AllowOverride None + Require all granted + + + # Galaxy needs to know that this is https for generating URLs + RequestHeader set X-URL-SCHEME "%{REQUEST_SCHEME}e" + + # allow up to 3 minutes for Galaxy to respond to slow requests before timing out + ProxyTimeout 180 + + # proxy all requests not matching other locations to uWSGI + ProxyPass / unix:///srv/galaxy/var/uwsgi.sock|uwsgi:// + # or uWSGI on a TCP socket + #ProxyPass / uwsgi://127.0.0.1:4001/ + + # serve framework static content + RewriteEngine On + RewriteRule ^/static/style/(.*) ${galaxy_root}/static/style/blue/$1 [L] + RewriteRule ^/static/(.*) ${galaxy_root}/static/$1 [L] + RewriteRule ^/favicon.ico ${galaxy_root}/static/favicon.ico [L] + RewriteRule ^/robots.txt ${galaxy_root}/static/robots.txt [L] + + # enable caching on static content + + ExpiresActive On + ExpiresDefault "access plus 24 hours" + + + # serve visualization and interactive environment plugin static content + + AllowOverride None + Require all granted + + RewriteRule ^/plugins/(.+)/(.+)/static/(.*)$ ${galaxy_root}/config/plugins/$1/$2/static/$3 [L] + +``` + +Be sure to set `galaxy_root` to the path to your copy of Galaxy and modify the value of `ProxyPass /` to match your +uWSGI socket path. With the default configuration, uWSGI will bind to a random TCP socket, so you will need to set it to +a fixed value as described in the [Scaling and Load Balancing](scaling.html) documentation. If using a UNIX domain +socket, be sure to pay particular attention to the discussion of users and permissions. + +### Implementation-specific Notes + +It is possible to perform the entire configuration in the main Apache configuration file, however, Apache packages as +provided by Linux distribution package managers typically provide a slightly more complex layout that is designed to +prevent conflicts in the main Apahce config file when updating the package. + +On Debian-based Linux distributions (Debian, Ubuntu, etc.), the Apache package's default configuration in +`/etc/apache2/apache2.conf` contains two include directives: + +- One which includes any configuration files with the `.conf` extension in the `/etc/apache2/conf-enabled` directory, + which contains symlinks to `/etc/apache2/confs-available`, where you would place global (non-VirtualHost) + configuration directives. +- One which includes all files in the `/etc/apache2/sites-enabled` directory, which contains symlinks to + `/etc/apache2/sites-available`, where you would place the `` configurations for websites hosted by this + Apache server. + +On EL-based Linux distributions (RedHat Enterprise Linux, CentOS, etc.), the Apache package's default configuration in +`/etc/httpd/conf/httpd.conf` contains a directive in that includes any configuration files with the `.conf` extension in +the `/etc/httpd/conf.d` directory. + +Thus, you might create: + +- `/etc/httpd/conf.d/galaxy_options.conf` on Debian-based distributions +- `/etc/apache2/confs-available/galaxy.conf` on Debian-based distributions + +With the global configuration directives: + +```apache +SSLProtocol all -SSLv3 +SSLCipherSuite ... +#... +``` + +Then for the site configurations, you might create: + +- `/etc/httpd/conf.d/galaxy_site.conf` on EL-based distributions +- `/etc/apache2/sites-available/galaxy` on Debian-based distributions + +With the `` blocks: + +```apache + + Redirect permanent / https://galaxy.example.org + + + + SSLEngine on + SSLCertificateFile /etc/apache2/ssl/server.crt + SSLCertificateKeyFile /etc/apache2/ssl/server.key + #... + +``` + +On Debian-based distribution, you'd then need to symlink the configs with (or do it by hand with `ln -s`): + +```shell-session +# a2enconf galaxy +# a2ensite galaxy +``` + +### Additional Notes + +- **Do not** simply copy the SSL configuration directives and expect them to work on your server or to be secure! These + are provided as examples of some of the best practices as of the time of writing, but will not always be up to date. + Use the guides referenced in [basic configuration](#basic-configuration) section to configure SSL properly. +- If your existing Apache configuration contains a line or included config file defining a default server, be sure to + disable it by commenting its `` or preventing its inclusion (under Debian-based operating systems, this + is done by removing its symlink from `/etc/apache2/sites-enabled`. +- `ProxyTimeout` can be adjusted as appropriate for your site. This is the amount of time allowed for communication + between Apache and uWSGI to block while waiting for a response from Galaxy, and is useful for holding client (browser) + connections while uWSGI is restarting Galaxy subprocesses or Galaxy is performing a slow operation. +- If your Apache server is set up to use `mod_security`, you may need to modify the value of the `SecRequestBodyLimit`. + The default value on some systems will limit uploads to only a few kilobytes. +- Some Galaxy URLs contain encoded slashes (%2F) in the path and Apache will not serve these URLs by default, which is + the reason for inclusion of the `AllowEncodedSlashes` directive. Note: The `NoDecode` value was added in Apache2 + 2.2.18, which is newer than EL 6's provided 2.2.15. +- If you must serve Galaxy without SSL, you would simply replace the `443` with `80` in the SSL `VirtualHost` block + and remove the non-SSL block and all SSL directives. +- If the proxy works but you are getting 404 errors for Galaxy's static content, be sure that the user that Apache runs + as has access to Galaxy's `static/` directory (and all its parent directories) on the filesystem. You can test this on + the command line with e.g. `sudo -u www-data ls /srv/galaxy/server/static`. + +### Serving Galaxy at a URL Prefix + +It may be necessary to serve Galaxy from an address other than the web server root (`https://www.example.org/galaxy`), +instead of `https://galaxy.example.org`). To do this, you need to make the following changes to the configuration in the +previous section: + +1. In the Apache config, prefix all of the location directives with your prefix, like so: + + ```apache + #... + + # proxy all requests not matching other locations to uWSGI + ProxyPass /galaxy unix:///srv/galaxy/var/uwsgi.sock|uwsgi:// + # or uWSGI on a TCP socket + #ProxyPass /galaxy uwsgi://127.0.0.1:4001/ + + # serve framework static content + RewriteEngine On + RewriteRule ^/galaxy/$ /galaxy [R,L] + RewriteRule ^/galaxy/static/style/(.*) ${galaxy_root}/static/style/blue/$1 [L] + RewriteRule ^/galaxy/static/(.*) ${galaxy_root}/static/$1 [L] + RewriteRule ^/galaxy/favicon.ico ${galaxy_root}/static/favicon.ico [L] + RewriteRule ^/galaxy/robots.txt ${galaxy_root}/static/robots.txt [L] + ``` + +2. The Galaxy application needs to be aware that it is running with a prefix (for generating URLs in dynamic pages). + This is accomplished by configuring uWSGI and Galaxy (the `uwsgi` and `galaxy` sections in `config/galaxy.yml` + respectively) like so and restarting Galaxy: + + ```yaml + uwsgi: + #... + socket: unix:///srv/galaxy/var/uwsgi.sock + mount: /galaxy=galaxy.webapps.galaxy.buildapp:uwsgi_app() + manage-script-name: true + # `module` MUST NOT be set when `mount` is in use + #module: galaxy.webapps.galaxy.buildapp:uwsgi_app() + + galaxy: + #... + cookie_path: /galaxy + ``` + + `cookie_path` should be set to prevent Galaxy's session cookies from clobbering each other if you are running more + than one instance of Galaxy under different URL prefixes on the same hostname. + + Be sure to consult the [Scaling and Load Balancing](scaling.html) documentation, other options unrelated to proxying + should also be set in the `uwsgi` section of the config. + +## Advanced Configuration Topics + +### Sending Files With Apache + +Galaxy sends files (e.g. dataset downloads) by opening the file and streaming it in chunks through the proxy server. +However, this ties up the Galaxy process, which can impact the performance of other operations (see [Production Server +Configuration](production.html) for a more in-depth explanation). + +Apache can assume this task instead and as an added benefit, speed up downloads. This is accomplished through the use of +`mod_xsendfile`, a 3rd-party Apache module. Dataset security is maintained in this configuration because Apache will +still check with Galaxy to ensure that the requesting user has permission to access the dataset before sending it. + +To enable it, you must first install `mod_xsendfile`. This is usually available via your package manager +(`libapache2-mod-xsendfile` on Debian-based distributions and `mod_xsendfile` from EPEL on EL-based distributions). Once +installed, add the appropriate `LoadModule` directive to your Apache configuration (`LoadModule xsendfile_module +/path/to/mod_xsendfile.so`, but both the Debian and EPEL packages do this for you upon installation). + +The, add `XSendFile` directives to your proxy configuration: + +```apache + + XSendFile on + XSendFilePath / + +``` + +Next, edit `galaxy.yml` and make the following change before restarting Galaxy: + +```yaml +galaxy: + # ... + apache_xsendfile: true +``` + +For this to work, the user under which your Apache server runs will need read access to Galaxy's `files_path` directory +(by default, `database/files/`) and its contents. This is most easily done by adding the Apache user to the Galaxy user's +primary group and setting the `umask(2)` to create files with the group read permission set. If you start Galaxy from +the command line, you can do this like so: + +```shell-session +admin@server$ sudo usermod -a -G galaxy www-data # add `www-data` user to `galaxy` group +admin@server$ sudo -iu galaxy +galaxy@server$ umask 027 +galaxy@server$ sh run.sh +``` + +If you start Galaxy from supervisord, you can set the `umask` option in the [program +section](http://supervisord.org/configuration.html#program-x-section-settings) after adding the Apache user to the Galaxy +group as shown above. + +### External user authentication + +- [Apache for External Authentication](https://galaxyproject.org/admin/config/apache-external-user-auth/) +- [Built-in Galaxy External Authentication](authentication.html) + +#### Display Sites + +Display sites such as UCSC work not by sending data directly from Galaxy to UCSC via the client's browser, but by +sending UCSC a URL to the data in Galaxy that the UCSC server will retrieve data from. Since enabling authentication +will place **all** of Galaxy behind authentication, such display sites will no longer be able to access data via that +URL. If `display_servers` is set to a non-empty value in `$galaxy_root/config/galaxy.yml`, this tells Galaxy it should +allow the named servers access to data in Galaxy. However, you still need to configure Apache to allow access to the +datasets. An example config is provided here that allows the UCSC Main/Test backends: + +```apache + + Satisfy Any + Order deny,allow + Deny from all + Allow from hgw1.cse.ucsc.edu + Allow from hgw2.cse.ucsc.edu + Allow from hgw3.cse.ucsc.edu + Allow from hgw4.cse.ucsc.edu + Allow from hgw5.cse.ucsc.edu + Allow from hgw6.cse.ucsc.edu + Allow from hgw7.cse.ucsc.edu + Allow from hgw8.cse.ucsc.edu + +``` + +**PLEASE NOTE that this introduces a security hole** , the impact of which depends on whether you have restricted access +to the dataset via Galaxy's [internal dataset permissions](https://galaxyproject.org/learn/security-features/). + +- By default, data in Galaxy is public. Normally with a Galaxy server behind authentication in a proxy server this is of + little concern since only clients who've authenticated can access Galaxy. However, if display site exceptions are made + as shown above, anyone could use those public sites to bypass authentication and view any **public** dataset on your + Galaxy server. If you have not changed from the default and most of your datasets are public, you should consider + running your own display sites that are also behind authentication rather than using the public ones. + +- For datasets for which access has been restricted to one or more roles (i.e. it is no longer "public"), access for + reading via external browsers is only allowed for a brief period, when someone with access permission clicks the + "display at..." link. During this period, anyone who has the dataset ID would then be able to use the browser to view + this dataset. Although such a scenario is unlikely, it is technically possible. diff --git a/doc/source/admin/index.rst b/doc/source/admin/index.rst index 032064a6ac9..e667df8cabe 100644 --- a/doc/source/admin/index.rst +++ b/doc/source/admin/index.rst @@ -11,6 +11,7 @@ This documentation is in the midst of being ported and unified based on resource production scaling nginx + apache cluster jobs tool_panel diff --git a/doc/source/admin/nginx.md b/doc/source/admin/nginx.md index 2c71c679c51..d93b7533b58 100644 --- a/doc/source/admin/nginx.md +++ b/doc/source/admin/nginx.md @@ -5,10 +5,6 @@ Galaxy sites ([Main](https://galaxyproject.org/main/) and [Test](https://galaxyp [Docker Galaxy project](https://github.com/bgruening/docker-galaxy-stable) use nginx to proxy rather than Apache for its simple, fast load balancing and other features. -```eval_rst -.. warning:: Please note that Galaxy should *never* be located on disk inside nginx's document root. By default, this - would expose all of Galaxy (including datasets) to anyone on the web. -``` ## Prerequisites @@ -25,6 +21,11 @@ For the purposes of this example, we assume that: Throughout the configuration examples in this document, in order to avoid reptition, `#...` is used to denote a location where existing or previously given configuration statements would appear. +```eval_rst +.. warning:: Please note that Galaxy should *never* be located on disk inside nginx's document root. By default, this + would expose all of Galaxy (including datasets) to anyone on the web. +``` + ## Basic Configuration The use of SSL is **strongly encouraged** to avoid exposure of confidential information such as datasets and user @@ -313,7 +314,7 @@ previous section: Galaxy sends files (e.g. dataset downloads) by opening the file and streaming it in chunks through the proxy server. However, this ties up the Galaxy process, which can impact the performance of other operations (see [Production Server -Configuration](/src/admin/config/performance/production-server/index.md) for a more in-depth explanation). +Configuration](production.html) for a more in-depth explanation). Nginx can assume this task instead and as an added benefit, speed up downloads. This is accomplished through the use of the special `X-Accel-Redirect` header. Dataset security is maintained in this configuration because nginx will still @@ -459,4 +460,4 @@ To secure this page to only Galaxy administrators, adjust your nginx config acco ### External User Authentication - [Nginx for External Authentication](https://galaxyproject.org/admin/config/nginx-external-user-auth/) -- [Built-in Galaxy External Authentication](../authentication.html) +- [Built-in Galaxy External Authentication](authentication.html) diff --git a/doc/source/admin/production.md b/doc/source/admin/production.md index ae6310f25ce..9d18219c850 100644 --- a/doc/source/admin/production.md +++ b/doc/source/admin/production.md @@ -95,7 +95,7 @@ Downloading and uploading data can also be moved to the proxy server. This is e Virtually any server that proxies HTTP should work, although we provide configuration examples for: -* [Apache](special_topics/apache.html), and +* [Apache](apache.html), and * [nginx](nginx.html), a high performance reverse proxy, used by our public Galaxy sites ### Using a compute cluster @@ -163,4 +163,4 @@ Finally, if you are using Galaxy <= release_2014.06.02, we recommend that you in ### Make the proxy handle uploads and downloads -By default, Galaxy receives file uploads as a stream from the proxy server and then writes this file to disk. Likewise, it sends files as a stream to the proxy server. This occupies the GIL in that Galaxy process and will decrease responsiveness for other operations in that process. To solve this problem, you can configure your proxy server to serve downloads directly, involving Galaxy only for the task of authorizing that the user has permission to read the dataset. If using nginx as the proxy, you can configure it to receive uploaded files and write them to disk itself, only notifying Galaxy of the upload once it's completed. All the details on how to configure these can be found on the [Apache](special_topics/apache.html) and [nginx](nginx.html) proxy instruction pages. +By default, Galaxy receives file uploads as a stream from the proxy server and then writes this file to disk. Likewise, it sends files as a stream to the proxy server. This occupies the GIL in that Galaxy process and will decrease responsiveness for other operations in that process. To solve this problem, you can configure your proxy server to serve downloads directly, involving Galaxy only for the task of authorizing that the user has permission to read the dataset. If using nginx as the proxy, you can configure it to receive uploaded files and write them to disk itself, only notifying Galaxy of the upload once it's completed. All the details on how to configure these can be found on the [Apache](apache.html) and [nginx](nginx.html) proxy instruction pages. diff --git a/doc/source/admin/scaling.md b/doc/source/admin/scaling.md index 02c40562ee9..8829f18ff90 100644 --- a/doc/source/admin/scaling.md +++ b/doc/source/admin/scaling.md @@ -66,7 +66,7 @@ roles (serving static content, serving dataset downloads, etc.) as described in configuration](production.html) documentation. When using uWSGI with a proxy server, it is recommended that you use the native high performance uWSGI protocol -(supported by both [Apache](special_topics/apache.html) and [nginx](nginx.html)) between uWSGI and the +(supported by both [Apache](apache.html) and [nginx](nginx.html)) between uWSGI and the proxy server, rather than HTTP. ### uWSGI with jobs handled by web workers (default configuration) @@ -248,7 +248,7 @@ permission on the socket. Because Galaxy and the proxy server most likely run as be the case by default. One common solution is to add the proxy server's user to the Galaxy user's primary group. uWSGI's `chmod-socket` option can also help here. -You can consult the Galaxy documentation for [Apache](special_topics/apache.html) or [nginx](nginx.html) +You can consult the Galaxy documentation for [Apache](apache.html) or [nginx](nginx.html) for help with the proxy-side configuration. By setting the `socket` option, `run.sh` will no longer automatically serve Galaxy via HTTP (since it is assumed that diff --git a/doc/source/admin/special_topics/apache.md b/doc/source/admin/special_topics/apache.md deleted file mode 100644 index 8e9fe6c8f29..00000000000 --- a/doc/source/admin/special_topics/apache.md +++ /dev/null @@ -1,228 +0,0 @@ -# Proxying Galaxy with Apache - -For various reasons (performance, authentication, etc.) in a production environment, it's recommended to run Galaxy behind a web server proxy. Although any proxy could work, Apache is a common choice. Alternatively, we use [nginx](http://nginx.net/) for our public sites and open source infrastructure, and [details are available](./nginx.html) for it, too. - -Currently the only recommended way to run Galaxy with Apache is using `mod_rewrite` and `mod_proxy`. Either `mod_proxy_uwsgi` or `mod_proxy_http` may be used from there. - -To support proxying, the `mod_proxy`, `mod_http_proxy` and `mod_rewrite` modules must be enabled in the Apache config. The main proxy directives, `ProxyRequests` and `ProxyVia` do **not** need to be enabled. - -## Prerequisites - -Make sure that inbound (and outbound) traffic to the TCP protocol HTTP on port 80 (and HTTPS on port 443 if using SSL) is permitted by your server's firewall/security. - -```eval_rst -.. warning:: Please note that Galaxy should *never* be located on disk inside Apache's `DocumentRoot`. By default, this would expose all of Galaxy (including datasets) to anyone on the web. -``` - -## Basic configuration - -### Allow Encoded Slashes in URLs - -Some Galaxy URLs contain encoded slashes (%2F) in the path and Apache will not serve these URLs by default. To configure Apache to serve URLs with encoded slashes in the path, add the following line to your Apache configuration file: - -```apache -AllowEncodedSlashes NoDecode -``` - -**Note**: The `NoDecode` setting was added in httpd 2.2.18, and CentOS 6 (as RHEL 6 does) only has 2.2.15. The [CentOS SCLo SIG Repo](https://wiki.centos.org/SpecialInterestGroup/SCLo/CollectionsList) has an httpd24 package. - -### Serving Galaxy at the web server root (/) - -For a default Galaxy configuration running on [http://localhost:8080/](http://localhost:8080/), the following lines in the Apache configuration will proxy requests to the Galaxy application: - -```apache -# Rewrite -RewriteEngine on -RewriteRule ^(.*) http://localhost:8080$1 [P] -``` - -Or, if using `mod_proxy` with HTTP transport - -```apache -ProxyPass / http://127.0.0.1:8080/ -``` - -Or, if using `mod_proxy` with uWSGI transport - -```apache -ProxyPass / uwsgi://127.0.0.1:4001/ -``` - -Thus, all requests on your server are now redirected to Galaxy. Because this example uses the "root" of your web server, you may want to use a [VirtualHost](http://httpd.apache.org/docs/2.2/vhosts/) to be able to run other sites from this same server. - -If your Apache server is set up to use `mod_security`, you may need to modify the value of the `SecRequestBodyLimit`. The default value on some systems will limit uploads to only a few kilobytes. - -Since Apache is more efficient at serving static content, it is best to serve it directly, reducing the load on the Galaxy process and allowing for more effective compression (if enabled), caching, and pipelining. To do so, your configuration will now include the following, where `$GALAXY_ROOT` should be replaced with the filesystem path to your Galaxy installation - -```apache -RewriteEngine on -RewriteRule ^/static/style/(.*) $GALAXY_ROOT/static/june_2007_style/blue/$1 [L] -RewriteRule ^/static/scripts/(.*) $GALAXY_ROOT/static/scripts/packed/$1 [L] -RewriteRule ^/static/(.*) $GALAXY_ROOT/static/$1 [L] -RewriteRule ^/favicon.ico $GALAXY_ROOT/static/favicon.ico [L] -RewriteRule ^/robots.txt $GALAXY_ROOT/static/robots.txt [L] -``` - -You will need to ensure that filesystem permissions are set such that the user running your Apache server has access to the Galaxy static/ directory. - -### Serving Galaxy at a sub directory (such as /galaxy) - -It may be necessary to house Galaxy at an address other than the web server root (`http://www.example.org/galaxy`), instead of `http://www.example.org`). To do this, you need to make the following changes: - -Two changes are necessary: - -1. In the apache config, prefix all of the location directives with your prefix, like so: - -```apache -RewriteEngine on -RewriteRule ^/galaxy/static/style/(.*) $GALAXY_ROOT/static/june_2007_style/blue/$1 [L] -RewriteRule ^/galaxy/static/scripts/(.*) $GALAXY_ROOT/static/scripts/packed/$1 [L] -RewriteRule ^/galaxy/static/(.*) $GALAXY_ROOT/static/$1 [L] -RewriteRule ^/galaxy/favicon.ico $GALAXY_ROOT/static/favicon.ico [L] -RewriteRule ^/galaxy/robots.txt $GALAXY_ROOT/static/robots.txt [L] -``` - -Note the first rewrite rule deals with the missing trailing slash problem. If left out, [http://www.example.org/galaxy](http://www.example.org/galaxy) will result in a 404 error. - -If you are using `mod_rewrite` for serving: - -``` -RewriteRule ^/galaxy$ /galaxy/ [R] -RewriteRule ^/galaxy(.*) http://localhost:8080$1 [P] -``` - -Or for `proxy_http`/`proxy_uwsgi`: - -``` -ProxyPass /galaxy http://127.0.0.1:8080/galaxy -# or -ProxyPass /galaxy uwsgi://127.0.0.1:4001/ -``` - -2. The Galaxy application needs to be aware that it is running with a prefix (for generating URLs in dynamic pages). This is accomplished by configuring a Paste proxy-prefix filter in the `[app:main]` section of `config/galaxy.ini` and restarting Galaxy: - - -```ini -[filter:proxy-prefix] -use = egg:PasteDeploy#prefix -prefix = /galaxy - -[app:main] -filter-with = proxy-prefix -cookie_path = /galaxy -``` - -`cookie_prefix` should be set to prevent Galaxy's session cookies from clobbering each other if running more than one instance of Galaxy in different subdirectories on the same hostname. - -### SSL - -If you place Galaxy behind a proxy address that uses SSL (i.e., `https://` URLs), edit your galaxy location block (e.g. `location /` when served at the root, or something else like `location /galaxy` when served under a prefix) - -```apache - - ... - RequestHeader set X-URL-SCHEME https - ... - -``` - -Setting `X-URL-SCHEME` makes Galaxy aware of what type of URL it should generate for external sites like Biomart. This should be added to the existing `` block if you already have one, and adjusted accordingly if you're serving Galaxy from a subdirectory. - -## Advanced Configuration Topics - -### Compression and caching - -All of Galaxy's static content can be cached on the client side, and everything (including dynamic content) can be compressed on the fly. This will decrease download and page load times for your clients, as well as decrease server load and bandwidth usage. To enable, you'll need to load `mod_deflate` and `mod_expires` in your Apache configuration, and then set: - -```apache - - ... - # Compress all uncompressed content. - SetOutputFilter DEFLATE - SetEnvIfNoCase Request_URI \.(?:gif|jpe?g|png)$ no-gzip dont-vary - SetEnvIfNoCase Request_URI \.(?:t?gz|zip|bz2)$ no-gzip dont-vary - SetEnvIfNoCase Request_URI /history/export_archive no-gzip dont-vary - - - # Allow browsers to cache everything from /static for 6 hours - ExpiresActive On - ExpiresDefault "access plus 6 hours" - ... - -``` - -The contents above should be added to the existing `` block if you already have one, and adjusted accordingly if you're serving Galaxy from a subdirectory. - -### Sending files using Apache - -Galaxy sends files (e.g. dataset downloads) by opening the file and streaming it in chunks through the proxy server. However, this ties up the Galaxy process, which can impact the performance of other operations (see [production configuration](../production.html) for a more in-depth explanation). - -Apache can assume this task instead and as an added benefit, speed up downloads. This is accomplished through the use of `mod_xsendfile`, a 3rd-party Apache module. Dataset security is maintained in this configuration because Apache will still check with Galaxy to ensure that the requesting user has permission to access the dataset before sending it. - -To enable it, you must first install `mod_xsendfile`, this is usually available via your OS's repositories. Once done, add the appropriate `LoadModule` directive to your Apache configuration to load the xsendfile module and the `XSendFile` directives to your proxy configuration: - -```apache - - XSendFile on - XSendFilePath / - -``` - -Finally edit your `$GALAXY_ROOT/config/galaxy.yml` and make the following change before restarting Galaxy: - -```yaml -galaxy: - # ... - apache_xsendfile: true -``` - -For this to work, the user under which your nginx server runs will need read access to Galaxy's `$GALAXY_ROOT/database/files/` directory and its contents. - -### External user authentication - -- [Apache for External Authentication](https://galaxyproject.org/admin/config/apache-external-user-auth/) -- [Built-in Galaxy External Authentication](../authentication.html) - -### Display Sites - -Display sites such as UCSC work not by sending data directly from Galaxy to UCSC via the client's browser, but by sending UCSC a URL to the data in Galaxy that the UCSC server will retrieve data from. Since enabling authentication will place **all** of Galaxy behind authentication, such display sites will no longer be able to access data via that URL. If `display_servers` is set to a non-empty value in `$GALAXY_ROOT/config/galaxy.yml`, this tells Galaxy it should allow the named servers access to data in Galaxy. However, you still need to configure Apache to allow access to the datasets. An example config is provided here that allows the UCSC Main/Test backends: - -```apache - - Satisfy Any - Order deny,allow - Deny from all - Allow from hgw1.cse.ucsc.edu - Allow from hgw2.cse.ucsc.edu - Allow from hgw3.cse.ucsc.edu - Allow from hgw4.cse.ucsc.edu - Allow from hgw5.cse.ucsc.edu - Allow from hgw6.cse.ucsc.edu - Allow from hgw7.cse.ucsc.edu - Allow from hgw8.cse.ucsc.edu - -``` - -**PLEASE NOTE that this introduces a security hole** , the impact of which depends on whether you have restricted access to the dataset via Galaxy's [internal dataset permissions](https://galaxyproject.org/learn/security-features/). - -- By default, data in Galaxy is public. Normally with a Galaxy server behind authentication in a proxy server this is of little concern since only clients who've authenticated can access Galaxy. However, if display site exceptions are made as shown above, anyone could use those public sites to bypass authentication and view any **public** dataset on your Galaxy server. If you have not changed from the default and most of your datasets are public, you should consider running your own display sites that are also behind authentication rather than using the public ones. - -- For datasets for which access has been restricted to one or more roles (i.e. it is no longer "public"), access for reading via external browsers is only allowed for a brief period, when someone with access permission clicks the "display at..." link. During this period, anyone who has the dataset ID would then be able to use the browser to view this dataset. Although such a scenario is unlikely, it is technically possible. - - -### Proxying multiple galaxy worker threads - -If you've configured multiple threads for galaxy in the `config/galaxy.yml` file, you will need a `ProxyBalancer` to manage sending requests to each of the threads. You can do that with apache configuration as follows: - -```apache - - BalancerMember http://localhost:8400 - BalancerMember http://localhost:8401 - - - -# Replace the following line from the regular proxy configuration: -# RewriteRule ^(.*) http://localhost:8080$1 [P] -# With: -RewriteRule ^(.*) balancer://galaxy$1 [P] -``` diff --git a/doc/source/admin/special_topics/index.rst b/doc/source/admin/special_topics/index.rst index 507e2b4cffe..f069300e744 100644 --- a/doc/source/admin/special_topics/index.rst +++ b/doc/source/admin/special_topics/index.rst @@ -5,7 +5,6 @@ Special Topics .. toctree:: :maxdepth: 2 - apache ftp interactive_environments mulled_containers diff --git a/lib/galaxy/webapps/galaxy/api/configuration.py b/lib/galaxy/webapps/galaxy/api/configuration.py index 25f4f8d9e96..d70b0e27da1 100644 --- a/lib/galaxy/webapps/galaxy/api/configuration.py +++ b/lib/galaxy/webapps/galaxy/api/configuration.py @@ -87,6 +87,9 @@ class ConfigurationController(BaseAPIController): @expose_api @require_admin def dynamic_tool_confs(self, trans): + # WARNING: If this method is ever changed so as not to require admin privileges, update the nginx proxy + # documentation, since this path is used as an authentication-by-proxy method for securing other paths on the + # server. A dedicated endpoint should probably be added to do that instead. confs = self.app.toolbox.dynamic_confs(include_migrated_tool_conf=True) return map(_tool_conf_to_dict, confs) From 78992968ecd0de1f95b99352b53ea2ecd246f954 Mon Sep 17 00:00:00 2001 From: Nate Coraor Date: Thu, 11 Jan 2018 16:40:05 -0500 Subject: [PATCH 077/112] Correct documentation line endings --- doc/source/admin/apache.md | 820 ++++++++++++++++---------------- doc/source/admin/nginx.md | 926 ++++++++++++++++++------------------- 2 files changed, 873 insertions(+), 873 deletions(-) diff --git a/doc/source/admin/apache.md b/doc/source/admin/apache.md index 50b7faf3c53..07119971409 100644 --- a/doc/source/admin/apache.md +++ b/doc/source/admin/apache.md @@ -1,410 +1,410 @@ -# Proxying Galaxy with Apache - -For various reasons (performance, authentication, etc.) in a production environment, it's recommended to run Galaxy -behind a web server proxy. Although any proxy could work, Apache is a common choice. Alternatively, we use -[nginx](http://nginx.net/) for our public sites and open source infrastructure, and [details are -available](nginx.html) for it, too. - -Currently, the only recommended way to run Galaxy with Apache is using `mod_rewrite`, `mod_proxy`, and -`mod_proxy_uwsgi`. These modules must be enabled in the Apache config. The main proxy directives, `ProxyRequests` and -`ProxyVia` do **not** need to be enabled. - -## Prerequisites - -Make sure that inbound (and outbound) traffic to the TCP protocol HTTP on port 80 (and HTTPS on port 443 if using SSL) -is permitted by your server's firewall/security. - -These directions are written for Apache 2.4+. Apache 2.4 for Enterprise Linux (EL) 6 can be obtained from the [CentOS -SCLo SIG Repo](https://wiki.centos.org/SpecialInterestGroup/SCLo/CollectionsList). - -Ensure that the `mod_headers`, `mod_rewrite`, `mod_proxy`, and `mod_proxy_uwsgi` modules are loaded. Although not -required, the configuration examples also use `mod_deflate` and `mod_expires` for increased client/server performance, -so these should also be enabled. On Debian-based Linux distributions, you can do this with: - -```shell-session -# apt-get install apache2 libapache2-mod-proxy-uwsgi -# a2enmod headers deflate expires rewrite proxy proxy_uwsgi -Enabling module headers. -Considering dependency filter for deflate: -Module filter already enabled -Module deflate already enabled -Enabling module expires. -Enabling module rewrite. -Enabling module proxy. -Considering dependency proxy for proxy_uwsgi: -Module proxy already enabled -Enabling module proxy_uwsgi. -To activate the new configuration, you need to run: - service apache2 restart -``` - -On EL-based distributions, you will need to enable the [EPEL](https://fedoraproject.org/wiki/EPEL) repository and then: - -```shell-session -# yum install httpd mod_proxy_uwsgi -# echo "LoadModule proxy_uwsgi_module modules/mod_proxy_uwsgi.so" > /etc/httpd/conf.modules.d/10-proxy-uwsgi.conf -``` - -For the purposes of this example, we assume that: - -- the Galaxy server is installed at `/srv/galaxy/server` -- Apache runs as the user `www-data` (this is the default under Debian-based Linux distributions) -- Galaxy runs as the user `galaxy` with primary group `galaxy` -- Galaxy is served from the hostname `galaxy.example.org` - -Throughout the configuration examples in this document, in order to avoid reptition, `#...` is used to denote a location -where existing or previously given configuration statements would appear. - -```eval_rst -.. warning:: Please note that Galaxy should *never* be located on disk inside Apache's `DocumentRoot`. By default, this - would expose all of Galaxy (including datasets) to anyone on the web. -``` - -## Basic configuration - -The use of SSL is **strongly encouraged** to avoid exposure of confidential information such as datasets and user -credentials to eavesdroppers. The instructions in this document are for setting an SSL-enabled Galaxy server. - -When setting up an SSL server, simply enabling SSL with the default options is not enough. In most cases, the -configuration is weak and vulnerable to one or more of the multitude of SSL attacks that have been recently prevalent. -The [Qualys SSL/TLS Deployment Best Practices](https://www.ssllabs.com/projects/best-practices/) is an excellent and -up-to-date guide covering everything necessary for securing an SSL server. In addition, the [Mozilla SSL Configuration -Generator](https://mozilla.github.io/server-side-tls/ssl-config-generator/) can provide you with a best practices config -tailored to your desired security level and software versions. - -Finally, Google's [PageSpeed Insights](https://developers.google.com/speed/pagespeed/insights/) tool is helpful for -determining how you can improve responsiveness as related to proxying, such as verifying that caching and compression -are configured properly. - -If you need to run more than one site on your Galaxy server, there are two options: - -- Run them on the same server but serve them on different hostnames -- Serve them from different URL prefixes on a single hostname - -The former option is typically cleaner, but if serving more than one SSL site, you will need an SSL certificate with -[subjectAltName](http://wiki.cacert.org/FAQ/subjectAltName)s for each hostname served by the server. - -### Serving Galaxy at the Web Server Root - -This configuration assumes that Galaxy will be the only site on your server using the given hostname (e.g. -`https://galaxy.example.org`). - -Beginning with Galaxy Release 18.01, the default application server that Galaxy runs under is uWSGI. Because of this, -the native high performance uWSGI protocol should be used for communication between the proxy server and Galaxy, rather -than HTTP. Legacy instructions for proxying via HTTP can be found in the [Galaxy Release 17.09 Apache -documentation](https://docs.galaxyproject.org/en/release_17.09/admin/special_topics/apache.html). - -Since Apache is more efficient than uWSGI at serving static content, it is best to serve it directly, reducing the load -on the Galaxy process and allowing for more effective compression (if enabled), caching, and pipelining. Directives to -do so are included in the example below. - -The following configuration is not exhaustive, only the portions most relevant to serving Galaxy are shown, these should -be incorporated with your existing/default Apache config as is appropriate for your server: - -```apache -SSLProtocol all -SSLv3 -SSLCipherSuite ECDHE-ECDSA-AES128-GCM-SHA256:ECDHE-ECDSA-AES256-GCM-SHA384:ECDHE-ECDSA-AES128-SHA:ECDHE-ECDSA-AES256-SHA:ECDHE-ECDSA-AES128-SHA256:ECDHE-ECDSA-AES256-SHA384:ECDHE-RSA-AES128-GCM-SHA256:ECDHE-RSA-AES256-GCM-SHA384:ECDHE-RSA-AES128-SHA:ECDHE-RSA-AES256-SHA:ECDHE-RSA-AES128-SHA256:ECDHE-RSA-AES256-SHA384:DHE-RSA-AES128-GCM-SHA256:DHE-RSA-AES256-GCM-SHA384:DHE-RSA-AES128-SHA:DHE-RSA-AES256-SHA:DHE-RSA-AES128-SHA256:DHE-RSA-AES256-SHA256 -SSLHonorCipherOrder on -SSLCompression off -SSLSessionTickets off - -# OCSP stapling -SSLUseStapling on -SSLStaplingResponderTimeout 5 -SSLStaplingReturnResponderErrors off -SSLStaplingCache shmcb:/var/run/ocsp(128000) - - - Redirect permanent / https://galaxy.example.org - - - - SSLEngine on - SSLCertificateFile /etc/apache2/ssl/server.crt - SSLCertificateKeyFile /etc/apache2/ssl/server.key - - # Enable HSTS - Header always set Strict-Transport-Security "max-age=15552000; includeSubdomains" - - # use a variable for convenience - Define galaxy_root /srv/galaxy/server - - # don't decode encoded slashes in path info - AllowEncodedSlashes NoDecode - - # enable compression on all relevant types - AddOutputFilterByType DEFLATE text/html text/plain text/xml - AddOutputFilterByType DEFLATE text/css - AddOutputFilterByType DEFLATE application/x-javascript application/javascript application/ecmascript - AddOutputFilterByType DEFLATE application/rss+xml - AddOutputFilterByType DEFLATE application/xml - AddOutputFilterByType DEFLATE application/json - - # allow access to static content - - AllowOverride None - Require all granted - - - # Galaxy needs to know that this is https for generating URLs - RequestHeader set X-URL-SCHEME "%{REQUEST_SCHEME}e" - - # allow up to 3 minutes for Galaxy to respond to slow requests before timing out - ProxyTimeout 180 - - # proxy all requests not matching other locations to uWSGI - ProxyPass / unix:///srv/galaxy/var/uwsgi.sock|uwsgi:// - # or uWSGI on a TCP socket - #ProxyPass / uwsgi://127.0.0.1:4001/ - - # serve framework static content - RewriteEngine On - RewriteRule ^/static/style/(.*) ${galaxy_root}/static/style/blue/$1 [L] - RewriteRule ^/static/(.*) ${galaxy_root}/static/$1 [L] - RewriteRule ^/favicon.ico ${galaxy_root}/static/favicon.ico [L] - RewriteRule ^/robots.txt ${galaxy_root}/static/robots.txt [L] - - # enable caching on static content - - ExpiresActive On - ExpiresDefault "access plus 24 hours" - - - # serve visualization and interactive environment plugin static content - - AllowOverride None - Require all granted - - RewriteRule ^/plugins/(.+)/(.+)/static/(.*)$ ${galaxy_root}/config/plugins/$1/$2/static/$3 [L] - -``` - -Be sure to set `galaxy_root` to the path to your copy of Galaxy and modify the value of `ProxyPass /` to match your -uWSGI socket path. With the default configuration, uWSGI will bind to a random TCP socket, so you will need to set it to -a fixed value as described in the [Scaling and Load Balancing](scaling.html) documentation. If using a UNIX domain -socket, be sure to pay particular attention to the discussion of users and permissions. - -### Implementation-specific Notes - -It is possible to perform the entire configuration in the main Apache configuration file, however, Apache packages as -provided by Linux distribution package managers typically provide a slightly more complex layout that is designed to -prevent conflicts in the main Apahce config file when updating the package. - -On Debian-based Linux distributions (Debian, Ubuntu, etc.), the Apache package's default configuration in -`/etc/apache2/apache2.conf` contains two include directives: - -- One which includes any configuration files with the `.conf` extension in the `/etc/apache2/conf-enabled` directory, - which contains symlinks to `/etc/apache2/confs-available`, where you would place global (non-VirtualHost) - configuration directives. -- One which includes all files in the `/etc/apache2/sites-enabled` directory, which contains symlinks to - `/etc/apache2/sites-available`, where you would place the `` configurations for websites hosted by this - Apache server. - -On EL-based Linux distributions (RedHat Enterprise Linux, CentOS, etc.), the Apache package's default configuration in -`/etc/httpd/conf/httpd.conf` contains a directive in that includes any configuration files with the `.conf` extension in -the `/etc/httpd/conf.d` directory. - -Thus, you might create: - -- `/etc/httpd/conf.d/galaxy_options.conf` on Debian-based distributions -- `/etc/apache2/confs-available/galaxy.conf` on Debian-based distributions - -With the global configuration directives: - -```apache -SSLProtocol all -SSLv3 -SSLCipherSuite ... -#... -``` - -Then for the site configurations, you might create: - -- `/etc/httpd/conf.d/galaxy_site.conf` on EL-based distributions -- `/etc/apache2/sites-available/galaxy` on Debian-based distributions - -With the `` blocks: - -```apache - - Redirect permanent / https://galaxy.example.org - - - - SSLEngine on - SSLCertificateFile /etc/apache2/ssl/server.crt - SSLCertificateKeyFile /etc/apache2/ssl/server.key - #... - -``` - -On Debian-based distribution, you'd then need to symlink the configs with (or do it by hand with `ln -s`): - -```shell-session -# a2enconf galaxy -# a2ensite galaxy -``` - -### Additional Notes - -- **Do not** simply copy the SSL configuration directives and expect them to work on your server or to be secure! These - are provided as examples of some of the best practices as of the time of writing, but will not always be up to date. - Use the guides referenced in [basic configuration](#basic-configuration) section to configure SSL properly. -- If your existing Apache configuration contains a line or included config file defining a default server, be sure to - disable it by commenting its `` or preventing its inclusion (under Debian-based operating systems, this - is done by removing its symlink from `/etc/apache2/sites-enabled`. -- `ProxyTimeout` can be adjusted as appropriate for your site. This is the amount of time allowed for communication - between Apache and uWSGI to block while waiting for a response from Galaxy, and is useful for holding client (browser) - connections while uWSGI is restarting Galaxy subprocesses or Galaxy is performing a slow operation. -- If your Apache server is set up to use `mod_security`, you may need to modify the value of the `SecRequestBodyLimit`. - The default value on some systems will limit uploads to only a few kilobytes. -- Some Galaxy URLs contain encoded slashes (%2F) in the path and Apache will not serve these URLs by default, which is - the reason for inclusion of the `AllowEncodedSlashes` directive. Note: The `NoDecode` value was added in Apache2 - 2.2.18, which is newer than EL 6's provided 2.2.15. -- If you must serve Galaxy without SSL, you would simply replace the `443` with `80` in the SSL `VirtualHost` block - and remove the non-SSL block and all SSL directives. -- If the proxy works but you are getting 404 errors for Galaxy's static content, be sure that the user that Apache runs - as has access to Galaxy's `static/` directory (and all its parent directories) on the filesystem. You can test this on - the command line with e.g. `sudo -u www-data ls /srv/galaxy/server/static`. - -### Serving Galaxy at a URL Prefix - -It may be necessary to serve Galaxy from an address other than the web server root (`https://www.example.org/galaxy`), -instead of `https://galaxy.example.org`). To do this, you need to make the following changes to the configuration in the -previous section: - -1. In the Apache config, prefix all of the location directives with your prefix, like so: - - ```apache - #... - - # proxy all requests not matching other locations to uWSGI - ProxyPass /galaxy unix:///srv/galaxy/var/uwsgi.sock|uwsgi:// - # or uWSGI on a TCP socket - #ProxyPass /galaxy uwsgi://127.0.0.1:4001/ - - # serve framework static content - RewriteEngine On - RewriteRule ^/galaxy/$ /galaxy [R,L] - RewriteRule ^/galaxy/static/style/(.*) ${galaxy_root}/static/style/blue/$1 [L] - RewriteRule ^/galaxy/static/(.*) ${galaxy_root}/static/$1 [L] - RewriteRule ^/galaxy/favicon.ico ${galaxy_root}/static/favicon.ico [L] - RewriteRule ^/galaxy/robots.txt ${galaxy_root}/static/robots.txt [L] - ``` - -2. The Galaxy application needs to be aware that it is running with a prefix (for generating URLs in dynamic pages). - This is accomplished by configuring uWSGI and Galaxy (the `uwsgi` and `galaxy` sections in `config/galaxy.yml` - respectively) like so and restarting Galaxy: - - ```yaml - uwsgi: - #... - socket: unix:///srv/galaxy/var/uwsgi.sock - mount: /galaxy=galaxy.webapps.galaxy.buildapp:uwsgi_app() - manage-script-name: true - # `module` MUST NOT be set when `mount` is in use - #module: galaxy.webapps.galaxy.buildapp:uwsgi_app() - - galaxy: - #... - cookie_path: /galaxy - ``` - - `cookie_path` should be set to prevent Galaxy's session cookies from clobbering each other if you are running more - than one instance of Galaxy under different URL prefixes on the same hostname. - - Be sure to consult the [Scaling and Load Balancing](scaling.html) documentation, other options unrelated to proxying - should also be set in the `uwsgi` section of the config. - -## Advanced Configuration Topics - -### Sending Files With Apache - -Galaxy sends files (e.g. dataset downloads) by opening the file and streaming it in chunks through the proxy server. -However, this ties up the Galaxy process, which can impact the performance of other operations (see [Production Server -Configuration](production.html) for a more in-depth explanation). - -Apache can assume this task instead and as an added benefit, speed up downloads. This is accomplished through the use of -`mod_xsendfile`, a 3rd-party Apache module. Dataset security is maintained in this configuration because Apache will -still check with Galaxy to ensure that the requesting user has permission to access the dataset before sending it. - -To enable it, you must first install `mod_xsendfile`. This is usually available via your package manager -(`libapache2-mod-xsendfile` on Debian-based distributions and `mod_xsendfile` from EPEL on EL-based distributions). Once -installed, add the appropriate `LoadModule` directive to your Apache configuration (`LoadModule xsendfile_module -/path/to/mod_xsendfile.so`, but both the Debian and EPEL packages do this for you upon installation). - -The, add `XSendFile` directives to your proxy configuration: - -```apache - - XSendFile on - XSendFilePath / - -``` - -Next, edit `galaxy.yml` and make the following change before restarting Galaxy: - -```yaml -galaxy: - # ... - apache_xsendfile: true -``` - -For this to work, the user under which your Apache server runs will need read access to Galaxy's `files_path` directory -(by default, `database/files/`) and its contents. This is most easily done by adding the Apache user to the Galaxy user's -primary group and setting the `umask(2)` to create files with the group read permission set. If you start Galaxy from -the command line, you can do this like so: - -```shell-session -admin@server$ sudo usermod -a -G galaxy www-data # add `www-data` user to `galaxy` group -admin@server$ sudo -iu galaxy -galaxy@server$ umask 027 -galaxy@server$ sh run.sh -``` - -If you start Galaxy from supervisord, you can set the `umask` option in the [program -section](http://supervisord.org/configuration.html#program-x-section-settings) after adding the Apache user to the Galaxy -group as shown above. - -### External user authentication - -- [Apache for External Authentication](https://galaxyproject.org/admin/config/apache-external-user-auth/) -- [Built-in Galaxy External Authentication](authentication.html) - -#### Display Sites - -Display sites such as UCSC work not by sending data directly from Galaxy to UCSC via the client's browser, but by -sending UCSC a URL to the data in Galaxy that the UCSC server will retrieve data from. Since enabling authentication -will place **all** of Galaxy behind authentication, such display sites will no longer be able to access data via that -URL. If `display_servers` is set to a non-empty value in `$galaxy_root/config/galaxy.yml`, this tells Galaxy it should -allow the named servers access to data in Galaxy. However, you still need to configure Apache to allow access to the -datasets. An example config is provided here that allows the UCSC Main/Test backends: - -```apache - - Satisfy Any - Order deny,allow - Deny from all - Allow from hgw1.cse.ucsc.edu - Allow from hgw2.cse.ucsc.edu - Allow from hgw3.cse.ucsc.edu - Allow from hgw4.cse.ucsc.edu - Allow from hgw5.cse.ucsc.edu - Allow from hgw6.cse.ucsc.edu - Allow from hgw7.cse.ucsc.edu - Allow from hgw8.cse.ucsc.edu - -``` - -**PLEASE NOTE that this introduces a security hole** , the impact of which depends on whether you have restricted access -to the dataset via Galaxy's [internal dataset permissions](https://galaxyproject.org/learn/security-features/). - -- By default, data in Galaxy is public. Normally with a Galaxy server behind authentication in a proxy server this is of - little concern since only clients who've authenticated can access Galaxy. However, if display site exceptions are made - as shown above, anyone could use those public sites to bypass authentication and view any **public** dataset on your - Galaxy server. If you have not changed from the default and most of your datasets are public, you should consider - running your own display sites that are also behind authentication rather than using the public ones. - -- For datasets for which access has been restricted to one or more roles (i.e. it is no longer "public"), access for - reading via external browsers is only allowed for a brief period, when someone with access permission clicks the - "display at..." link. During this period, anyone who has the dataset ID would then be able to use the browser to view - this dataset. Although such a scenario is unlikely, it is technically possible. +# Proxying Galaxy with Apache + +For various reasons (performance, authentication, etc.) in a production environment, it's recommended to run Galaxy +behind a web server proxy. Although any proxy could work, Apache is a common choice. Alternatively, we use +[nginx](http://nginx.net/) for our public sites and open source infrastructure, and [details are +available](nginx.html) for it, too. + +Currently, the only recommended way to run Galaxy with Apache is using `mod_rewrite`, `mod_proxy`, and +`mod_proxy_uwsgi`. These modules must be enabled in the Apache config. The main proxy directives, `ProxyRequests` and +`ProxyVia` do **not** need to be enabled. + +## Prerequisites + +Make sure that inbound (and outbound) traffic to the TCP protocol HTTP on port 80 (and HTTPS on port 443 if using SSL) +is permitted by your server's firewall/security. + +These directions are written for Apache 2.4+. Apache 2.4 for Enterprise Linux (EL) 6 can be obtained from the [CentOS +SCLo SIG Repo](https://wiki.centos.org/SpecialInterestGroup/SCLo/CollectionsList). + +Ensure that the `mod_headers`, `mod_rewrite`, `mod_proxy`, and `mod_proxy_uwsgi` modules are loaded. Although not +required, the configuration examples also use `mod_deflate` and `mod_expires` for increased client/server performance, +so these should also be enabled. On Debian-based Linux distributions, you can do this with: + +```shell-session +# apt-get install apache2 libapache2-mod-proxy-uwsgi +# a2enmod headers deflate expires rewrite proxy proxy_uwsgi +Enabling module headers. +Considering dependency filter for deflate: +Module filter already enabled +Module deflate already enabled +Enabling module expires. +Enabling module rewrite. +Enabling module proxy. +Considering dependency proxy for proxy_uwsgi: +Module proxy already enabled +Enabling module proxy_uwsgi. +To activate the new configuration, you need to run: + service apache2 restart +``` + +On EL-based distributions, you will need to enable the [EPEL](https://fedoraproject.org/wiki/EPEL) repository and then: + +```shell-session +# yum install httpd mod_proxy_uwsgi +# echo "LoadModule proxy_uwsgi_module modules/mod_proxy_uwsgi.so" > /etc/httpd/conf.modules.d/10-proxy-uwsgi.conf +``` + +For the purposes of this example, we assume that: + +- the Galaxy server is installed at `/srv/galaxy/server` +- Apache runs as the user `www-data` (this is the default under Debian-based Linux distributions) +- Galaxy runs as the user `galaxy` with primary group `galaxy` +- Galaxy is served from the hostname `galaxy.example.org` + +Throughout the configuration examples in this document, in order to avoid reptition, `#...` is used to denote a location +where existing or previously given configuration statements would appear. + +```eval_rst +.. warning:: Please note that Galaxy should *never* be located on disk inside Apache's `DocumentRoot`. By default, this + would expose all of Galaxy (including datasets) to anyone on the web. +``` + +## Basic configuration + +The use of SSL is **strongly encouraged** to avoid exposure of confidential information such as datasets and user +credentials to eavesdroppers. The instructions in this document are for setting an SSL-enabled Galaxy server. + +When setting up an SSL server, simply enabling SSL with the default options is not enough. In most cases, the +configuration is weak and vulnerable to one or more of the multitude of SSL attacks that have been recently prevalent. +The [Qualys SSL/TLS Deployment Best Practices](https://www.ssllabs.com/projects/best-practices/) is an excellent and +up-to-date guide covering everything necessary for securing an SSL server. In addition, the [Mozilla SSL Configuration +Generator](https://mozilla.github.io/server-side-tls/ssl-config-generator/) can provide you with a best practices config +tailored to your desired security level and software versions. + +Finally, Google's [PageSpeed Insights](https://developers.google.com/speed/pagespeed/insights/) tool is helpful for +determining how you can improve responsiveness as related to proxying, such as verifying that caching and compression +are configured properly. + +If you need to run more than one site on your Galaxy server, there are two options: + +- Run them on the same server but serve them on different hostnames +- Serve them from different URL prefixes on a single hostname + +The former option is typically cleaner, but if serving more than one SSL site, you will need an SSL certificate with +[subjectAltName](http://wiki.cacert.org/FAQ/subjectAltName)s for each hostname served by the server. + +### Serving Galaxy at the Web Server Root + +This configuration assumes that Galaxy will be the only site on your server using the given hostname (e.g. +`https://galaxy.example.org`). + +Beginning with Galaxy Release 18.01, the default application server that Galaxy runs under is uWSGI. Because of this, +the native high performance uWSGI protocol should be used for communication between the proxy server and Galaxy, rather +than HTTP. Legacy instructions for proxying via HTTP can be found in the [Galaxy Release 17.09 Apache +documentation](https://docs.galaxyproject.org/en/release_17.09/admin/special_topics/apache.html). + +Since Apache is more efficient than uWSGI at serving static content, it is best to serve it directly, reducing the load +on the Galaxy process and allowing for more effective compression (if enabled), caching, and pipelining. Directives to +do so are included in the example below. + +The following configuration is not exhaustive, only the portions most relevant to serving Galaxy are shown, these should +be incorporated with your existing/default Apache config as is appropriate for your server: + +```apache +SSLProtocol all -SSLv3 +SSLCipherSuite ECDHE-ECDSA-AES128-GCM-SHA256:ECDHE-ECDSA-AES256-GCM-SHA384:ECDHE-ECDSA-AES128-SHA:ECDHE-ECDSA-AES256-SHA:ECDHE-ECDSA-AES128-SHA256:ECDHE-ECDSA-AES256-SHA384:ECDHE-RSA-AES128-GCM-SHA256:ECDHE-RSA-AES256-GCM-SHA384:ECDHE-RSA-AES128-SHA:ECDHE-RSA-AES256-SHA:ECDHE-RSA-AES128-SHA256:ECDHE-RSA-AES256-SHA384:DHE-RSA-AES128-GCM-SHA256:DHE-RSA-AES256-GCM-SHA384:DHE-RSA-AES128-SHA:DHE-RSA-AES256-SHA:DHE-RSA-AES128-SHA256:DHE-RSA-AES256-SHA256 +SSLHonorCipherOrder on +SSLCompression off +SSLSessionTickets off + +# OCSP stapling +SSLUseStapling on +SSLStaplingResponderTimeout 5 +SSLStaplingReturnResponderErrors off +SSLStaplingCache shmcb:/var/run/ocsp(128000) + + + Redirect permanent / https://galaxy.example.org + + + + SSLEngine on + SSLCertificateFile /etc/apache2/ssl/server.crt + SSLCertificateKeyFile /etc/apache2/ssl/server.key + + # Enable HSTS + Header always set Strict-Transport-Security "max-age=15552000; includeSubdomains" + + # use a variable for convenience + Define galaxy_root /srv/galaxy/server + + # don't decode encoded slashes in path info + AllowEncodedSlashes NoDecode + + # enable compression on all relevant types + AddOutputFilterByType DEFLATE text/html text/plain text/xml + AddOutputFilterByType DEFLATE text/css + AddOutputFilterByType DEFLATE application/x-javascript application/javascript application/ecmascript + AddOutputFilterByType DEFLATE application/rss+xml + AddOutputFilterByType DEFLATE application/xml + AddOutputFilterByType DEFLATE application/json + + # allow access to static content + + AllowOverride None + Require all granted + + + # Galaxy needs to know that this is https for generating URLs + RequestHeader set X-URL-SCHEME "%{REQUEST_SCHEME}e" + + # allow up to 3 minutes for Galaxy to respond to slow requests before timing out + ProxyTimeout 180 + + # proxy all requests not matching other locations to uWSGI + ProxyPass / unix:///srv/galaxy/var/uwsgi.sock|uwsgi:// + # or uWSGI on a TCP socket + #ProxyPass / uwsgi://127.0.0.1:4001/ + + # serve framework static content + RewriteEngine On + RewriteRule ^/static/style/(.*) ${galaxy_root}/static/style/blue/$1 [L] + RewriteRule ^/static/(.*) ${galaxy_root}/static/$1 [L] + RewriteRule ^/favicon.ico ${galaxy_root}/static/favicon.ico [L] + RewriteRule ^/robots.txt ${galaxy_root}/static/robots.txt [L] + + # enable caching on static content + + ExpiresActive On + ExpiresDefault "access plus 24 hours" + + + # serve visualization and interactive environment plugin static content + + AllowOverride None + Require all granted + + RewriteRule ^/plugins/(.+)/(.+)/static/(.*)$ ${galaxy_root}/config/plugins/$1/$2/static/$3 [L] + +``` + +Be sure to set `galaxy_root` to the path to your copy of Galaxy and modify the value of `ProxyPass /` to match your +uWSGI socket path. With the default configuration, uWSGI will bind to a random TCP socket, so you will need to set it to +a fixed value as described in the [Scaling and Load Balancing](scaling.html) documentation. If using a UNIX domain +socket, be sure to pay particular attention to the discussion of users and permissions. + +### Implementation-specific Notes + +It is possible to perform the entire configuration in the main Apache configuration file, however, Apache packages as +provided by Linux distribution package managers typically provide a slightly more complex layout that is designed to +prevent conflicts in the main Apahce config file when updating the package. + +On Debian-based Linux distributions (Debian, Ubuntu, etc.), the Apache package's default configuration in +`/etc/apache2/apache2.conf` contains two include directives: + +- One which includes any configuration files with the `.conf` extension in the `/etc/apache2/conf-enabled` directory, + which contains symlinks to `/etc/apache2/confs-available`, where you would place global (non-VirtualHost) + configuration directives. +- One which includes all files in the `/etc/apache2/sites-enabled` directory, which contains symlinks to + `/etc/apache2/sites-available`, where you would place the `` configurations for websites hosted by this + Apache server. + +On EL-based Linux distributions (RedHat Enterprise Linux, CentOS, etc.), the Apache package's default configuration in +`/etc/httpd/conf/httpd.conf` contains a directive in that includes any configuration files with the `.conf` extension in +the `/etc/httpd/conf.d` directory. + +Thus, you might create: + +- `/etc/httpd/conf.d/galaxy_options.conf` on Debian-based distributions +- `/etc/apache2/confs-available/galaxy.conf` on Debian-based distributions + +With the global configuration directives: + +```apache +SSLProtocol all -SSLv3 +SSLCipherSuite ... +#... +``` + +Then for the site configurations, you might create: + +- `/etc/httpd/conf.d/galaxy_site.conf` on EL-based distributions +- `/etc/apache2/sites-available/galaxy` on Debian-based distributions + +With the `` blocks: + +```apache + + Redirect permanent / https://galaxy.example.org + + + + SSLEngine on + SSLCertificateFile /etc/apache2/ssl/server.crt + SSLCertificateKeyFile /etc/apache2/ssl/server.key + #... + +``` + +On Debian-based distribution, you'd then need to symlink the configs with (or do it by hand with `ln -s`): + +```shell-session +# a2enconf galaxy +# a2ensite galaxy +``` + +### Additional Notes + +- **Do not** simply copy the SSL configuration directives and expect them to work on your server or to be secure! These + are provided as examples of some of the best practices as of the time of writing, but will not always be up to date. + Use the guides referenced in [basic configuration](#basic-configuration) section to configure SSL properly. +- If your existing Apache configuration contains a line or included config file defining a default server, be sure to + disable it by commenting its `` or preventing its inclusion (under Debian-based operating systems, this + is done by removing its symlink from `/etc/apache2/sites-enabled`. +- `ProxyTimeout` can be adjusted as appropriate for your site. This is the amount of time allowed for communication + between Apache and uWSGI to block while waiting for a response from Galaxy, and is useful for holding client (browser) + connections while uWSGI is restarting Galaxy subprocesses or Galaxy is performing a slow operation. +- If your Apache server is set up to use `mod_security`, you may need to modify the value of the `SecRequestBodyLimit`. + The default value on some systems will limit uploads to only a few kilobytes. +- Some Galaxy URLs contain encoded slashes (%2F) in the path and Apache will not serve these URLs by default, which is + the reason for inclusion of the `AllowEncodedSlashes` directive. Note: The `NoDecode` value was added in Apache2 + 2.2.18, which is newer than EL 6's provided 2.2.15. +- If you must serve Galaxy without SSL, you would simply replace the `443` with `80` in the SSL `VirtualHost` block + and remove the non-SSL block and all SSL directives. +- If the proxy works but you are getting 404 errors for Galaxy's static content, be sure that the user that Apache runs + as has access to Galaxy's `static/` directory (and all its parent directories) on the filesystem. You can test this on + the command line with e.g. `sudo -u www-data ls /srv/galaxy/server/static`. + +### Serving Galaxy at a URL Prefix + +It may be necessary to serve Galaxy from an address other than the web server root (`https://www.example.org/galaxy`), +instead of `https://galaxy.example.org`). To do this, you need to make the following changes to the configuration in the +previous section: + +1. In the Apache config, prefix all of the location directives with your prefix, like so: + + ```apache + #... + + # proxy all requests not matching other locations to uWSGI + ProxyPass /galaxy unix:///srv/galaxy/var/uwsgi.sock|uwsgi:// + # or uWSGI on a TCP socket + #ProxyPass /galaxy uwsgi://127.0.0.1:4001/ + + # serve framework static content + RewriteEngine On + RewriteRule ^/galaxy/$ /galaxy [R,L] + RewriteRule ^/galaxy/static/style/(.*) ${galaxy_root}/static/style/blue/$1 [L] + RewriteRule ^/galaxy/static/(.*) ${galaxy_root}/static/$1 [L] + RewriteRule ^/galaxy/favicon.ico ${galaxy_root}/static/favicon.ico [L] + RewriteRule ^/galaxy/robots.txt ${galaxy_root}/static/robots.txt [L] + ``` + +2. The Galaxy application needs to be aware that it is running with a prefix (for generating URLs in dynamic pages). + This is accomplished by configuring uWSGI and Galaxy (the `uwsgi` and `galaxy` sections in `config/galaxy.yml` + respectively) like so and restarting Galaxy: + + ```yaml + uwsgi: + #... + socket: unix:///srv/galaxy/var/uwsgi.sock + mount: /galaxy=galaxy.webapps.galaxy.buildapp:uwsgi_app() + manage-script-name: true + # `module` MUST NOT be set when `mount` is in use + #module: galaxy.webapps.galaxy.buildapp:uwsgi_app() + + galaxy: + #... + cookie_path: /galaxy + ``` + + `cookie_path` should be set to prevent Galaxy's session cookies from clobbering each other if you are running more + than one instance of Galaxy under different URL prefixes on the same hostname. + + Be sure to consult the [Scaling and Load Balancing](scaling.html) documentation, other options unrelated to proxying + should also be set in the `uwsgi` section of the config. + +## Advanced Configuration Topics + +### Sending Files With Apache + +Galaxy sends files (e.g. dataset downloads) by opening the file and streaming it in chunks through the proxy server. +However, this ties up the Galaxy process, which can impact the performance of other operations (see [Production Server +Configuration](production.html) for a more in-depth explanation). + +Apache can assume this task instead and as an added benefit, speed up downloads. This is accomplished through the use of +`mod_xsendfile`, a 3rd-party Apache module. Dataset security is maintained in this configuration because Apache will +still check with Galaxy to ensure that the requesting user has permission to access the dataset before sending it. + +To enable it, you must first install `mod_xsendfile`. This is usually available via your package manager +(`libapache2-mod-xsendfile` on Debian-based distributions and `mod_xsendfile` from EPEL on EL-based distributions). Once +installed, add the appropriate `LoadModule` directive to your Apache configuration (`LoadModule xsendfile_module +/path/to/mod_xsendfile.so`, but both the Debian and EPEL packages do this for you upon installation). + +The, add `XSendFile` directives to your proxy configuration: + +```apache + + XSendFile on + XSendFilePath / + +``` + +Next, edit `galaxy.yml` and make the following change before restarting Galaxy: + +```yaml +galaxy: + # ... + apache_xsendfile: true +``` + +For this to work, the user under which your Apache server runs will need read access to Galaxy's `files_path` directory +(by default, `database/files/`) and its contents. This is most easily done by adding the Apache user to the Galaxy user's +primary group and setting the `umask(2)` to create files with the group read permission set. If you start Galaxy from +the command line, you can do this like so: + +```shell-session +admin@server$ sudo usermod -a -G galaxy www-data # add `www-data` user to `galaxy` group +admin@server$ sudo -iu galaxy +galaxy@server$ umask 027 +galaxy@server$ sh run.sh +``` + +If you start Galaxy from supervisord, you can set the `umask` option in the [program +section](http://supervisord.org/configuration.html#program-x-section-settings) after adding the Apache user to the Galaxy +group as shown above. + +### External user authentication + +- [Apache for External Authentication](https://galaxyproject.org/admin/config/apache-external-user-auth/) +- [Built-in Galaxy External Authentication](authentication.html) + +#### Display Sites + +Display sites such as UCSC work not by sending data directly from Galaxy to UCSC via the client's browser, but by +sending UCSC a URL to the data in Galaxy that the UCSC server will retrieve data from. Since enabling authentication +will place **all** of Galaxy behind authentication, such display sites will no longer be able to access data via that +URL. If `display_servers` is set to a non-empty value in `$galaxy_root/config/galaxy.yml`, this tells Galaxy it should +allow the named servers access to data in Galaxy. However, you still need to configure Apache to allow access to the +datasets. An example config is provided here that allows the UCSC Main/Test backends: + +```apache + + Satisfy Any + Order deny,allow + Deny from all + Allow from hgw1.cse.ucsc.edu + Allow from hgw2.cse.ucsc.edu + Allow from hgw3.cse.ucsc.edu + Allow from hgw4.cse.ucsc.edu + Allow from hgw5.cse.ucsc.edu + Allow from hgw6.cse.ucsc.edu + Allow from hgw7.cse.ucsc.edu + Allow from hgw8.cse.ucsc.edu + +``` + +**PLEASE NOTE that this introduces a security hole** , the impact of which depends on whether you have restricted access +to the dataset via Galaxy's [internal dataset permissions](https://galaxyproject.org/learn/security-features/). + +- By default, data in Galaxy is public. Normally with a Galaxy server behind authentication in a proxy server this is of + little concern since only clients who've authenticated can access Galaxy. However, if display site exceptions are made + as shown above, anyone could use those public sites to bypass authentication and view any **public** dataset on your + Galaxy server. If you have not changed from the default and most of your datasets are public, you should consider + running your own display sites that are also behind authentication rather than using the public ones. + +- For datasets for which access has been restricted to one or more roles (i.e. it is no longer "public"), access for + reading via external browsers is only allowed for a brief period, when someone with access permission clicks the + "display at..." link. During this period, anyone who has the dataset ID would then be able to use the browser to view + this dataset. Although such a scenario is unlikely, it is technically possible. diff --git a/doc/source/admin/nginx.md b/doc/source/admin/nginx.md index d93b7533b58..5d09afe9761 100644 --- a/doc/source/admin/nginx.md +++ b/doc/source/admin/nginx.md @@ -1,463 +1,463 @@ -# Proxying Galaxy with NGINX - -[NGINX](http://nginx.org/en/) is a lightweight http server designed with high performance proxying in mind. The public -Galaxy sites ([Main](https://galaxyproject.org/main/) and [Test](https://galaxyproject.org/test/)) as well as the -[Docker Galaxy project](https://github.com/bgruening/docker-galaxy-stable) use nginx to proxy rather than Apache for its -simple, fast load balancing and other features. - - -## Prerequisites - -Make sure that inbound (and outbound) traffic to the TCP protocol HTTP on port 80 (and HTTPS on port 443 if using SSL) -is permitted by your server's firewall/security. - -For the purposes of this example, we assume that: - -- the Galaxy server is installed at `/srv/galaxy/server` -- nginx runs as the user `www-data` (this is the default under Debian-based Linux distributions) -- Galaxy runs as the user `galaxy` with primary group `galaxy` -- Galaxy is served from the hostname `galaxy.example.org` - -Throughout the configuration examples in this document, in order to avoid reptition, `#...` is used to denote a location -where existing or previously given configuration statements would appear. - -```eval_rst -.. warning:: Please note that Galaxy should *never* be located on disk inside nginx's document root. By default, this - would expose all of Galaxy (including datasets) to anyone on the web. -``` - -## Basic Configuration - -The use of SSL is **strongly encouraged** to avoid exposure of confidential information such as datasets and user -credentials to eavesdroppers. The instructions in this document are for setting an SSL-enabled Galaxy server. - -When setting up an SSL server, simply enabling SSL with the default options is not enough. In most cases, the -configuration is weak and vulnerable to one or more of the multitude of SSL attacks that have been recently prevalent. -The [Qualys SSL/TLS Deployment Best Practices](https://www.ssllabs.com/projects/best-practices/) is an excellent and -up-to-date guide covering everything necessary for securing an SSL server. In addition, the [Mozilla SSL Configuration -Generator](https://mozilla.github.io/server-side-tls/ssl-config-generator/) can provide you with a best practices config -tailored to your desired security level and software versions. - -Finally, Google's [PageSpeed Insights](https://developers.google.com/speed/pagespeed/insights/) tool is helpful for -determining how you can improve responsiveness as related to proxying, such as verifying that caching and compression -are configured properly. - -If you need to run more than one site on your Galaxy server, there are two options: - -- Run them on the same server but serve them on different hostnames -- Serve them from different URL prefixes on a single hostname - -The former option is typically cleaner, but if serving more than one SSL site, you will need an SSL certificate with -[subjectAltName](http://wiki.cacert.org/FAQ/subjectAltName)s for each hostname served by the server. - -### Serving Galaxy at the Web Server Root - -This configuration assumes that Galaxy will be the only site on your server using the given hostname (e.g. -`https://galaxy.example.org`). - -Beginning with Galaxy Release 18.01, the default application server that Galaxy runs under is uWSGI. Because of this, -the native high performance uWSGI protocol should be used for communication between the proxy server and Galaxy, rather -than HTTP. Legacy instructions for proxying via HTTP can be found in the [Galaxy Release 17.09 nginx -documentation](https://docs.galaxyproject.org/en/release_17.09/admin/special_topics/nginx.html). - -uWSGI protocol support is built in to nginx, so (unlike Apache) no extra modules or recompiling should be required. - -Since nginx is more efficient than uWSGI at serving static content, it is best to serve it directly, reducing the load -on the Galaxy process and allowing for more effective compression (if enabled), caching, and pipelining. Directives to -do so are included in the example below. - -The following configuration is not exhaustive, only the portions most relevant to serving Galaxy are shown, these should -be incorporated with your existing/default nginx config as is appropriate for your server: - -```nginx -http { - - #... - - # compress responses whenever possible - gzip on; - gzip_http_version 1.1; - gzip_vary on; - gzip_comp_level 4; - gzip_proxied any; - gzip_types text/plain text/css application/json application/x-javascript text/xml application/xml application/xml+rss text/javascript; - gzip_comp_level 6; - gzip_buffers 16 8k; - - # allow up to 3 minutes for Galaxy to respond to slow requests before timing out - uwsgi_read_timeout 180; - - # maximum file upload size - client_max_body_size 10g; - - # allowable SSL protocols - ssl_protocols TLSv1 TLSv1.1 TLSv1.2; - - # use secure ciphers - ssl_ciphers - ECDHE-ECDSA-AES128-GCM-SHA256:ECDHE-ECDSA-AES256-GCM-SHA384:ECDHE-ECDSA-AES128-SHA:ECDHE-ECDSA-AES256-SHA:ECDHE-ECDSA-AES128-SHA256:ECDHE-ECDSA-AES256-SHA384:ECDHE-RSA-AES128-GCM-SHA256:ECDHE-RSA-AES256-GCM-SHA384:ECDHE-RSA-AES128-SHA:ECDHE-RSA-AES256-SHA:ECDHE-RSA-AES128-SHA256:ECDHE-RSA-AES256-SHA384:DHE-RSA-AES128-GCM-SHA256:DHE-RSA-AES256-GCM-SHA384:DHE-RSA-AES128-SHA:DHE-RSA-AES256-SHA:DHE-RSA-AES128-SHA256:DHE-RSA-AES256-SHA256; - ssl_dhparam /etc/nginx/ssl/dhparams.pem; - ssl_prefer_server_ciphers on; - - # enable session reuse - ssl_session_cache shared:SSL:8m; - ssl_session_timeout 5m; - - # cert/key - ssl_certificate /etc/nginx/ssl/server.crt; - ssl_certificate_key /etc/nginx/ssl/server.key; - - # OCSP stapling - ssl_stapling on; - ssl_stapling_verify on; - ssl_trusted_certificate /etc/nginx/ssl/ca.crt; - - - server { - listen 80 default_server; - listen [::]:80 default_server; - server_name _; - - return 301 https://$host$request_uri; - } - - server { - listen 443 default_server; - listen [::]:443 default_server; - server_name _; - - # use a variable for convenience - set $galaxy_root /srv/galaxy/server; - - # Enable HSTS - add_header Strict-Transport-Security "max-age=15552000; includeSubdomains"; - - # proxy all requests not matching other locations to uWSGI - location / { - uwsgi_pass unix:///srv/galaxy/var/uwsgi.sock - uwsgi_param UWSGI_SCHEME $scheme; - include uwsgi_params; - } - - # serve framework static content - location /static/style { - alias $galaxy_root/static/style/blue; - expires 24h; - } - location /static { - alias $galaxy_root/static; - expires 24h; - } - location /robots.txt { - alias $galaxy_root/static/robots.txt; - expires 24h; - } - location /favicon.ico { - alias $galaxy_root/static/favicon.ico; - expires 24h; - } - - # serve visualization and interactive environment plugin static content - location ~ ^/plugins/(?.+?)/(?.+?)/static/(?.*?)$ { - alias $galaxy_root/config/plugins/$plug_type/$vis_name/static/$static_file; - expires 24; - } - } -} -``` - -Be sure to set `$galaxy_root` to the path to your copy of Galaxy and modify the value of `uwsgi_pass` to match your -uWSGI socket path. With the default configuration, uWSGI will bind to a random TCP socket, so you will need to set it to -a fixed value as described in the [Scaling and Load Balancing](scaling.html) documentation. If using a UNIX domain -socket, be sure to pay particular attention to the discussion of users and permissions. - -### Implementation-specific Notes - -It is possible to perform the entire configuration in the main nginx configuration file (typically -`/etc/nginx/nginx.conf`), however, nginx packages as provided by Linux distribution package managers typically provide a -slightly more complex layout that is designed to prevent conflicts in `nginx.conf` when updating the package. - -On Debian-based Linux distributions (Debian, Ubuntu, etc.), the nginx package's default configuration contains two -include directives in the `http {}` block: - -- One which includes any configuration files with the `.conf` extension in the `/etc/nginx/conf.d` directory, where you - would place directives that belong in the `http {}` block. -- One which includes all files in the `/etc/nginx/sites-enabled` directory, which contains symlinks to - `/etc/nginx/sites-available`, where you would place the `server {}` configurations for websites hosted by this nginx - server. - -On EL-based Linux distributions (RedHat Enterprise Linux, CentOS, etc.), the EPEL nginx package's default configuration -contains a directive in the `http {}` block that includes any configuration files with the `.conf` extension in the -`/etc/nginx/conf.d` directory. - -Thus, on both Debian- and EL-based distributions, you might put the `http` directives in -`/etc/nginx/conf.d/galaxy_http_options.conf`. Note that these are **not** enclosed in an `http {}` block themselves, as -they are already enclosed by the `http {}` block in `/etc/nginx/nginx.conf`: - -```nginx -uwsgi_read_timeout 180; -client_max_body_size 10g; -ssl_certificate /etc/nginx/ssl/server.crt; -ssl_certificate_key /etc/nginx/ssl/server.key; -#... -``` - -Then for the site configurations, you might create: - -- `/etc/nginx/conf.d/galaxy_site.conf` on EL-based distributions -- `/etc/nginx/sites-available/galaxy` on Debian-based distributions - -With the `server {}` blocks (again, not enclosed in an `http {}`): - -```nginx -server { - listen 80 default_server; - listen [::]:80 default_server; - server_name _; - #... -} - -server { - listen 443 default_server; - listen [::]:443 default_server; - server_name _; - #... -} -``` - -On Debian-based distribution, you'd then need to symlink the config with: - -```shell-session -# ln -s /etc/nginx/sites-available/galaxy /etc/nginx/sites-enabled/galaxy -``` - -### Additional Notes - -- **Do not** simply copy the SSL configuration directives and expect them to work on your server or to be secure! These - are provided as examples of some of the best practices as of the time of writing, but will not always be up to date. - Use the guides referenced in [basic configuration](#basic-configuration) section to configure SSL properly. -- If your existing nginx configuration contains a line or included config file defining a default server, be sure to - disable it by commenting its `server {}` or preventing its inclusion (under Debian-based operating systems, this - is done by removing its symlink from `/etc/nginx/sites-enabled`. -- `uwsgi_read_timeout` can be adjusted as appropriate for your site. This is the amount of time allowed for - communication between nginx and uWSGI to block while waiting for a response from Galaxy, and is useful for holding - client (browser) connections while uWSGI is restarting Galaxy subprocesses or Galaxy is performing a slow operation. -- The parameter `client_max_body_size` specifies the maximum upload size that can be handled by POST requests through - nginx. You should set this to the largest file size that you wish to allow for upload and that could be reasonably - handled by your site. It defaults to 1MB, so it will need to be increased if you are dealing with genome sized - datasets. -- If you must serve Galaxy without SSL, you would simply replace the `listen` directives in the SSL `server {}` block - with the `listen` directives from the non-SSL `server {}` block and remove the non-SSL block and SSL directives from - the `http {}` block. -- If the proxy works but you are getting 404 errors for Galaxy's static content, be sure that the user that nginx runs - as has access to Galaxy's `static/` directory (and all its parent directories) on the filesystem. You can test this on - the command line with e.g. `sudo -u www-data ls /srv/galaxy/server/static`. - -### Serving Galaxy at a URL Prefix - -It may be necessary to serve Galaxy from an address other than the web server root (`https://www.example.org/galaxy`), -instead of `https://galaxy.example.org`). To do this, you need to make the following changes to the configuration in the -previous section: - -1. In the nginx config, prefix all of the location directives with your prefix and redirect requests from `/prefix` to - `/prefix/` like so: - - ```nginx - #... - - # proxy all requests not matching other locations to uWSGI - location /galaxy { - uwsgi_pass unix:///srv/galaxy/var/uwsgi.sock - uwsgi_param UWSGI_SCHEME $scheme; - include uwsgi_params; - } - - # serve framework static content - location /galaxy/static/style { - alias $galaxy_root/static/style/blue; - expires 24h; - } - - # additional static locations... - - # redirect /prefix -> /prefix/ - rewrite ^/galaxy$ /galaxy/ last; - ``` - -2. The Galaxy application needs to be aware that it is running with a prefix (for generating URLs in dynamic pages). - This is accomplished by configuring uWSGI and Galaxy (the `uwsgi` and `galaxy` sections in `config/galaxy.yml` - respectively) like so and restarting Galaxy: - - ```yaml - uwsgi: - #... - socket: unix:///srv/galaxy/var/uwsgi.sock - mount: /galaxy=galaxy.webapps.galaxy.buildapp:uwsgi_app() - manage-script-name: true - # `module` MUST NOT be set when `mount` is in use - #module: galaxy.webapps.galaxy.buildapp:uwsgi_app() - - galaxy: - #... - cookie_path: /galaxy - ``` - - `cookie_path` should be set to prevent Galaxy's session cookies from clobbering each other if you are running more - than one instance of Galaxy under different URL prefixes on the same hostname. - - Be sure to consult the [Scaling and Load Balancing](scaling.html) documentation, other options unrelated to proxying - should also be set in the `uwsgi` section of the config. - -## Advanced Configuration Topics - -### Sending Files With Nginx - -Galaxy sends files (e.g. dataset downloads) by opening the file and streaming it in chunks through the proxy server. -However, this ties up the Galaxy process, which can impact the performance of other operations (see [Production Server -Configuration](production.html) for a more in-depth explanation). - -Nginx can assume this task instead and as an added benefit, speed up downloads. This is accomplished through the use of -the special `X-Accel-Redirect` header. Dataset security is maintained in this configuration because nginx will still -check with Galaxy to ensure that the requesting user has permission to access the dataset before sending it. - -To enable it, add the following to your Galaxy's `server {}` block: - -```nginx - location /_x_accel_redirect/ { - internal; - alias /; - } -``` - -Next, edit `galaxy.yml` and make the following change before restarting Galaxy: - -```yaml -galaxy: - #... - nginx_x_accel_redirect_base: '/_x_accel_redirect' -``` - -For this to work, the user under which your nginx server runs will need read access to Galaxy's `files_path` directory -(by default, `database/files/`) and its contents. This is most easily done by adding the nginx user to the Galaxy user's -primary group and setting the `umask(2)` to create files with the group read permission set. If you start Galaxy from -the command line, you can do this like so: - -```shell-session -admin@server$ sudo usermod -a -G galaxy www-data # add `www-data` user to `galaxy` group -admin@server$ sudo -iu galaxy -galaxy@server$ umask 027 -galaxy@server$ sh run.sh -``` - -If you start Galaxy from supervisord, you can set the `umask` option in the [program -section](http://supervisord.org/configuration.html#program-x-section-settings) after adding the nginx user to the Galaxy -group as shown above. - -### Receiving Files With Nginx - -Galaxy receives files (e.g. dataset uploads) by streaming them in chunks through the proxy server and writing the files -to disk. However, this again ties up the Galaxy process. nginx can assume this task instead and as an added benefit, -speed up uploads. This is accomplished through the use of -[nginx_upload_module](http://www.grid.net.ru/nginx/upload.en.html), a 3rd-party nginx module. - -To enable it, you must first download, compile and install nginx with the upload module, since prior to NGINX 1.11.5, -nginx did not support shared modules, and the upload module is not yet shared-compatible. Because this is a tedious -and complicated process, the Galaxy Committers team maintains (for some platforms) versions of nginx modified from their -upstream package sources (APT, EPEL, etc.) to include the upload module: - -- [Ubuntu (PPA)](https://launchpad.net/~galaxyproject/+archive/ubuntu/nginx) -- [Enterprise Linux](https://depot.galaxyproject.org/yum/) - -To contribute support for additional platforms, please see the [Galaxy -Starforge](https://github.com/galaxyproject/starforge) project, which is used to do the repackaging. - - -Once nginx with the upload module is installed, create a directory in which to store uploads (ideally, for performance -reasons, on the same filesystem as Galaxy's datasets) and add the necessary directives to `nginx.conf`: - -```nginx -user galaxy; - -http { - - #... - - server { - - #... - - # handle file uploads via the upload module - location /_upload { - upload_store /srv/galaxy/upload_store; - upload_store_access user:rw group:rw; - upload_pass_form_field ""; - upload_set_form_field "__${upload_field_name}__is_composite" "true"; - upload_set_form_field "__${upload_field_name}__keys" "name path"; - upload_set_form_field "${upload_field_name}_name" "$upload_file_name"; - upload_set_form_field "${upload_field_name}_path" "$upload_tmp_path"; - upload_pass_args on; - upload_pass /_upload_done; - } - - # once upload is complete, redirect to the proper galaxy path - location /_upload_done { - set $dst /api/tools; - if ($args ~ nginx_redir=([^&]+)) { - set $dst $1; - } - rewrite "" $dst; - } -} -``` - -Note the `user` directive at the top, outside of the `http {}` block. To ensure that Galaxy has write permission on the -uploaded files, nginx's workers will need to run as the same user as Galaxy. - -When serving Galaxy at a URL prefix as described in the [Serving Galaxy at a URL -prefix](#serving-galaxy-at-a-url-prefix) section, you will need to change `set $dst /api/tools;` to `set $dst -/prefix/api/tools;` (e.g. `set $dst /galaxy/api/tools;`). - -Finally, edit `galaxy.yml` and make the following change before restarting Galaxy: - -```yaml -galaxy: - #... - nginx_upload_store: /srv/galaxy/upload_store - nginx_upload_path: '/_upload' -``` - -### Use Galaxy Authentication to Protect Custom Paths - -You may find it useful to require authentication for access to certain paths on your server. For example, Galaxy can -run a separate reports app which gives useful information about your Galaxy instance. See the [Reports Configuration -documentation](reports.html) and [Peter Briggs' blog post on the -subject](http://galacticengineer.blogspot.com/2015/06/exposing-galaxy-reports-via-nginx-in.html) for more. - -After succesfully following the blog post, Galaxy reports should be available at e.g. `https://galaxy.example.org/reports`. -To secure this page to only Galaxy administrators, adjust your nginx config accordingly: - -**TODO:** This is not valid for the uWSGI proxy method and needs to be updated. -nate 2018-01-11 - -```nginx - location /reports { - #... - satisfy any; # only one auth method needs to succeed - deny all; # host-based auth is not allowed - auth_request /_auth; # forward authentication - } - - location /_auth { - #internal; probably? - # The used galaxy api endpoint is only available to galaxy admins and thus limits the access - # to only logged in admins. - proxy_pass http://localhost/api/configuration/dynamic_tool_confs; - proxy_pass_request_body off; - proxy_set_header Content-Length ""; - proxy_set_header X-Original-URI $request_uri; - } -``` - -### External User Authentication - -- [Nginx for External Authentication](https://galaxyproject.org/admin/config/nginx-external-user-auth/) -- [Built-in Galaxy External Authentication](authentication.html) +# Proxying Galaxy with NGINX + +[NGINX](http://nginx.org/en/) is a lightweight http server designed with high performance proxying in mind. The public +Galaxy sites ([Main](https://galaxyproject.org/main/) and [Test](https://galaxyproject.org/test/)) as well as the +[Docker Galaxy project](https://github.com/bgruening/docker-galaxy-stable) use nginx to proxy rather than Apache for its +simple, fast load balancing and other features. + + +## Prerequisites + +Make sure that inbound (and outbound) traffic to the TCP protocol HTTP on port 80 (and HTTPS on port 443 if using SSL) +is permitted by your server's firewall/security. + +For the purposes of this example, we assume that: + +- the Galaxy server is installed at `/srv/galaxy/server` +- nginx runs as the user `www-data` (this is the default under Debian-based Linux distributions) +- Galaxy runs as the user `galaxy` with primary group `galaxy` +- Galaxy is served from the hostname `galaxy.example.org` + +Throughout the configuration examples in this document, in order to avoid reptition, `#...` is used to denote a location +where existing or previously given configuration statements would appear. + +```eval_rst +.. warning:: Please note that Galaxy should *never* be located on disk inside nginx's document root. By default, this + would expose all of Galaxy (including datasets) to anyone on the web. +``` + +## Basic Configuration + +The use of SSL is **strongly encouraged** to avoid exposure of confidential information such as datasets and user +credentials to eavesdroppers. The instructions in this document are for setting an SSL-enabled Galaxy server. + +When setting up an SSL server, simply enabling SSL with the default options is not enough. In most cases, the +configuration is weak and vulnerable to one or more of the multitude of SSL attacks that have been recently prevalent. +The [Qualys SSL/TLS Deployment Best Practices](https://www.ssllabs.com/projects/best-practices/) is an excellent and +up-to-date guide covering everything necessary for securing an SSL server. In addition, the [Mozilla SSL Configuration +Generator](https://mozilla.github.io/server-side-tls/ssl-config-generator/) can provide you with a best practices config +tailored to your desired security level and software versions. + +Finally, Google's [PageSpeed Insights](https://developers.google.com/speed/pagespeed/insights/) tool is helpful for +determining how you can improve responsiveness as related to proxying, such as verifying that caching and compression +are configured properly. + +If you need to run more than one site on your Galaxy server, there are two options: + +- Run them on the same server but serve them on different hostnames +- Serve them from different URL prefixes on a single hostname + +The former option is typically cleaner, but if serving more than one SSL site, you will need an SSL certificate with +[subjectAltName](http://wiki.cacert.org/FAQ/subjectAltName)s for each hostname served by the server. + +### Serving Galaxy at the Web Server Root + +This configuration assumes that Galaxy will be the only site on your server using the given hostname (e.g. +`https://galaxy.example.org`). + +Beginning with Galaxy Release 18.01, the default application server that Galaxy runs under is uWSGI. Because of this, +the native high performance uWSGI protocol should be used for communication between the proxy server and Galaxy, rather +than HTTP. Legacy instructions for proxying via HTTP can be found in the [Galaxy Release 17.09 nginx +documentation](https://docs.galaxyproject.org/en/release_17.09/admin/special_topics/nginx.html). + +uWSGI protocol support is built in to nginx, so (unlike Apache) no extra modules or recompiling should be required. + +Since nginx is more efficient than uWSGI at serving static content, it is best to serve it directly, reducing the load +on the Galaxy process and allowing for more effective compression (if enabled), caching, and pipelining. Directives to +do so are included in the example below. + +The following configuration is not exhaustive, only the portions most relevant to serving Galaxy are shown, these should +be incorporated with your existing/default nginx config as is appropriate for your server: + +```nginx +http { + + #... + + # compress responses whenever possible + gzip on; + gzip_http_version 1.1; + gzip_vary on; + gzip_comp_level 4; + gzip_proxied any; + gzip_types text/plain text/css application/json application/x-javascript text/xml application/xml application/xml+rss text/javascript; + gzip_comp_level 6; + gzip_buffers 16 8k; + + # allow up to 3 minutes for Galaxy to respond to slow requests before timing out + uwsgi_read_timeout 180; + + # maximum file upload size + client_max_body_size 10g; + + # allowable SSL protocols + ssl_protocols TLSv1 TLSv1.1 TLSv1.2; + + # use secure ciphers + ssl_ciphers + ECDHE-ECDSA-AES128-GCM-SHA256:ECDHE-ECDSA-AES256-GCM-SHA384:ECDHE-ECDSA-AES128-SHA:ECDHE-ECDSA-AES256-SHA:ECDHE-ECDSA-AES128-SHA256:ECDHE-ECDSA-AES256-SHA384:ECDHE-RSA-AES128-GCM-SHA256:ECDHE-RSA-AES256-GCM-SHA384:ECDHE-RSA-AES128-SHA:ECDHE-RSA-AES256-SHA:ECDHE-RSA-AES128-SHA256:ECDHE-RSA-AES256-SHA384:DHE-RSA-AES128-GCM-SHA256:DHE-RSA-AES256-GCM-SHA384:DHE-RSA-AES128-SHA:DHE-RSA-AES256-SHA:DHE-RSA-AES128-SHA256:DHE-RSA-AES256-SHA256; + ssl_dhparam /etc/nginx/ssl/dhparams.pem; + ssl_prefer_server_ciphers on; + + # enable session reuse + ssl_session_cache shared:SSL:8m; + ssl_session_timeout 5m; + + # cert/key + ssl_certificate /etc/nginx/ssl/server.crt; + ssl_certificate_key /etc/nginx/ssl/server.key; + + # OCSP stapling + ssl_stapling on; + ssl_stapling_verify on; + ssl_trusted_certificate /etc/nginx/ssl/ca.crt; + + + server { + listen 80 default_server; + listen [::]:80 default_server; + server_name _; + + return 301 https://$host$request_uri; + } + + server { + listen 443 default_server; + listen [::]:443 default_server; + server_name _; + + # use a variable for convenience + set $galaxy_root /srv/galaxy/server; + + # Enable HSTS + add_header Strict-Transport-Security "max-age=15552000; includeSubdomains"; + + # proxy all requests not matching other locations to uWSGI + location / { + uwsgi_pass unix:///srv/galaxy/var/uwsgi.sock + uwsgi_param UWSGI_SCHEME $scheme; + include uwsgi_params; + } + + # serve framework static content + location /static/style { + alias $galaxy_root/static/style/blue; + expires 24h; + } + location /static { + alias $galaxy_root/static; + expires 24h; + } + location /robots.txt { + alias $galaxy_root/static/robots.txt; + expires 24h; + } + location /favicon.ico { + alias $galaxy_root/static/favicon.ico; + expires 24h; + } + + # serve visualization and interactive environment plugin static content + location ~ ^/plugins/(?.+?)/(?.+?)/static/(?.*?)$ { + alias $galaxy_root/config/plugins/$plug_type/$vis_name/static/$static_file; + expires 24; + } + } +} +``` + +Be sure to set `$galaxy_root` to the path to your copy of Galaxy and modify the value of `uwsgi_pass` to match your +uWSGI socket path. With the default configuration, uWSGI will bind to a random TCP socket, so you will need to set it to +a fixed value as described in the [Scaling and Load Balancing](scaling.html) documentation. If using a UNIX domain +socket, be sure to pay particular attention to the discussion of users and permissions. + +### Implementation-specific Notes + +It is possible to perform the entire configuration in the main nginx configuration file (typically +`/etc/nginx/nginx.conf`), however, nginx packages as provided by Linux distribution package managers typically provide a +slightly more complex layout that is designed to prevent conflicts in `nginx.conf` when updating the package. + +On Debian-based Linux distributions (Debian, Ubuntu, etc.), the nginx package's default configuration contains two +include directives in the `http {}` block: + +- One which includes any configuration files with the `.conf` extension in the `/etc/nginx/conf.d` directory, where you + would place directives that belong in the `http {}` block. +- One which includes all files in the `/etc/nginx/sites-enabled` directory, which contains symlinks to + `/etc/nginx/sites-available`, where you would place the `server {}` configurations for websites hosted by this nginx + server. + +On EL-based Linux distributions (RedHat Enterprise Linux, CentOS, etc.), the EPEL nginx package's default configuration +contains a directive in the `http {}` block that includes any configuration files with the `.conf` extension in the +`/etc/nginx/conf.d` directory. + +Thus, on both Debian- and EL-based distributions, you might put the `http` directives in +`/etc/nginx/conf.d/galaxy_http_options.conf`. Note that these are **not** enclosed in an `http {}` block themselves, as +they are already enclosed by the `http {}` block in `/etc/nginx/nginx.conf`: + +```nginx +uwsgi_read_timeout 180; +client_max_body_size 10g; +ssl_certificate /etc/nginx/ssl/server.crt; +ssl_certificate_key /etc/nginx/ssl/server.key; +#... +``` + +Then for the site configurations, you might create: + +- `/etc/nginx/conf.d/galaxy_site.conf` on EL-based distributions +- `/etc/nginx/sites-available/galaxy` on Debian-based distributions + +With the `server {}` blocks (again, not enclosed in an `http {}`): + +```nginx +server { + listen 80 default_server; + listen [::]:80 default_server; + server_name _; + #... +} + +server { + listen 443 default_server; + listen [::]:443 default_server; + server_name _; + #... +} +``` + +On Debian-based distribution, you'd then need to symlink the config with: + +```shell-session +# ln -s /etc/nginx/sites-available/galaxy /etc/nginx/sites-enabled/galaxy +``` + +### Additional Notes + +- **Do not** simply copy the SSL configuration directives and expect them to work on your server or to be secure! These + are provided as examples of some of the best practices as of the time of writing, but will not always be up to date. + Use the guides referenced in [basic configuration](#basic-configuration) section to configure SSL properly. +- If your existing nginx configuration contains a line or included config file defining a default server, be sure to + disable it by commenting its `server {}` or preventing its inclusion (under Debian-based operating systems, this + is done by removing its symlink from `/etc/nginx/sites-enabled`. +- `uwsgi_read_timeout` can be adjusted as appropriate for your site. This is the amount of time allowed for + communication between nginx and uWSGI to block while waiting for a response from Galaxy, and is useful for holding + client (browser) connections while uWSGI is restarting Galaxy subprocesses or Galaxy is performing a slow operation. +- The parameter `client_max_body_size` specifies the maximum upload size that can be handled by POST requests through + nginx. You should set this to the largest file size that you wish to allow for upload and that could be reasonably + handled by your site. It defaults to 1MB, so it will need to be increased if you are dealing with genome sized + datasets. +- If you must serve Galaxy without SSL, you would simply replace the `listen` directives in the SSL `server {}` block + with the `listen` directives from the non-SSL `server {}` block and remove the non-SSL block and SSL directives from + the `http {}` block. +- If the proxy works but you are getting 404 errors for Galaxy's static content, be sure that the user that nginx runs + as has access to Galaxy's `static/` directory (and all its parent directories) on the filesystem. You can test this on + the command line with e.g. `sudo -u www-data ls /srv/galaxy/server/static`. + +### Serving Galaxy at a URL Prefix + +It may be necessary to serve Galaxy from an address other than the web server root (`https://www.example.org/galaxy`), +instead of `https://galaxy.example.org`). To do this, you need to make the following changes to the configuration in the +previous section: + +1. In the nginx config, prefix all of the location directives with your prefix and redirect requests from `/prefix` to + `/prefix/` like so: + + ```nginx + #... + + # proxy all requests not matching other locations to uWSGI + location /galaxy { + uwsgi_pass unix:///srv/galaxy/var/uwsgi.sock + uwsgi_param UWSGI_SCHEME $scheme; + include uwsgi_params; + } + + # serve framework static content + location /galaxy/static/style { + alias $galaxy_root/static/style/blue; + expires 24h; + } + + # additional static locations... + + # redirect /prefix -> /prefix/ + rewrite ^/galaxy$ /galaxy/ last; + ``` + +2. The Galaxy application needs to be aware that it is running with a prefix (for generating URLs in dynamic pages). + This is accomplished by configuring uWSGI and Galaxy (the `uwsgi` and `galaxy` sections in `config/galaxy.yml` + respectively) like so and restarting Galaxy: + + ```yaml + uwsgi: + #... + socket: unix:///srv/galaxy/var/uwsgi.sock + mount: /galaxy=galaxy.webapps.galaxy.buildapp:uwsgi_app() + manage-script-name: true + # `module` MUST NOT be set when `mount` is in use + #module: galaxy.webapps.galaxy.buildapp:uwsgi_app() + + galaxy: + #... + cookie_path: /galaxy + ``` + + `cookie_path` should be set to prevent Galaxy's session cookies from clobbering each other if you are running more + than one instance of Galaxy under different URL prefixes on the same hostname. + + Be sure to consult the [Scaling and Load Balancing](scaling.html) documentation, other options unrelated to proxying + should also be set in the `uwsgi` section of the config. + +## Advanced Configuration Topics + +### Sending Files With Nginx + +Galaxy sends files (e.g. dataset downloads) by opening the file and streaming it in chunks through the proxy server. +However, this ties up the Galaxy process, which can impact the performance of other operations (see [Production Server +Configuration](production.html) for a more in-depth explanation). + +Nginx can assume this task instead and as an added benefit, speed up downloads. This is accomplished through the use of +the special `X-Accel-Redirect` header. Dataset security is maintained in this configuration because nginx will still +check with Galaxy to ensure that the requesting user has permission to access the dataset before sending it. + +To enable it, add the following to your Galaxy's `server {}` block: + +```nginx + location /_x_accel_redirect/ { + internal; + alias /; + } +``` + +Next, edit `galaxy.yml` and make the following change before restarting Galaxy: + +```yaml +galaxy: + #... + nginx_x_accel_redirect_base: '/_x_accel_redirect' +``` + +For this to work, the user under which your nginx server runs will need read access to Galaxy's `files_path` directory +(by default, `database/files/`) and its contents. This is most easily done by adding the nginx user to the Galaxy user's +primary group and setting the `umask(2)` to create files with the group read permission set. If you start Galaxy from +the command line, you can do this like so: + +```shell-session +admin@server$ sudo usermod -a -G galaxy www-data # add `www-data` user to `galaxy` group +admin@server$ sudo -iu galaxy +galaxy@server$ umask 027 +galaxy@server$ sh run.sh +``` + +If you start Galaxy from supervisord, you can set the `umask` option in the [program +section](http://supervisord.org/configuration.html#program-x-section-settings) after adding the nginx user to the Galaxy +group as shown above. + +### Receiving Files With Nginx + +Galaxy receives files (e.g. dataset uploads) by streaming them in chunks through the proxy server and writing the files +to disk. However, this again ties up the Galaxy process. nginx can assume this task instead and as an added benefit, +speed up uploads. This is accomplished through the use of +[nginx_upload_module](http://www.grid.net.ru/nginx/upload.en.html), a 3rd-party nginx module. + +To enable it, you must first download, compile and install nginx with the upload module, since prior to NGINX 1.11.5, +nginx did not support shared modules, and the upload module is not yet shared-compatible. Because this is a tedious +and complicated process, the Galaxy Committers team maintains (for some platforms) versions of nginx modified from their +upstream package sources (APT, EPEL, etc.) to include the upload module: + +- [Ubuntu (PPA)](https://launchpad.net/~galaxyproject/+archive/ubuntu/nginx) +- [Enterprise Linux](https://depot.galaxyproject.org/yum/) + +To contribute support for additional platforms, please see the [Galaxy +Starforge](https://github.com/galaxyproject/starforge) project, which is used to do the repackaging. + + +Once nginx with the upload module is installed, create a directory in which to store uploads (ideally, for performance +reasons, on the same filesystem as Galaxy's datasets) and add the necessary directives to `nginx.conf`: + +```nginx +user galaxy; + +http { + + #... + + server { + + #... + + # handle file uploads via the upload module + location /_upload { + upload_store /srv/galaxy/upload_store; + upload_store_access user:rw group:rw; + upload_pass_form_field ""; + upload_set_form_field "__${upload_field_name}__is_composite" "true"; + upload_set_form_field "__${upload_field_name}__keys" "name path"; + upload_set_form_field "${upload_field_name}_name" "$upload_file_name"; + upload_set_form_field "${upload_field_name}_path" "$upload_tmp_path"; + upload_pass_args on; + upload_pass /_upload_done; + } + + # once upload is complete, redirect to the proper galaxy path + location /_upload_done { + set $dst /api/tools; + if ($args ~ nginx_redir=([^&]+)) { + set $dst $1; + } + rewrite "" $dst; + } +} +``` + +Note the `user` directive at the top, outside of the `http {}` block. To ensure that Galaxy has write permission on the +uploaded files, nginx's workers will need to run as the same user as Galaxy. + +When serving Galaxy at a URL prefix as described in the [Serving Galaxy at a URL +prefix](#serving-galaxy-at-a-url-prefix) section, you will need to change `set $dst /api/tools;` to `set $dst +/prefix/api/tools;` (e.g. `set $dst /galaxy/api/tools;`). + +Finally, edit `galaxy.yml` and make the following change before restarting Galaxy: + +```yaml +galaxy: + #... + nginx_upload_store: /srv/galaxy/upload_store + nginx_upload_path: '/_upload' +``` + +### Use Galaxy Authentication to Protect Custom Paths + +You may find it useful to require authentication for access to certain paths on your server. For example, Galaxy can +run a separate reports app which gives useful information about your Galaxy instance. See the [Reports Configuration +documentation](reports.html) and [Peter Briggs' blog post on the +subject](http://galacticengineer.blogspot.com/2015/06/exposing-galaxy-reports-via-nginx-in.html) for more. + +After succesfully following the blog post, Galaxy reports should be available at e.g. `https://galaxy.example.org/reports`. +To secure this page to only Galaxy administrators, adjust your nginx config accordingly: + +**TODO:** This is not valid for the uWSGI proxy method and needs to be updated. -nate 2018-01-11 + +```nginx + location /reports { + #... + satisfy any; # only one auth method needs to succeed + deny all; # host-based auth is not allowed + auth_request /_auth; # forward authentication + } + + location /_auth { + #internal; probably? + # The used galaxy api endpoint is only available to galaxy admins and thus limits the access + # to only logged in admins. + proxy_pass http://localhost/api/configuration/dynamic_tool_confs; + proxy_pass_request_body off; + proxy_set_header Content-Length ""; + proxy_set_header X-Original-URI $request_uri; + } +``` + +### External User Authentication + +- [Nginx for External Authentication](https://galaxyproject.org/admin/config/nginx-external-user-auth/) +- [Built-in Galaxy External Authentication](authentication.html) From a847dbd3d5e312b13cfe8a90844c8f88d3aedc78 Mon Sep 17 00:00:00 2001 From: mvdbeek Date: Fri, 12 Jan 2018 12:35:04 +0100 Subject: [PATCH 078/112] Fix tool report submission --- .../tools/error_reports/plugins/sentry.py | 19 ++++++++++++------- 1 file changed, 12 insertions(+), 7 deletions(-) diff --git a/lib/galaxy/tools/error_reports/plugins/sentry.py b/lib/galaxy/tools/error_reports/plugins/sentry.py index f6ad7710d20..4b7df39a79f 100644 --- a/lib/galaxy/tools/error_reports/plugins/sentry.py +++ b/lib/galaxy/tools/error_reports/plugins/sentry.py @@ -64,6 +64,17 @@ class SentryPlugin(ErrorPlugin): error_message = ERROR_TEMPLATE.format(**extra) # Update context with user information in a sentry-specific manner + + # Getting the url allows us to link to the dataset info page in case + # anything is missing from this report. + try: + url = web.url_for(controller="dataset", + action="show_params", + dataset_id=self.app.security.encode_id(dataset.id), + qualified=True) + except AttributeError: + # The above does not work when handlers are separate from the web handlers + url = None self.app.sentry_client.context.merge({ # User information here also places email links + allows seeing # a list of affected users in the tags/filtering. @@ -71,14 +82,8 @@ class SentryPlugin(ErrorPlugin): 'name': user.username, 'email': user.email, }, - # This allows us to link to the dataset info page in case - # anything is missing from this report. 'request': { - 'url': web.url_for( - controller="dataset", action="show_params", - dataset_id=self.app.security.encode_id(dataset.id), - qualified=True - ) + 'url': url } }) From a70ecd0147bb178b90b820d4c5cac0caa86152ab Mon Sep 17 00:00:00 2001 From: Nicola Soranzo Date: Fri, 12 Jan 2018 13:20:23 +0100 Subject: [PATCH 079/112] Fix common_startup.sh bashisms Introduced in commit 45a25a1b8bd182cc6dff2926974681ef1bf4fc6f . This was causing this error on the `dev` branch on Ubuntu (which uses `dash`): ``` $ ./run.sh ./scripts/common_startup.sh: 69: [: dev: unexpected operator Activating virtualenv at .venv ... ``` instead of exiting with the "The Galaxy client build is out of date." message. --- scripts/common_startup.sh | 6 +++--- 1 file changed, 3 insertions(+), 3 deletions(-) diff --git a/scripts/common_startup.sh b/scripts/common_startup.sh index 25a3d59fe98..736d8e4568f 100755 --- a/scripts/common_startup.sh +++ b/scripts/common_startup.sh @@ -66,14 +66,14 @@ done # Check client build state. if [ $SKIP_CLIENT_BUILD -eq 0 ]; then gitbranch=$(git rev-parse --abbrev-ref HEAD) - if [ $gitbranch == "dev" ]; then + if [ "$gitbranch" = "dev" ]; then # We're on dev. This branch (only, currently) doesn't have build # artifacts. We should probabably swap to a list of releases? # Compare hash. if [ -f static/client_build_hash.txt ]; then githash=$(git rev-parse HEAD) statichash=$(cat static/client_build_hash.txt) - if [ $githash == $statichash ]; then + if [ "$githash" = "$statichash" ]; then SKIP_CLIENT_BUILD=1 fi fi @@ -174,7 +174,7 @@ if [ $DEV_WHEELS -eq 1 ]; then fi if [ $FETCH_WHEELS -eq 1 ]; then - pip install $requirement_args --index-url "${GALAXY_WHEELS_INDEX_URL}" --extra-index-url "${PYPI_INDEX_URL}" + pip install "$requirement_args" --index-url "${GALAXY_WHEELS_INDEX_URL}" --extra-index-url "${PYPI_INDEX_URL}" GALAXY_CONDITIONAL_DEPENDENCIES=$(PYTHONPATH=lib python -c "import galaxy.dependencies; print '\n'.join(galaxy.dependencies.optional('$GALAXY_CONFIG_FILE'))") [ -z "$GALAXY_CONDITIONAL_DEPENDENCIES" ] || echo "$GALAXY_CONDITIONAL_DEPENDENCIES" | pip install -r /dev/stdin --index-url "${GALAXY_WHEELS_INDEX_URL}" --extra-index-url "${PYPI_INDEX_URL}" fi From f4131b8d2bcf75c1724e19265cf4ca93dfaefa73 Mon Sep 17 00:00:00 2001 From: Nate Coraor Date: Fri, 12 Jan 2018 10:45:50 -0500 Subject: [PATCH 080/112] Correct doc typos caught by @nsoranzo --- doc/source/admin/apache.md | 4 ++-- doc/source/admin/nginx.md | 4 ++-- 2 files changed, 4 insertions(+), 4 deletions(-) diff --git a/doc/source/admin/apache.md b/doc/source/admin/apache.md index 07119971409..e722f719538 100644 --- a/doc/source/admin/apache.md +++ b/doc/source/admin/apache.md @@ -52,7 +52,7 @@ For the purposes of this example, we assume that: - Galaxy runs as the user `galaxy` with primary group `galaxy` - Galaxy is served from the hostname `galaxy.example.org` -Throughout the configuration examples in this document, in order to avoid reptition, `#...` is used to denote a location +Throughout the configuration examples in this document, in order to avoid repetition, `#...` is used to denote a location where existing or previously given configuration statements would appear. ```eval_rst @@ -251,7 +251,7 @@ On Debian-based distribution, you'd then need to symlink the configs with (or do Use the guides referenced in [basic configuration](#basic-configuration) section to configure SSL properly. - If your existing Apache configuration contains a line or included config file defining a default server, be sure to disable it by commenting its `` or preventing its inclusion (under Debian-based operating systems, this - is done by removing its symlink from `/etc/apache2/sites-enabled`. + is done by removing its symlink from `/etc/apache2/sites-enabled`). - `ProxyTimeout` can be adjusted as appropriate for your site. This is the amount of time allowed for communication between Apache and uWSGI to block while waiting for a response from Galaxy, and is useful for holding client (browser) connections while uWSGI is restarting Galaxy subprocesses or Galaxy is performing a slow operation. diff --git a/doc/source/admin/nginx.md b/doc/source/admin/nginx.md index 5d09afe9761..7489254bae0 100644 --- a/doc/source/admin/nginx.md +++ b/doc/source/admin/nginx.md @@ -18,7 +18,7 @@ For the purposes of this example, we assume that: - Galaxy runs as the user `galaxy` with primary group `galaxy` - Galaxy is served from the hostname `galaxy.example.org` -Throughout the configuration examples in this document, in order to avoid reptition, `#...` is used to denote a location +Throughout the configuration examples in this document, in order to avoid repetition, `#...` is used to denote a location where existing or previously given configuration statements would appear. ```eval_rst @@ -238,7 +238,7 @@ On Debian-based distribution, you'd then need to symlink the config with: Use the guides referenced in [basic configuration](#basic-configuration) section to configure SSL properly. - If your existing nginx configuration contains a line or included config file defining a default server, be sure to disable it by commenting its `server {}` or preventing its inclusion (under Debian-based operating systems, this - is done by removing its symlink from `/etc/nginx/sites-enabled`. + is done by removing its symlink from `/etc/nginx/sites-enabled`). - `uwsgi_read_timeout` can be adjusted as appropriate for your site. This is the amount of time allowed for communication between nginx and uWSGI to block while waiting for a response from Galaxy, and is useful for holding client (browser) connections while uWSGI is restarting Galaxy subprocesses or Galaxy is performing a slow operation. From 5fcefe404f7d5cd5d2dbbf0628b265e9d24138f5 Mon Sep 17 00:00:00 2001 From: Nate Coraor Date: Fri, 12 Jan 2018 16:44:40 -0500 Subject: [PATCH 081/112] Attempt to reduce duplication in the proxy documentation through the use of includes, move the multi-config-file discussion to a common page. --- doc/source/admin/_inc_proxy_prereq.rst | 22 +++ doc/source/admin/_inc_proxy_serving_root.rst | 10 + doc/source/admin/_inc_proxy_ssl.rst | 25 +++ doc/source/admin/apache.md | 181 ++++++------------- doc/source/admin/nginx.md | 159 +++++----------- doc/source/admin/proxy_package_layout.rst | 172 ++++++++++++++++++ 6 files changed, 330 insertions(+), 239 deletions(-) create mode 100644 doc/source/admin/_inc_proxy_prereq.rst create mode 100644 doc/source/admin/_inc_proxy_serving_root.rst create mode 100644 doc/source/admin/_inc_proxy_ssl.rst create mode 100644 doc/source/admin/proxy_package_layout.rst diff --git a/doc/source/admin/_inc_proxy_prereq.rst b/doc/source/admin/_inc_proxy_prereq.rst new file mode 100644 index 00000000000..eddc002795e --- /dev/null +++ b/doc/source/admin/_inc_proxy_prereq.rst @@ -0,0 +1,22 @@ +This documentation should be used in conjunction with the `Scaling and Load Balancing` documentation, which you should +familiarize yourself with prior to setting up your proxy. + +You will need to ensure that inbound (and outbound) traffic on the HTTP (TCP port 80) and HTTPS (TCP port 443) ports is +permitted by your server's firewall/security. + +**Documentation Conventions:** + +For the purposes of this example, we assume that: + +- **Debian** refers to any *Debian*-based Linux distribution (including Ubuntu) +- **EL** refers to any *RedHat Enterprise Linux*-based Linux distribution (including CentOS) +- the Galaxy server is installed at ``/srv/galaxy/server`` +- |PROXY| runs as the user ``www-data`` (this is the default under Debian) +- Galaxy runs as the user ``galaxy`` with primary group ``galaxy`` +- Galaxy is served from the hostname ``galaxy.example.org`` + +Throughout the configuration examples in this document, in order to avoid repetition, ``#...`` is used to denote a +location where existing or previously given configuration statements would appear. + +.. danger:: Please note that Galaxy's files - code, datasets, and so forth - should *never* be located on disk inside + |PROXY|'s document root. By default, this would expose all of Galaxy (including datasets) to anyone on the web. diff --git a/doc/source/admin/_inc_proxy_serving_root.rst b/doc/source/admin/_inc_proxy_serving_root.rst new file mode 100644 index 00000000000..fe043fa0243 --- /dev/null +++ b/doc/source/admin/_inc_proxy_serving_root.rst @@ -0,0 +1,10 @@ +This configuration assumes that Galaxy will be the only site on your server using the given hostname (e.g. +``https://galaxy.example.org``). + +Beginning with Galaxy Release 18.01, the default application server that Galaxy runs under is uWSGI. Because of this, +the native high performance uWSGI protocol should be used for communication between |PROXY| and Galaxy, rather +than HTTP. Legacy instructions for proxying via HTTP can be found in the `Galaxy Release 17.09 proxy documentation`_. + +Since |PROXY| is more efficient than uWSGI at serving static content, it is best to serve it directly, reducing the load +on the Galaxy process and allowing for more effective compression (if enabled), caching, and pipelining. Directives to +do so are included in the example below. diff --git a/doc/source/admin/_inc_proxy_ssl.rst b/doc/source/admin/_inc_proxy_ssl.rst new file mode 100644 index 00000000000..ed815b49b3c --- /dev/null +++ b/doc/source/admin/_inc_proxy_ssl.rst @@ -0,0 +1,25 @@ +The use of SSL is **strongly encouraged** to avoid exposure of confidential information such as datasets and user +credentials to eavesdroppers. The instructions in this document are for setting up an SSL-enabled Galaxy server. + +When setting up an SSL server, simply enabling SSL with the default options is not enough to have a secure server. In +most cases, the configuration is weak and vulnerable to one or more of the multitude of SSL attacks that have been +recently prevalent. The `Qualys SSL/TLS Deployment Best Practices`_ is an excellent and up-to-date guide covering +everything necessary for securing an SSL server. In addition, the `Mozilla SSL Configuration Generator`_ can provide you +with a best practices config tailored to your desired security level and software versions. + +Finally, Google's `PageSpeed Insights`_ tool is helpful for determining how you can improve responsiveness as related to +proxying, such as verifying that caching and compression are configured properly. + +If you need to run more than one site on your Galaxy server, there are two options: + +- Run them on the same server but serve them on different hostnames +- Serve them from different URL prefixes on a single hostname + +The former option is typically cleaner, but if serving more than one SSL site, you will need an SSL certificate with +subjectAltNames_ for each hostname served by the server. + +.. _Qualys SSL/TLS Deployment Best Practices: https://www.ssllabs.com/projects/best-practices/ +.. _Mozilla SSL Configuration Generator: https://mozilla.github.io/server-side-tls/ssl-config-generator/ +.. _PageSpeed Insights: https://developers.google.com/speed/pagespeed/insights/ +.. _subjectAltNames: http://wiki.cacert.org/FAQ/subjectAltName + diff --git a/doc/source/admin/apache.md b/doc/source/admin/apache.md index e722f719538..d42f7b25a03 100644 --- a/doc/source/admin/apache.md +++ b/doc/source/admin/apache.md @@ -1,25 +1,50 @@ +```eval_rst +.. |PROXY| replace:: Apache +``` # Proxying Galaxy with Apache -For various reasons (performance, authentication, etc.) in a production environment, it's recommended to run Galaxy -behind a web server proxy. Although any proxy could work, Apache is a common choice. Alternatively, we use -[nginx](http://nginx.net/) for our public sites and open source infrastructure, and [details are -available](nginx.html) for it, too. +In a production environment, it is recommended to run Galaxy behind a proxy web server for performance and security +reasons. The proxy server sits between clients and your Galaxy server, relaying requests between them and offloading +some of the more menial and resource-intensive tasks. -Currently, the only recommended way to run Galaxy with Apache is using `mod_rewrite`, `mod_proxy`, and -`mod_proxy_uwsgi`. These modules must be enabled in the Apache config. The main proxy directives, `ProxyRequests` and -`ProxyVia` do **not** need to be enabled. +[The Apache HTTP Server][apache] is a widely deployed and very featureful general purpose web server with mature +proxying capabilities. + +Instructions for [proxying with NGINX](nginx.html), which is the proxy server used by The Galaxy Project's public +servers, [usegalaxy.org][main] ("Main") and [Test][test], as well as the [Docker Galaxy project][docker-galaxy], are +also available. + +[apache]: https://httpd.apache.org/ +[main]: https://galaxyproject.org/main/ +[test]: https://galaxyproject.org/test/ +[docker-galaxy]: https://github.com/bgruening/docker-galaxy-stable ## Prerequisites -Make sure that inbound (and outbound) traffic to the TCP protocol HTTP on port 80 (and HTTPS on port 443 if using SSL) -is permitted by your server's firewall/security. +```eval_rst +.. include:: _inc_proxy_prereq.rst +``` -These directions are written for Apache 2.4+. Apache 2.4 for Enterprise Linux (EL) 6 can be obtained from the [CentOS -SCLo SIG Repo](https://wiki.centos.org/SpecialInterestGroup/SCLo/CollectionsList). +### Apache Proxy Prerequisites + +Currently, the only recommended way to proxy Galaxy with Apache is using `mod_rewrite`, `mod_proxy`, and +`mod_proxy_uwsgi`. These modules must be enabled in the Apache config. The main proxy directives, `ProxyRequests` and +`ProxyVia` do **not** need to be enabled. + +Additionally, these directions are written for Apache 2.4+. Apache 2.4 for EL 6 can be obtained from the [CentOS SCLo +SIG Repo][sclo-sig-repo]. Otherwise, your system package manager's version of Apache should be suitable. On EL, you will +need to enable the [EPEL][epel] repository to obtain the `mod_proxy_uwsgi` package. + +```eval_rst +.. caution:: ``mod_uwsgi`` is not the same module as ``mod_proxy_uwsgi``. The former is the old and unsupported module. + Be sure that you have installed ``mod_proxy_uwsgi``. +``` Ensure that the `mod_headers`, `mod_rewrite`, `mod_proxy`, and `mod_proxy_uwsgi` modules are loaded. Although not required, the configuration examples also use `mod_deflate` and `mod_expires` for increased client/server performance, -so these should also be enabled. On Debian-based Linux distributions, you can do this with: +so these should also be enabled. + +On Debian you can install the necessary packages and enable the modules this with the following: ```shell-session # apt-get install apache2 libapache2-mod-proxy-uwsgi @@ -38,68 +63,34 @@ To activate the new configuration, you need to run: service apache2 restart ``` -On EL-based distributions, you will need to enable the [EPEL](https://fedoraproject.org/wiki/EPEL) repository and then: +And on EL: ```shell-session # yum install httpd mod_proxy_uwsgi # echo "LoadModule proxy_uwsgi_module modules/mod_proxy_uwsgi.so" > /etc/httpd/conf.modules.d/10-proxy-uwsgi.conf ``` -For the purposes of this example, we assume that: - -- the Galaxy server is installed at `/srv/galaxy/server` -- Apache runs as the user `www-data` (this is the default under Debian-based Linux distributions) -- Galaxy runs as the user `galaxy` with primary group `galaxy` -- Galaxy is served from the hostname `galaxy.example.org` - -Throughout the configuration examples in this document, in order to avoid repetition, `#...` is used to denote a location -where existing or previously given configuration statements would appear. - -```eval_rst -.. warning:: Please note that Galaxy should *never* be located on disk inside Apache's `DocumentRoot`. By default, this - would expose all of Galaxy (including datasets) to anyone on the web. -``` +[sclo-sig-repo]: https://wiki.centos.org/SpecialInterestGroup/SCLo/CollectionsList +[epel]: https://fedoraproject.org/wiki/EPEL ## Basic configuration -The use of SSL is **strongly encouraged** to avoid exposure of confidential information such as datasets and user -credentials to eavesdroppers. The instructions in this document are for setting an SSL-enabled Galaxy server. - -When setting up an SSL server, simply enabling SSL with the default options is not enough. In most cases, the -configuration is weak and vulnerable to one or more of the multitude of SSL attacks that have been recently prevalent. -The [Qualys SSL/TLS Deployment Best Practices](https://www.ssllabs.com/projects/best-practices/) is an excellent and -up-to-date guide covering everything necessary for securing an SSL server. In addition, the [Mozilla SSL Configuration -Generator](https://mozilla.github.io/server-side-tls/ssl-config-generator/) can provide you with a best practices config -tailored to your desired security level and software versions. - -Finally, Google's [PageSpeed Insights](https://developers.google.com/speed/pagespeed/insights/) tool is helpful for -determining how you can improve responsiveness as related to proxying, such as verifying that caching and compression -are configured properly. - -If you need to run more than one site on your Galaxy server, there are two options: - -- Run them on the same server but serve them on different hostnames -- Serve them from different URL prefixes on a single hostname - -The former option is typically cleaner, but if serving more than one SSL site, you will need an SSL certificate with -[subjectAltName](http://wiki.cacert.org/FAQ/subjectAltName)s for each hostname served by the server. +```eval_rst +.. include:: _inc_proxy_ssl.rst +``` ### Serving Galaxy at the Web Server Root -This configuration assumes that Galaxy will be the only site on your server using the given hostname (e.g. -`https://galaxy.example.org`). - -Beginning with Galaxy Release 18.01, the default application server that Galaxy runs under is uWSGI. Because of this, -the native high performance uWSGI protocol should be used for communication between the proxy server and Galaxy, rather -than HTTP. Legacy instructions for proxying via HTTP can be found in the [Galaxy Release 17.09 Apache -documentation](https://docs.galaxyproject.org/en/release_17.09/admin/special_topics/apache.html). - -Since Apache is more efficient than uWSGI at serving static content, it is best to serve it directly, reducing the load -on the Galaxy process and allowing for more effective compression (if enabled), caching, and pipelining. Directives to -do so are included in the example below. +```eval_rst +.. include:: _inc_proxy_serving_root.rst +.. _Galaxy Release 17.09 Proxy Documentation: https://docs.galaxyproject.org/en/release_17.09/admin/special_topics/apache.html +``` The following configuration is not exhaustive, only the portions most relevant to serving Galaxy are shown, these should -be incorporated with your existing/default Apache config as is appropriate for your server: +be incorporated with your existing/default Apache config as is appropriate for your server. Notably, the Apache package +you installed most likely has a multi-file config layout. If you are not already familiar with that layout and where +best to place your configuration, you can learn more in the [Proxy Package Layouts](proxy_package_layouts.html) +documentation. ```apache SSLProtocol all -SSLv3 @@ -184,74 +175,14 @@ uWSGI socket path. With the default configuration, uWSGI will bind to a random T a fixed value as described in the [Scaling and Load Balancing](scaling.html) documentation. If using a UNIX domain socket, be sure to pay particular attention to the discussion of users and permissions. -### Implementation-specific Notes - -It is possible to perform the entire configuration in the main Apache configuration file, however, Apache packages as -provided by Linux distribution package managers typically provide a slightly more complex layout that is designed to -prevent conflicts in the main Apahce config file when updating the package. - -On Debian-based Linux distributions (Debian, Ubuntu, etc.), the Apache package's default configuration in -`/etc/apache2/apache2.conf` contains two include directives: - -- One which includes any configuration files with the `.conf` extension in the `/etc/apache2/conf-enabled` directory, - which contains symlinks to `/etc/apache2/confs-available`, where you would place global (non-VirtualHost) - configuration directives. -- One which includes all files in the `/etc/apache2/sites-enabled` directory, which contains symlinks to - `/etc/apache2/sites-available`, where you would place the `` configurations for websites hosted by this - Apache server. - -On EL-based Linux distributions (RedHat Enterprise Linux, CentOS, etc.), the Apache package's default configuration in -`/etc/httpd/conf/httpd.conf` contains a directive in that includes any configuration files with the `.conf` extension in -the `/etc/httpd/conf.d` directory. - -Thus, you might create: - -- `/etc/httpd/conf.d/galaxy_options.conf` on Debian-based distributions -- `/etc/apache2/confs-available/galaxy.conf` on Debian-based distributions - -With the global configuration directives: - -```apache -SSLProtocol all -SSLv3 -SSLCipherSuite ... -#... -``` - -Then for the site configurations, you might create: - -- `/etc/httpd/conf.d/galaxy_site.conf` on EL-based distributions -- `/etc/apache2/sites-available/galaxy` on Debian-based distributions - -With the `` blocks: - -```apache - - Redirect permanent / https://galaxy.example.org - - - - SSLEngine on - SSLCertificateFile /etc/apache2/ssl/server.crt - SSLCertificateKeyFile /etc/apache2/ssl/server.key - #... - -``` - -On Debian-based distribution, you'd then need to symlink the configs with (or do it by hand with `ln -s`): - -```shell-session -# a2enconf galaxy -# a2ensite galaxy -``` - ### Additional Notes - **Do not** simply copy the SSL configuration directives and expect them to work on your server or to be secure! These are provided as examples of some of the best practices as of the time of writing, but will not always be up to date. Use the guides referenced in [basic configuration](#basic-configuration) section to configure SSL properly. - If your existing Apache configuration contains a line or included config file defining a default server, be sure to - disable it by commenting its `` or preventing its inclusion (under Debian-based operating systems, this - is done by removing its symlink from `/etc/apache2/sites-enabled`). + disable it by commenting its `` or preventing its inclusion (under Debian this is done by removing its + symlink from `/etc/apache2/sites-enabled`). - `ProxyTimeout` can be adjusted as appropriate for your site. This is the amount of time allowed for communication between Apache and uWSGI to block while waiting for a response from Galaxy, and is useful for holding client (browser) connections while uWSGI is restarting Galaxy subprocesses or Galaxy is performing a slow operation. @@ -328,9 +259,9 @@ Apache can assume this task instead and as an added benefit, speed up downloads. still check with Galaxy to ensure that the requesting user has permission to access the dataset before sending it. To enable it, you must first install `mod_xsendfile`. This is usually available via your package manager -(`libapache2-mod-xsendfile` on Debian-based distributions and `mod_xsendfile` from EPEL on EL-based distributions). Once -installed, add the appropriate `LoadModule` directive to your Apache configuration (`LoadModule xsendfile_module -/path/to/mod_xsendfile.so`, but both the Debian and EPEL packages do this for you upon installation). +(`libapache2-mod-xsendfile` on Debian and `mod_xsendfile` from EPEL on EL). Once installed, add the appropriate +`LoadModule` directive to your Apache configuration (`LoadModule xsendfile_module /path/to/mod_xsendfile.so`, but both +the Debian and EPEL packages do this for you upon installation). The, add `XSendFile` directives to your proxy configuration: diff --git a/doc/source/admin/nginx.md b/doc/source/admin/nginx.md index 7489254bae0..c6df513f4ac 100644 --- a/doc/source/admin/nginx.md +++ b/doc/source/admin/nginx.md @@ -1,73 +1,64 @@ +```eval_rst +.. |PROXY| replace:: nginx +``` + # Proxying Galaxy with NGINX -[NGINX](http://nginx.org/en/) is a lightweight http server designed with high performance proxying in mind. The public -Galaxy sites ([Main](https://galaxyproject.org/main/) and [Test](https://galaxyproject.org/test/)) as well as the -[Docker Galaxy project](https://github.com/bgruening/docker-galaxy-stable) use nginx to proxy rather than Apache for its -simple, fast load balancing and other features. +In a production environment, it is recommended to run Galaxy behind a proxy web server for performance and security +reasons. The proxy server sits between clients and your Galaxy server, relaying requests between them and offloading +some of the more menial and resource-intensive tasks. +[NGINX][nginx] is a lightweight HTTP server designed with high performance proxying in mind. The Galaxy Project's public +servers, [usegalaxy.org][main] ("Main") and [Test][test], as well as the [Docker Galaxy project][docker-galaxy] use +NGINX, rather than Apache, to proxy Galaxy. NGINX was chosen for its simple, fast load balancing and other +proxy-oriented features. + +Instructions for [proxying with Apache](apache.html) are also available. + +[nginx]: http://nginx.org/en/ +[main]: https://galaxyproject.org/main/ +[test]: https://galaxyproject.org/test/ +[docker-galaxy]: https://github.com/bgruening/docker-galaxy-stable ## Prerequisites -Make sure that inbound (and outbound) traffic to the TCP protocol HTTP on port 80 (and HTTPS on port 443 if using SSL) -is permitted by your server's firewall/security. - -For the purposes of this example, we assume that: - -- the Galaxy server is installed at `/srv/galaxy/server` -- nginx runs as the user `www-data` (this is the default under Debian-based Linux distributions) -- Galaxy runs as the user `galaxy` with primary group `galaxy` -- Galaxy is served from the hostname `galaxy.example.org` - -Throughout the configuration examples in this document, in order to avoid repetition, `#...` is used to denote a location -where existing or previously given configuration statements would appear. - ```eval_rst -.. warning:: Please note that Galaxy should *never* be located on disk inside nginx's document root. By default, this - would expose all of Galaxy (including datasets) to anyone on the web. +.. include:: _inc_proxy_prereq.rst ``` +### NGINX Proxy Prerequisities + +If you plan to use nginx to handle your file uploads, you will (most likely) not be able to use your package manager's +version of nginx. The [Receiving Files With NGINX](#receiving-files-with-nginx) section explains this in detail and +provides some options for installing *nginx + upload module* packages maintained by the Galaxy Committers Team. + +Otherwise, your system package manager's version of nginx should be suitable. Under Debian, the +[nginx-light][nginx-light] package contains all the necessary modules used in this guide. On EL, the [EPEL][epel] +version of nginx is suitable. + +[nginx-light]: https://packages.debian.org/search?keywords=nginx-light +[epel]: https://fedoraproject.org/wiki/EPEL + ## Basic Configuration -The use of SSL is **strongly encouraged** to avoid exposure of confidential information such as datasets and user -credentials to eavesdroppers. The instructions in this document are for setting an SSL-enabled Galaxy server. - -When setting up an SSL server, simply enabling SSL with the default options is not enough. In most cases, the -configuration is weak and vulnerable to one or more of the multitude of SSL attacks that have been recently prevalent. -The [Qualys SSL/TLS Deployment Best Practices](https://www.ssllabs.com/projects/best-practices/) is an excellent and -up-to-date guide covering everything necessary for securing an SSL server. In addition, the [Mozilla SSL Configuration -Generator](https://mozilla.github.io/server-side-tls/ssl-config-generator/) can provide you with a best practices config -tailored to your desired security level and software versions. - -Finally, Google's [PageSpeed Insights](https://developers.google.com/speed/pagespeed/insights/) tool is helpful for -determining how you can improve responsiveness as related to proxying, such as verifying that caching and compression -are configured properly. - -If you need to run more than one site on your Galaxy server, there are two options: - -- Run them on the same server but serve them on different hostnames -- Serve them from different URL prefixes on a single hostname - -The former option is typically cleaner, but if serving more than one SSL site, you will need an SSL certificate with -[subjectAltName](http://wiki.cacert.org/FAQ/subjectAltName)s for each hostname served by the server. +```eval_rst +.. include:: _inc_proxy_ssl.rst +``` ### Serving Galaxy at the Web Server Root -This configuration assumes that Galaxy will be the only site on your server using the given hostname (e.g. -`https://galaxy.example.org`). - -Beginning with Galaxy Release 18.01, the default application server that Galaxy runs under is uWSGI. Because of this, -the native high performance uWSGI protocol should be used for communication between the proxy server and Galaxy, rather -than HTTP. Legacy instructions for proxying via HTTP can be found in the [Galaxy Release 17.09 nginx -documentation](https://docs.galaxyproject.org/en/release_17.09/admin/special_topics/nginx.html). +```eval_rst +.. include:: _inc_proxy_serving_root.rst +.. _Galaxy Release 17.09 Proxy Documentation: https://docs.galaxyproject.org/en/release_17.09/admin/special_topics/nginx.html +``` uWSGI protocol support is built in to nginx, so (unlike Apache) no extra modules or recompiling should be required. -Since nginx is more efficient than uWSGI at serving static content, it is best to serve it directly, reducing the load -on the Galaxy process and allowing for more effective compression (if enabled), caching, and pipelining. Directives to -do so are included in the example below. - The following configuration is not exhaustive, only the portions most relevant to serving Galaxy are shown, these should -be incorporated with your existing/default nginx config as is appropriate for your server: +be incorporated with your existing/default nginx config as is appropriate for your server. Notably, the nginx package +you installed most likely has a multi-file config layout. If you are not already familiar with that layout and where +best to place your configuration, you can learn more in the [Proxy Package Layouts](proxy_package_layouts.html) +documentation. ```nginx http { @@ -171,74 +162,14 @@ uWSGI socket path. With the default configuration, uWSGI will bind to a random T a fixed value as described in the [Scaling and Load Balancing](scaling.html) documentation. If using a UNIX domain socket, be sure to pay particular attention to the discussion of users and permissions. -### Implementation-specific Notes - -It is possible to perform the entire configuration in the main nginx configuration file (typically -`/etc/nginx/nginx.conf`), however, nginx packages as provided by Linux distribution package managers typically provide a -slightly more complex layout that is designed to prevent conflicts in `nginx.conf` when updating the package. - -On Debian-based Linux distributions (Debian, Ubuntu, etc.), the nginx package's default configuration contains two -include directives in the `http {}` block: - -- One which includes any configuration files with the `.conf` extension in the `/etc/nginx/conf.d` directory, where you - would place directives that belong in the `http {}` block. -- One which includes all files in the `/etc/nginx/sites-enabled` directory, which contains symlinks to - `/etc/nginx/sites-available`, where you would place the `server {}` configurations for websites hosted by this nginx - server. - -On EL-based Linux distributions (RedHat Enterprise Linux, CentOS, etc.), the EPEL nginx package's default configuration -contains a directive in the `http {}` block that includes any configuration files with the `.conf` extension in the -`/etc/nginx/conf.d` directory. - -Thus, on both Debian- and EL-based distributions, you might put the `http` directives in -`/etc/nginx/conf.d/galaxy_http_options.conf`. Note that these are **not** enclosed in an `http {}` block themselves, as -they are already enclosed by the `http {}` block in `/etc/nginx/nginx.conf`: - -```nginx -uwsgi_read_timeout 180; -client_max_body_size 10g; -ssl_certificate /etc/nginx/ssl/server.crt; -ssl_certificate_key /etc/nginx/ssl/server.key; -#... -``` - -Then for the site configurations, you might create: - -- `/etc/nginx/conf.d/galaxy_site.conf` on EL-based distributions -- `/etc/nginx/sites-available/galaxy` on Debian-based distributions - -With the `server {}` blocks (again, not enclosed in an `http {}`): - -```nginx -server { - listen 80 default_server; - listen [::]:80 default_server; - server_name _; - #... -} - -server { - listen 443 default_server; - listen [::]:443 default_server; - server_name _; - #... -} -``` - -On Debian-based distribution, you'd then need to symlink the config with: - -```shell-session -# ln -s /etc/nginx/sites-available/galaxy /etc/nginx/sites-enabled/galaxy -``` - ### Additional Notes - **Do not** simply copy the SSL configuration directives and expect them to work on your server or to be secure! These are provided as examples of some of the best practices as of the time of writing, but will not always be up to date. Use the guides referenced in [basic configuration](#basic-configuration) section to configure SSL properly. - If your existing nginx configuration contains a line or included config file defining a default server, be sure to - disable it by commenting its `server {}` or preventing its inclusion (under Debian-based operating systems, this - is done by removing its symlink from `/etc/nginx/sites-enabled`). + disable it by commenting its `server {}` or preventing its inclusion (under Debian this is done by removing its + symlink from `/etc/nginx/sites-enabled`). - `uwsgi_read_timeout` can be adjusted as appropriate for your site. This is the amount of time allowed for communication between nginx and uWSGI to block while waiting for a response from Galaxy, and is useful for holding client (browser) connections while uWSGI is restarting Galaxy subprocesses or Galaxy is performing a slow operation. diff --git a/doc/source/admin/proxy_package_layout.rst b/doc/source/admin/proxy_package_layout.rst new file mode 100644 index 00000000000..7c038adf31f --- /dev/null +++ b/doc/source/admin/proxy_package_layout.rst @@ -0,0 +1,172 @@ +Proxy Package Layouts +======================================== + +Every software package has a suggested filesystem layout, and proxy servers like Apache and NGINX are no exception. +However, Linux distribution package maintainers often have their own opinions about layout, especially with respect to +following a layout standard or scheme employed by their particular distribution. + +Thus, although you can configure the proxy server entirely within its primary configuration file, if you have installed +the proxy via your system package manager, this may not be the best idea. The primary config file in the cases of both Apache +and nginx under both Debian-based distributions and Enterprise Linux-based distributions contains various *include* +directives designed to allow you to place your configuration in files that are entirely controlled by you. This helps to +avoid conflicts in the primary config file when the package is upgraded. + +.. hint:: + + Primary configuration files can be found at: + + - nginx (both EL and Debian): ``/etc/nginx/nginx.conf`` + - Apache: + + - EL: ``/etc/httpd/conf/httpd.conf`` + - Debian: ``/etc/apache2/apache2.conf`` + +Package Layout Overviews +--------------------------- + +Debian +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +Debian uses a very similar directory scheme for both nginx and Apache, where ```` is ``apache2`` or ``nginx`` +and ```` is some configuration subcomponent: + +- ``/etc//-available`` for files containing configuration snippets for various instances of the given + component +- ``/etc//-enabled`` for symbolic links to files in ``/etc//-available`` for each + snippet that the administrator wishes to enable + +``-available`` is effectively a "repository" for configurations which are enabled by symbolic links in +``-enabled``. + +Both nginx and Apache use the component ``sites``, intended for individual website configurations. Apache additionally +uses the components ``mods`` and ``conf`` for module loading/configuration and general global configuration statements, +respectively. Nginx, lacking the ``mods`` and ``conf`` components, provides ``/etc/nginx/conf.d`` + +.. tip:: + + On Debian, the paths most relevant to our purposes are: + + - nginx: + + - ``/etc/nginx/conf.d/*.conf`` for general directives that belong in the ``http {}`` block + - ``/etc/nginx/sites-available/*`` for individual site configs + - ``/etc/nginx/sites-enabled/*`` to enable sites + + - Apache: + + - ``/etc/apache2/conf-available/*`` for general directives that belong in the ``http {}`` block + - ``/etc/apache2/conf-enabled/*`` to enable configs + - ``/etc/apache2/sites-available/*`` for individual site configs + - ``/etc/apache2/sites-enabled/*`` to enable sites + +Enterprise Linux +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +EL's layout is simpler: both nginx and Apache provide a single configuration inclusion directory, where ```` is +``httpd`` or ``nginx``: + +- ``/etc//conf.d/`` + +Apache additionally has a module configuration directory at ``/etc/httpd/conf.modules.d`` + +.. tip:: + + On EL, the paths most relevant to our purposes are: + + - nginx: ``/etc/nginx/conf.d/*.conf`` + - Apache: ``/etc/httpd/conf.d/*.conf`` + +NGINX +--------------------------- + +**Global option configuration:** + +On both Debian and EL, you could create ``/etc/nginx/conf.d/galaxy_options.conf`` for global options intended for the +``http {}`` block. Because this file is included from within the ``http {}`` block, you would simply define directives +without enclosing them in any sort of block: + +.. code-block:: nginx + + uwsgi_read_timeout 180; + client_max_body_size 10g; + ssl_certificate /etc/nginx/ssl/server.crt; + ssl_certificate_key /etc/nginx/ssl/server.key; + #... + +**Site configuration:** + +For the site configurations, you could create: + +- ``/etc/nginx/sites-available/galaxy`` on Debian +- ``/etc/nginx/conf.d/galaxy_site.conf`` on EL + +These files contain ``server {}`` blocks (again, not enclosed in an ``http {}``): + +.. code-block:: nginx + + server { + listen 80 default_server; + listen [::]:80 default_server; + server_name _; + #... + } + + server { + listen 443 default_server; + listen [::]:443 default_server; + server_name _; + #... + } + +On Debian, you'd then need to symlink the config with: + +.. code-block:: shell-session + + # ln -s /etc/nginx/sites-available/galaxy /etc/nginx/sites-enabled/galaxy + +Apache +--------------------------- + +**Global option configuration:** + +For the global options, you could create: + +- ``/etc/apache2/confs-available/galaxy.conf`` on Debian +- ``/etc/httpd/conf.d/galaxy_options.conf`` on EL + +With the global configuration directives: + +.. code-block:: apache + + SSLProtocol all -SSLv3 + SSLCipherSuite ... + #... + +**Site configuration:** + +For the site configurations, you could create: + +- ``/etc/apache2/sites-available/galaxy.conf`` on Debian +- ``/etc/httpd/conf.d/galaxy_site.conf`` on EL + +With the ```` blocks: + +.. code-block:: apache + + + Redirect permanent / https://galaxy.example.org + + + + SSLEngine on + SSLCertificateFile /etc/apache2/ssl/server.crt + SSLCertificateKeyFile /etc/apache2/ssl/server.key + #... + + +On Debian you'd then need to symlink the configs with (or do it by hand with `ln -s`): + +.. code-block:: shell-session + + # a2enconf galaxy + # a2ensite galaxy From efb061d4d4a88b491e77b52b670d18c1f28a81de Mon Sep 17 00:00:00 2001 From: Nate Coraor Date: Fri, 12 Jan 2018 16:51:37 -0500 Subject: [PATCH 082/112] Add a tiny bit about uwsgitop --- doc/source/admin/scaling.md | 7 +++++++ 1 file changed, 7 insertions(+) diff --git a/doc/source/admin/scaling.md b/doc/source/admin/scaling.md index 8829f18ff90..f504ff0e31f 100644 --- a/doc/source/admin/scaling.md +++ b/doc/source/admin/scaling.md @@ -466,6 +466,13 @@ Python application. The `chdir` option is useful if you are not using `run.sh`, to be able to call `uwsgi` from anywhere without having to `cd` to the Galaxy directory first. +**Monitoring** + +The [uwsgitop](https://github.com/xrmx/uwsgitop) tool uses uWSGI's stats server (the `stats` option, which is configured +to listen on a socket or port in the same manner as the `socket` option) to report on the health and performance of the +web workers. It can be installed with `pip install uwsgitop`. This tool can be useful for determing whether a worker is +stuck, or seeing the throughput of traffic on your site. + ## Starting and Stopping If you are using the **uWSGI + Webless job handlers** deployment strategy or want to run your Galaxy server as a From 6b444f609d3a48d17a783e581dc077b0731673ca Mon Sep 17 00:00:00 2001 From: mvdbeek Date: Sat, 13 Jan 2018 13:10:46 +0100 Subject: [PATCH 083/112] Revert "resort the converters so that the accepted_formats are infront" This reverts commit 446643159540f8db67dfd0752560b387b63fc4b8. --- lib/galaxy/datatypes/registry.py | 17 +---------------- 1 file changed, 1 insertion(+), 16 deletions(-) diff --git a/lib/galaxy/datatypes/registry.py b/lib/galaxy/datatypes/registry.py index 72f818e55e3..b893f869b73 100644 --- a/lib/galaxy/datatypes/registry.py +++ b/lib/galaxy/datatypes/registry.py @@ -804,7 +804,6 @@ class Registry(object): converters = odict() source_datatype = type(self.get_datatype_by_extension(ext)) for ext2, converters_dict in self.datatype_converters.items(): - converter_datatype = type(self.get_datatype_by_extension(ext2)) if issubclass(source_datatype, converter_datatype): converters.update(converters_dict) @@ -823,21 +822,7 @@ class Registry(object): def find_conversion_destination_for_dataset_by_extensions(self, dataset, accepted_formats, converter_safe=True): """Returns ( target_ext, existing converted dataset )""" - - converters = self.get_converters_by_datatype(dataset.ext) - new_order = odict() - - accepted_format_keys = list() - for k in accepted_formats: - accepted_format_keys.append(k.file_ext) - if k.file_ext in converters: - new_order[k.file_ext] = converters[k.file_ext] - - for k,v in converters.items(): - if not k in accepted_format_keys: - new_order[k] = v - - for convert_ext in new_order: + for convert_ext in self.get_converters_by_datatype(dataset.ext): convert_ext_datatype = self.get_datatype_by_extension(convert_ext) if convert_ext_datatype is None: self.log.warning("Datatype class not found for extension '%s', which is used as target for conversion from datatype '%s'" % (convert_ext, dataset.ext)) From c2328e32eb18bd7a4a5c791306203b933fc73603 Mon Sep 17 00:00:00 2001 From: mvdbeek Date: Thu, 11 Jan 2018 15:04:33 +0100 Subject: [PATCH 084/112] Move up sam_to_bam_native converter That should allow implicit conversion from sam to bam_native for tools that support bam_native. --- config/datatypes_conf.xml.sample | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/config/datatypes_conf.xml.sample b/config/datatypes_conf.xml.sample index 4045ac713fc..7c590f5e7df 100644 --- a/config/datatypes_conf.xml.sample +++ b/config/datatypes_conf.xml.sample @@ -288,8 +288,8 @@ - + From bae64800f072f84c7bbfda2c29f4330d6ca6552e Mon Sep 17 00:00:00 2001 From: Nuwan Goonasekera Date: Sat, 13 Jan 2018 18:33:43 +0530 Subject: [PATCH 085/112] Fix discover_target_directory and pass correct parameter Fix according to review comment: https://github.com/galaxyproject/galaxy/pull/5240/files#r159138549 --- lib/galaxy/tools/parameters/output_collect.py | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/lib/galaxy/tools/parameters/output_collect.py b/lib/galaxy/tools/parameters/output_collect.py index 6a69cb6863e..3e6ecc645df 100644 --- a/lib/galaxy/tools/parameters/output_collect.py +++ b/lib/galaxy/tools/parameters/output_collect.py @@ -474,7 +474,7 @@ def discover_files(output_name, tool_provided_metadata, extra_file_collectors, j # just load entries from tool provided metadata... assert len(extra_file_collectors) == 1 extra_file_collector = extra_file_collectors[0] - target_directory = discover_target_directory(extra_file_collector, job_working_directory) + target_directory = discover_target_directory(extra_file_collector.directory, job_working_directory) for dataset in tool_provided_metadata.get_new_datasets(output_name): filename = dataset["filename"] path = os.path.join(target_directory, filename) From a36ebe35521e3e45c5c3301eef9535ebdf630f9d Mon Sep 17 00:00:00 2001 From: mvdbeek Date: Sat, 13 Jan 2018 14:17:56 +0100 Subject: [PATCH 086/112] Enhance tests for sam_to_bam conversion This demonstrates that the `sam_to_bam` converter will be used for an input with `format="bam"`, and not `sam_to_bam_native`. --- test/functional/tools/sam_to_bam_native.xml | 21 +++++++++++++++------ 1 file changed, 15 insertions(+), 6 deletions(-) diff --git a/test/functional/tools/sam_to_bam_native.xml b/test/functional/tools/sam_to_bam_native.xml index b960bb4c87a..aed8f24892c 100644 --- a/test/functional/tools/sam_to_bam_native.xml +++ b/test/functional/tools/sam_to_bam_native.xml @@ -8,30 +8,39 @@ -b -h -@ \${GALAXY_SLOTS:-2} - -o '${output}' + -o '$bam_native_output' '$input1' - #else - cp '$input2' '$output' + #elif $input2: + cp '$input2' '$bam_native_output' + #elif $input3: + cp '$input3' '$bam_output' #end if ]]> + - + + - + - + + + + + + From 6cb9d664dee2af178f179e9fc3f528710c5d4507 Mon Sep 17 00:00:00 2001 From: anup kumar Date: Sun, 14 Jan 2018 11:42:15 +0100 Subject: [PATCH 087/112] Fix Galaxy instance startup error --- scripts/common_startup.sh | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/scripts/common_startup.sh b/scripts/common_startup.sh index 736d8e4568f..41344166bf9 100755 --- a/scripts/common_startup.sh +++ b/scripts/common_startup.sh @@ -174,7 +174,7 @@ if [ $DEV_WHEELS -eq 1 ]; then fi if [ $FETCH_WHEELS -eq 1 ]; then - pip install "$requirement_args" --index-url "${GALAXY_WHEELS_INDEX_URL}" --extra-index-url "${PYPI_INDEX_URL}" + pip install $requirement_args --index-url "${GALAXY_WHEELS_INDEX_URL}" --extra-index-url "${PYPI_INDEX_URL}" GALAXY_CONDITIONAL_DEPENDENCIES=$(PYTHONPATH=lib python -c "import galaxy.dependencies; print '\n'.join(galaxy.dependencies.optional('$GALAXY_CONFIG_FILE'))") [ -z "$GALAXY_CONDITIONAL_DEPENDENCIES" ] || echo "$GALAXY_CONDITIONAL_DEPENDENCIES" | pip install -r /dev/stdin --index-url "${GALAXY_WHEELS_INDEX_URL}" --extra-index-url "${PYPI_INDEX_URL}" fi From e7b98dff47d2ae48c1d1cc9a609d7de992f23ac2 Mon Sep 17 00:00:00 2001 From: mvdbeek Date: Mon, 15 Jan 2018 17:40:43 +0100 Subject: [PATCH 088/112] Fix string substitution syntax --- lib/galaxy/tools/__init__.py | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/lib/galaxy/tools/__init__.py b/lib/galaxy/tools/__init__.py index d9b3dc74dfc..b46e3226eb0 100755 --- a/lib/galaxy/tools/__init__.py +++ b/lib/galaxy/tools/__init__.py @@ -2517,7 +2517,7 @@ class SortTool(DatabaseOperationTool): try: sorted_elements = [old_elements_dict[line.strip()] for line in open(hda.file_name)] except KeyError: - hdca_history_name = "%s: %s" (hdca.hid, hdca.name) + hdca_history_name = "%s: %s" % (hdca.hid, hdca.name) message = "List of element identifiers does not match element identifiers in collection '%s'" % hdca_history_name raise Exception(message) From cdc6657bda6a70ecc036f53cf265f1815dc2badc Mon Sep 17 00:00:00 2001 From: Nate Coraor Date: Mon, 15 Jan 2018 15:08:42 -0500 Subject: [PATCH 089/112] Update galaxy.yml.sample uwsgi section from defaults in get_uwsgi_args.py --- config/galaxy.yml.sample | 57 ++++++++++++++++-- lib/galaxy/webapps/config_manage.py | 91 ++++++++++++++++++++++++----- 2 files changed, 131 insertions(+), 17 deletions(-) diff --git a/config/galaxy.yml.sample b/config/galaxy.yml.sample index 011d98383ee..9911f4ab323 100644 --- a/config/galaxy.yml.sample +++ b/config/galaxy.yml.sample @@ -20,17 +20,59 @@ uwsgi: # The address and port on which to listen. By default, only listen to # localhost (galaxy will not be accessible over the network). Use - # '0.0.0.0' to listen on all available network interfaces. + # ':8080' to listen on all available network interfaces. http: 127.0.0.1:8080 - threads: 8 + # Number of web server (worker) processes to fork after the + # application has loaded. + processes: 1 - http-raw-body: True + # Number of threads for each web server process. + threads: 4 - offload-threads: 8 + # Number of threads for serving static content and handling internal + # routing requests. + offload-threads: 2 + # Mapping to serve style content. + static-map: /static/style=static/style/blue + + # Mapping to serve the remainder of the static content. + static-map: /static=static + + # Enable the master process manager. Disabled by default for maximum + # compatibility with CTRL+C, but should be enabled for use with + # --daemon and/or production deployments. + master: false + + # Path to the application's Python virtual environment. + virtualenv: .venv + + # Path to the application's Python library. + pythonpath: lib + + # The entry point which returns the web application (e.g. Galaxy, + # Reports, etc.) that you are loading. module: galaxy.webapps.galaxy.buildapp:uwsgi_app() + # Cause uWSGI to respect the traditional behavior of dying on SIGTERM + # (its default is to brutally reload workers) + die-on-term: true + + # Cause uWSGI to gracefully reload workers and mules upon receipt of + # SIGINT (its default is to brutally kill workers) + hook-master-start: unix_signal:2 gracefully_kill_them_all + + # Cause uWSGI to gracefully reload workers and mules upon receipt of + # SIGTERM (its default is to brutally kill workers) + hook-master-start: unix_signal:15 gracefully_kill_them_all + + # Feature necessary for proper mule signal handling + py-call-osafterfork: true + + # Ensure application threads will run if `threads` is unset. + enable-threads: true + galaxy: # If running behind a proxy server and Galaxy is served from a @@ -811,6 +853,13 @@ galaxy: # verbosity. #log_level: DEBUG + # Controls where and how the server logs messages. If unset, the + # default is to log all messages to standard output at the level + # defined by the `log_level` configuration option. Configuration is + # described in the documentation at: + # https://docs.galaxyproject.org/en/master/admin/config_logging.html + #logging: galaxy.config.LOGGING_CONFIG_DEFAULT + # Print database operations to the server log (warning, quite # verbose!). #database_engine_option_echo: false diff --git a/lib/galaxy/webapps/config_manage.py b/lib/galaxy/webapps/config_manage.py index bdcad53d441..f92be052ad2 100644 --- a/lib/galaxy/webapps/config_manage.py +++ b/lib/galaxy/webapps/config_manage.py @@ -51,14 +51,84 @@ App = namedtuple( UWSGI_OPTIONS = OrderedDict([ ('http', { - 'desc': """The address and port on which to listen. By default, only listen to localhost ($app_name will not be accessible over the network). Use '0.0.0.0' to listen on all available network interfaces.""", + 'desc': """The address and port on which to listen. By default, only listen to localhost ($app_name will not be accessible over the network). Use ':$default_port' to listen on all available network interfaces.""", 'default': '127.0.0.1:$default_port', 'type': 'str', }), - ('threads', { - 'default': 8, + ('processes', { + 'desc': """Number of web server (worker) processes to fork after the application has loaded.""", + 'default': '1', 'type': 'int', }), + ('threads', { + 'desc': """Number of threads for each web server process.""", + 'default': 4, + 'type': 'int', + }), + ('offload-threads', { + 'desc': """Number of threads for serving static content and handling internal routing requests.""", + 'default': '2', + 'type': 'int', + }), + ('static-map.1', { + 'key': 'static-map', + 'desc': """Mapping to serve style content.""", + 'default': '/static/style=static/style/blue', + 'type': 'str', + }), + ('static-map.2', { + 'key': 'static-map', + 'desc': """Mapping to serve the remainder of the static content.""", + 'default': '/static=static', + 'type': 'str', + }), + ('master', { + 'desc': """Enable the master process manager. Disabled by default for maximum compatibility with CTRL+C, but should be enabled for use with --daemon and/or production deployments.""", + 'default': 'false', + 'type': 'str', + }), + ('virtualenv', { + 'desc': """Path to the application's Python virtual environment.""", + 'default': '.venv', + 'type': 'str', + }), + ('pythonpath', { + 'desc': """Path to the application's Python library.""", + 'default': 'lib', + 'type': 'str', + }), + ('module', { + 'desc': """The entry point which returns the web application (e.g. Galaxy, Reports, etc.) that you are loading.""", + 'default': '$uwsgi_module', + 'type': 'str', + }), + ('die-on-term', { + 'desc': """Cause uWSGI to respect the traditional behavior of dying on SIGTERM (its default is to brutally reload workers)""", + 'default': 'true', + 'type': 'str', + }), + ('hook-master-start.1', { + 'key': 'hook-master-start', + 'desc': """Cause uWSGI to gracefully reload workers and mules upon receipt of SIGINT (its default is to brutally kill workers)""", + 'default': 'unix_signal:2 gracefully_kill_them_all', + 'type': 'str', + }), + ('hook-master-start.2', { + 'key': 'hook-master-start', + 'desc': """Cause uWSGI to gracefully reload workers and mules upon receipt of SIGTERM (its default is to brutally kill workers)""", + 'default': 'unix_signal:15 gracefully_kill_them_all', + 'type': 'str', + }), + ('py-call-osafterfork', { + 'desc': """Feature necessary for proper mule signal handling""", + 'default': 'true', + 'type': 'str', + }), + ('enable-threads', { + 'desc': """Ensure application threads will run if `threads` is unset.""", + 'default': 'true', + 'type': 'str', + }), # ('route-uri', { # 'default': '^/proxy/ goto:proxy' # }), @@ -74,16 +144,9 @@ UWSGI_OPTIONS = OrderedDict([ # ('route-run', { # 'default': "['log:Proxy ${HTTP_HOST} to ${TARGET_HOST}', 'httpdumb:${TARGET_HOST}']", # }), - ('http-raw-body', { - 'default': 'True' - }), - ('offload-threads', { - 'default': '8', - }), - ('module', { - 'default': '$uwsgi_module', - 'type': 'str', - }) + #('http-raw-body', { + # 'default': 'True' + #}), ]) DROP_OPTION_VALUE = object() @@ -654,6 +717,8 @@ def _write_sample_section(args, f, section_header, schema, as_comment=True, uwsg default = None if "default" not in value else value["default"] option = schema.get_app_option(key) option_value = OptionValue(key, default, option) + # support uWSGI "dumb yaml parser" (unbit/uwsgi#863) + key = option.get('key', key) _write_option(args, f, key, option_value, as_comment=as_comment, uwsgi_hack=uwsgi_hack) From 69e35a24345469f1bbb4da46a4bfd3b8786e5ece Mon Sep 17 00:00:00 2001 From: Martin Cech Date: Mon, 15 Jan 2018 15:58:51 -0500 Subject: [PATCH 090/112] allow message to be modified on ldda implements #5309 --- client/galaxy/scripts/mvc/library/library-dataset-view.js | 7 ++++++- lib/galaxy/managers/library_datasets.py | 6 +++++- 2 files changed, 11 insertions(+), 2 deletions(-) diff --git a/client/galaxy/scripts/mvc/library/library-dataset-view.js b/client/galaxy/scripts/mvc/library/library-dataset-view.js index 81a26034863..3c9fd090924 100644 --- a/client/galaxy/scripts/mvc/library/library-dataset-view.js +++ b/client/galaxy/scripts/mvc/library/library-dataset-view.js @@ -409,6 +409,11 @@ var LibraryDatasetView = Backbone.View.extend({ ld.set("misc_info", new_info); is_changed = true; } + var new_message = this.$el.find(".input_dataset_message").val(); + if (typeof new_message !== "undefined" && new_message !== ld.get("message")) { + ld.set("message", new_message); + is_changed = true; + } var new_genome_build = this.select_genome.$el.select2("data").id; if (typeof new_genome_build !== "undefined" && new_genome_build !== ld.get("genome_build")) { ld.set("genome_build", new_genome_build); @@ -972,7 +977,7 @@ var LibraryDatasetView = Backbone.View.extend({ "", "", 'Message', - '<%= _.escape(item.get("message")) %>', + '">', "", "", 'Misc. blurb', diff --git a/lib/galaxy/managers/library_datasets.py b/lib/galaxy/managers/library_datasets.py index 5db80efce67..5826486dbf6 100644 --- a/lib/galaxy/managers/library_datasets.py +++ b/lib/galaxy/managers/library_datasets.py @@ -78,6 +78,10 @@ class LibraryDatasetsManager(object): if new_misc_info is not None and new_misc_info != ldda.info: ldda.info = new_misc_info changed = True + new_message = new_data.get('message', None) + if new_message is not None and new_message != ldda.message: + ldda.message = new_message + changed = True new_file_ext = new_data.get('file_ext', None) if new_file_ext is not None and new_file_ext != ldda.extension: ldda.extension = new_file_ext @@ -103,7 +107,7 @@ class LibraryDatasetsManager(object): raise RequestParameterInvalidException('%s must have at least length of %s' % (key, MINIMUM_STRING_LENGTH)) val = validation.validate_and_sanitize_basestring(key, val) validated_payload[key] = val - if key in ('misc_info'): + if key in ('misc_info', 'message'): val = validation.validate_and_sanitize_basestring(key, val) validated_payload[key] = val if key in ('file_ext'): From e63f8c8a26b23bec5136cf19877a1f32ed9f4f5d Mon Sep 17 00:00:00 2001 From: Enis Afgan Date: Thu, 11 Jan 2018 17:10:07 +0100 Subject: [PATCH 091/112] Uninstall a tool by default (vs. deactivating it) --- lib/galaxy/webapps/galaxy/controllers/admin_toolshed.py | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/lib/galaxy/webapps/galaxy/controllers/admin_toolshed.py b/lib/galaxy/webapps/galaxy/controllers/admin_toolshed.py index e4045f8508f..0189b8fdc36 100644 --- a/lib/galaxy/webapps/galaxy/controllers/admin_toolshed.py +++ b/lib/galaxy/webapps/galaxy/controllers/admin_toolshed.py @@ -221,7 +221,7 @@ class AdminToolshed(AdminGalaxy): status = statuses.index(status) else: status = 1 - remove_from_disk = kwd.get('remove_from_disk', '') + remove_from_disk = kwd.get('remove_from_disk', 'true') remove_from_disk_checked = CheckboxField.is_checked(remove_from_disk) tool_shed_repositories = repository_util.get_installed_tool_shed_repository(trans.app, kwd['id']) if not isinstance(tool_shed_repositories, list): From e5de36e3c500ab2c7d3abcdfff8b405d80dd8536 Mon Sep 17 00:00:00 2001 From: Martin Cech Date: Tue, 16 Jan 2018 13:46:58 -0500 Subject: [PATCH 092/112] use Python bool as argument --- lib/galaxy/webapps/galaxy/controllers/admin_toolshed.py | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/lib/galaxy/webapps/galaxy/controllers/admin_toolshed.py b/lib/galaxy/webapps/galaxy/controllers/admin_toolshed.py index 0189b8fdc36..aa2b21c221f 100644 --- a/lib/galaxy/webapps/galaxy/controllers/admin_toolshed.py +++ b/lib/galaxy/webapps/galaxy/controllers/admin_toolshed.py @@ -221,7 +221,7 @@ class AdminToolshed(AdminGalaxy): status = statuses.index(status) else: status = 1 - remove_from_disk = kwd.get('remove_from_disk', 'true') + remove_from_disk = kwd.get('remove_from_disk', True) remove_from_disk_checked = CheckboxField.is_checked(remove_from_disk) tool_shed_repositories = repository_util.get_installed_tool_shed_repository(trans.app, kwd['id']) if not isinstance(tool_shed_repositories, list): From 878c68e2a201905bb40901e66af0c701ebe30eea Mon Sep 17 00:00:00 2001 From: Martin Cech Date: Tue, 16 Jan 2018 15:16:47 -0500 Subject: [PATCH 093/112] set the default after the form submission action to not override --- lib/galaxy/webapps/galaxy/controllers/admin_toolshed.py | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/lib/galaxy/webapps/galaxy/controllers/admin_toolshed.py b/lib/galaxy/webapps/galaxy/controllers/admin_toolshed.py index aa2b21c221f..8a48c6eaab0 100644 --- a/lib/galaxy/webapps/galaxy/controllers/admin_toolshed.py +++ b/lib/galaxy/webapps/galaxy/controllers/admin_toolshed.py @@ -221,7 +221,7 @@ class AdminToolshed(AdminGalaxy): status = statuses.index(status) else: status = 1 - remove_from_disk = kwd.get('remove_from_disk', True) + remove_from_disk = kwd.get('remove_from_disk', '') remove_from_disk_checked = CheckboxField.is_checked(remove_from_disk) tool_shed_repositories = repository_util.get_installed_tool_shed_repository(trans.app, kwd['id']) if not isinstance(tool_shed_repositories, list): @@ -238,7 +238,7 @@ class AdminToolshed(AdminGalaxy): message += 'Attempting to uninstall tool dependencies resulted in errors: %s' % errors status = max(status, statuses.index('error')) status = statuses[status] - remove_from_disk_check_box = CheckboxField('remove_from_disk', value=remove_from_disk_checked) + remove_from_disk_check_box = CheckboxField('remove_from_disk', value=True) return trans.fill_template('/admin/tool_shed_repository/deactivate_or_uninstall_repository.mako', repository=tool_shed_repositories, remove_from_disk_check_box=remove_from_disk_check_box, From be4fba3566ac70306451d84b069adc462baeb73c Mon Sep 17 00:00:00 2001 From: mvdbeek Date: Wed, 17 Jan 2018 13:49:42 +0100 Subject: [PATCH 094/112] Add option to replace failed elements on job rerun Replacing failed collection elements was already possible when dependent jobs were found (https://github.com/galaxyproject/galaxy/pull/5247). This commit restructures the remapping so that remapping is possible when no dependent jobs are available. This also simplifies the replacement of HDAs between old and new jobs. --- client/galaxy/scripts/mvc/tool/tool-form.js | 12 +++-- lib/galaxy/tools/__init__.py | 3 ++ lib/galaxy/tools/actions/__init__.py | 60 ++++++++++++--------- 3 files changed, 46 insertions(+), 29 deletions(-) diff --git a/client/galaxy/scripts/mvc/tool/tool-form.js b/client/galaxy/scripts/mvc/tool/tool-form.js index 3c027a0cbb3..931e091e2cc 100644 --- a/client/galaxy/scripts/mvc/tool/tool-form.js +++ b/client/galaxy/scripts/mvc/tool/tool-form.js @@ -136,16 +136,22 @@ var View = Backbone.View.extend({ // remap feature if (options.job_id && options.job_remap) { + if (options.job_remap === "job_produced_collection_elements") { + var label = "Replace elements in collection ?"; + var help = "The previous run of this tool failed. Use this option to replace the failed element(s) in the dataset collectio that were produced during the previous tool run."; + } else { + var label = "Resume dependencies from this job ?"; + var help = "The previous run of this tool failed and other tools were waiting for it to finish successfully. Use this option to resume those tools using the new output(s) of this tool run."; + } options.inputs.push({ - label: "Resume dependencies from this job", + label: label, name: "rerun_remap_job_id", type: "select", display: "radio", ignore: "__ignore__", value: "__ignore__", options: [["Yes", options.job_id], ["No", "__ignore__"]], - help: - "The previous run of this tool failed and other tools were waiting for it to finish successfully. Use this option to resume those tools using the new output(s) of this tool run." + help: help, }); } diff --git a/lib/galaxy/tools/__init__.py b/lib/galaxy/tools/__init__.py index d9b3dc74dfc..d334598d0ed 100755 --- a/lib/galaxy/tools/__init__.py +++ b/lib/galaxy/tools/__init__.py @@ -1890,6 +1890,9 @@ class Tool(object, Dictifiable): try: if [hda.dependent_jobs for hda in [jtod.dataset for jtod in job.output_datasets] if hda.dependent_jobs]: return True + elif job.output_dataset_collection_instances: + # We'll want to replace this item + return 'job_produced_collection_elements' except Exception as exception: log.error(str(exception)) pass diff --git a/lib/galaxy/tools/actions/__init__.py b/lib/galaxy/tools/actions/__init__.py index c248141f433..372cadc76ae 100644 --- a/lib/galaxy/tools/actions/__init__.py +++ b/lib/galaxy/tools/actions/__init__.py @@ -534,43 +534,51 @@ class DefaultToolAction(object): for p in old_job.parameters: if p.name.endswith('|__identifier__'): current_job.parameters.append(p.copy()) - remapped_hdas = {} - input_hdcas = set() + remapped_hdas = self.__remap_data_inputs(old_job=old_job, current_job=current_job) for jtod in old_job.output_datasets: for (job_to_remap, jtid) in [(jtid.job, jtid) for jtid in jtod.dataset.dependent_jobs]: if (trans.user is not None and job_to_remap.user_id == trans.user.id) or ( trans.user is None and job_to_remap.session_id == galaxy_session.id): - if job_to_remap.state == job_to_remap.states.PAUSED: - job_to_remap.state = job_to_remap.states.NEW - for hda in [dep_jtod.dataset for dep_jtod in job_to_remap.output_datasets]: - if hda.state == hda.states.PAUSED: - hda.state = hda.states.NEW - hda.info = None - input_values = dict([(p.name, json.loads(p.value)) for p in job_to_remap.parameters]) - remapped_hdas[jtod.dataset] = out_data[jtod.name] - for jtidca in job_to_remap.input_dataset_collections: - input_hdcas.add(jtidca.dataset_collection) - old_dataset_id = jtod.dataset_id - new_dataset_id = out_data[jtod.name].id - input_values = update_dataset_ids(input_values, {old_dataset_id: new_dataset_id}, src='hda') - for p in job_to_remap.parameters: - p.value = json.dumps(input_values[p.name]) - jtid.dataset = out_data[jtod.name] - jtid.dataset.hid = jtod.dataset.hid - log.info('Job %s input HDA %s remapped to new HDA %s' % (job_to_remap.id, jtod.dataset.id, jtid.dataset.id)) + self.__remap_parameters(job_to_remap, jtid, jtod, out_data) trans.sa_session.add(job_to_remap) trans.sa_session.add(jtid) - for hdca in input_hdcas: - hdca.collection.replace_failed_elements(remapped_hdas) - if hdca.implicit_collection_jobs: - for job in hdca.implicit_collection_jobs.jobs: - if job.job_id == old_job.id: - job.job_id = current_job.id jtod.dataset.visible = False trans.sa_session.add(jtod) + for jtodc in old_job.output_dataset_collection_instances: + hdca = jtodc.dataset_collection_instance + hdca.collection.replace_failed_elements(remapped_hdas) + if hdca.implicit_collection_jobs: + for job in hdca.implicit_collection_jobs.jobs: + if job.job_id == old_job.id: + job.job_id = current_job.id except Exception: log.exception('Cannot remap rerun dependencies.') + def __remap_data_inputs(self, old_job, current_job): + """Record output datasets from old_job and build a dictionary that maps the old output HDAs to the new output HDAs.""" + remapped_hdas = {} + old_output_datasets = {jtod.name: jtod.dataset for jtod in old_job.output_datasets} + for jtod in current_job.output_datasets: + remapped_hdas[old_output_datasets[jtod.name]] = jtod.dataset + return remapped_hdas + + def __remap_parameters(self, job_to_remap, jtid, jtod, out_data): + if job_to_remap.state == job_to_remap.states.PAUSED: + job_to_remap.state = job_to_remap.states.NEW + for hda in [dep_jtod.dataset for dep_jtod in job_to_remap.output_datasets]: + if hda.state == hda.states.PAUSED: + hda.state = hda.states.NEW + hda.info = None + input_values = dict([(p.name, json.loads(p.value)) for p in job_to_remap.parameters]) + old_dataset_id = jtod.dataset_id + new_dataset_id = out_data[jtod.name].id + input_values = update_dataset_ids(input_values, {old_dataset_id: new_dataset_id}, src='hda') + for p in job_to_remap.parameters: + p.value = json.dumps(input_values[p.name]) + jtid.dataset = out_data[jtod.name] + jtid.dataset.hid = jtod.dataset.hid + log.info('Job %s input HDA %s remapped to new HDA %s' % (job_to_remap.id, jtod.dataset.id, jtid.dataset.id)) + def _wrapped_params(self, trans, tool, incoming, input_datasets=None): wrapped_params = WrappedParameters(trans, tool, incoming, input_datasets=input_datasets) return wrapped_params From 4b2bf122b627d4dfbd87e9491cbf97755f40a9bf Mon Sep 17 00:00:00 2001 From: Matthias Bernt Date: Wed, 3 Jan 2018 11:26:04 +0100 Subject: [PATCH 095/112] fix for microbial import tool There seems to be no UnvalidatedValue class anymore. So I removed these checks which seems to make the tool functional again. Note that there is one more instance of such a check in the Galaxy sources (in tools/parameters/basic.py). I guess this can also be removed? --- tools/data_source/microbial_import_code.py | 5 ----- 1 file changed, 5 deletions(-) diff --git a/tools/data_source/microbial_import_code.py b/tools/data_source/microbial_import_code.py index f9f53b6427a..7db3f0e07fb 100644 --- a/tools/data_source/microbial_import_code.py +++ b/tools/data_source/microbial_import_code.py @@ -101,11 +101,6 @@ def exec_after_process(app, inp_data, out_data, param_dict, tool, stdout, stderr # if not (kingdom or group or org): if not (kingdom or org): print("Parameters are not available.") - # workflow passes galaxy.tools.parameters.basic.UnvalidatedValue instead of values - if isinstance(kingdom, tools.parameters.basic.UnvalidatedValue): - kingdom = kingdom.value - if isinstance(org, tools.parameters.basic.UnvalidatedValue): - org = org.value GALAXY_DATA_INDEX_DIR = app.config.tool_data_path microbe_info = load_microbial_data(GALAXY_DATA_INDEX_DIR, sep='\t') From aaaf7b50a7a227e5344712f6441fce337a20d1ba Mon Sep 17 00:00:00 2001 From: mvdbeek Date: Wed, 17 Jan 2018 17:10:17 +0100 Subject: [PATCH 096/112] Enable conda_auto_init and conda_auto_install for framework tests --- scripts/functional_tests.py | 2 ++ test/base/driver_util.py | 9 ++++++++- 2 files changed, 10 insertions(+), 1 deletion(-) diff --git a/scripts/functional_tests.py b/scripts/functional_tests.py index 51228a384bb..0493a49bd3b 100644 --- a/scripts/functional_tests.py +++ b/scripts/functional_tests.py @@ -71,6 +71,8 @@ class FrameworkToolsGalaxyTestDriver(DefaultGalaxyTestDriver): """Galaxy-style nose TestDriver for testing framework Galaxy tools.""" framework_tool_and_types = True + conda_auto_init = True + conda_auto_install = True class DataManagersGalaxyTestDriver(driver_util.GalaxyTestDriver): diff --git a/test/base/driver_util.py b/test/base/driver_util.py index 29e99a8aef7..131a72b173a 100644 --- a/test/base/driver_util.py +++ b/test/base/driver_util.py @@ -129,6 +129,8 @@ def setup_galaxy_config( update_integrated_tool_panel=False, prefer_template_database=False, log_format=None, + conda_auto_init=False, + conda_auto_install=False ): """Setup environment and build config for test Galaxy instance.""" if not os.path.exists(tmpdir): @@ -188,7 +190,8 @@ def setup_galaxy_config( api_allow_run_as='test@bx.psu.edu', auto_configure_logging=logging_config_file is None, check_migrate_tools=False, - conda_auto_init=False, + conda_auto_init=conda_auto_init, + conda_auto_install=conda_auto_install, cleanup_job='onsuccess', data_manager_config_file=data_manager_config_file, enable_beta_tool_formats=True, @@ -793,6 +796,8 @@ class GalaxyTestDriver(TestDriver): """Instantial a Galaxy-style nose TestDriver for testing Galaxy.""" testing_shed_tools = False + conda_auto_init = False + conda_auto_install = False def setup(self, config_object=None): """Setup a Galaxy server for functional test (if needed). @@ -851,6 +856,8 @@ class GalaxyTestDriver(TestDriver): datatypes_conf=datatypes_conf_override, prefer_template_database=getattr(config_object, "prefer_template_database", False), log_format=log_format, + conda_auto_init=self.conda_auto_init, + conda_auto_install=self.conda_auto_install, ) galaxy_config = setup_galaxy_config( galaxy_db_path, From b59fb06fd92f71211bf473f30e8d0341fb4650b4 Mon Sep 17 00:00:00 2001 From: Nicola Soranzo Date: Wed, 17 Jan 2018 16:26:56 +0000 Subject: [PATCH 097/112] Remove unused import --- tools/data_source/microbial_import_code.py | 2 -- 1 file changed, 2 deletions(-) diff --git a/tools/data_source/microbial_import_code.py b/tools/data_source/microbial_import_code.py index 7db3f0e07fb..9466f25f9d1 100644 --- a/tools/data_source/microbial_import_code.py +++ b/tools/data_source/microbial_import_code.py @@ -2,8 +2,6 @@ from __future__ import print_function from shutil import copyfile -from galaxy import tools - def load_microbial_data(GALAXY_DATA_INDEX_DIR, sep='\t'): # FIXME: this function is duplicated in the DynamicOptions class. It is used here only to From 680bf685c2dfdc874277321e2c7d0673516bf62a Mon Sep 17 00:00:00 2001 From: mvdbeek Date: Wed, 17 Jan 2018 18:11:31 +0100 Subject: [PATCH 098/112] Fix datatype order --- test/functional/tools/sample_datatypes_conf.xml | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/test/functional/tools/sample_datatypes_conf.xml b/test/functional/tools/sample_datatypes_conf.xml index 98991439526..c2f8edbe9c6 100644 --- a/test/functional/tools/sample_datatypes_conf.xml +++ b/test/functional/tools/sample_datatypes_conf.xml @@ -15,8 +15,8 @@ - + From 8ecc86cb677bc3971baa75bf0e8c1481d8e3aef4 Mon Sep 17 00:00:00 2001 From: mvdbeek Date: Wed, 17 Jan 2018 19:32:15 +0100 Subject: [PATCH 099/112] Simplify conda framework setup Thanks @nsoranzo! --- test/base/driver_util.py | 6 ++---- 1 file changed, 2 insertions(+), 4 deletions(-) diff --git a/test/base/driver_util.py b/test/base/driver_util.py index 131a72b173a..7f9ff9ede21 100644 --- a/test/base/driver_util.py +++ b/test/base/driver_util.py @@ -796,8 +796,6 @@ class GalaxyTestDriver(TestDriver): """Instantial a Galaxy-style nose TestDriver for testing Galaxy.""" testing_shed_tools = False - conda_auto_init = False - conda_auto_install = False def setup(self, config_object=None): """Setup a Galaxy server for functional test (if needed). @@ -856,8 +854,8 @@ class GalaxyTestDriver(TestDriver): datatypes_conf=datatypes_conf_override, prefer_template_database=getattr(config_object, "prefer_template_database", False), log_format=log_format, - conda_auto_init=self.conda_auto_init, - conda_auto_install=self.conda_auto_install, + conda_auto_init=getattr(config_object, "conda_auto_init", False), + conda_auto_install=getattr(config_object, "conda_auto_install", False), ) galaxy_config = setup_galaxy_config( galaxy_db_path, From 6bef1fcbaa1df5690658f7b14512d212c115a0e5 Mon Sep 17 00:00:00 2001 From: Martin Cech Date: Wed, 17 Jan 2018 15:50:06 -0500 Subject: [PATCH 100/112] remove an extra F from the folder ID --- templates/webapps/galaxy/history/display_structured.mako | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/templates/webapps/galaxy/history/display_structured.mako b/templates/webapps/galaxy/history/display_structured.mako index b616cd3747d..4576d83bdbe 100644 --- a/templates/webapps/galaxy/history/display_structured.mako +++ b/templates/webapps/galaxy/history/display_structured.mako @@ -232,7 +232,7 @@ elif entity_name == "WorkflowInvocation": <% id = trans.security.encode_id( hda.id ) %> <% folder = hda.copied_from_library_dataset_dataset_association.library_dataset.folder - folder_id = 'F' + trans.security.encode_id( folder.id ) + folder_id = trans.security.encode_id( folder.id ) %>
From d94148ff7999e0ecee9b617c4daec24da28ea1a5 Mon Sep 17 00:00:00 2001 From: mvdbeek Date: Thu, 18 Jan 2018 15:04:41 +0100 Subject: [PATCH 101/112] Prevent reloading when data table is being modified Fixes https://github.com/galaxyproject/galaxy/issues/4783. --- lib/galaxy/tools/data_manager/manager.py | 8 ++++---- lib/galaxy/tools/toolbox/watcher.py | 4 ++++ 2 files changed, 8 insertions(+), 4 deletions(-) diff --git a/lib/galaxy/tools/data_manager/manager.py b/lib/galaxy/tools/data_manager/manager.py index 05d3a9b3e1b..1dfa973abed 100644 --- a/lib/galaxy/tools/data_manager/manager.py +++ b/lib/galaxy/tools/data_manager/manager.py @@ -317,10 +317,10 @@ class DataManager(object): self.process_move(data_table_name, name, output_ref_values[name].extra_files_path, **data_table_value) data_table_value[name] = self.process_value_translation(data_table_name, name, **data_table_value) data_table.add_entry(data_table_value, persist=True, entry_source=self) - send_control_task(self.data_managers.app, - 'reload_tool_data_tables', - noop_self=True, - kwargs={'table_name': data_table_name}) + send_control_task(self.data_managers.app, + 'reload_tool_data_tables', + noop_self=True, + kwargs={'table_name': data_table_name}) if self.undeclared_tables and data_tables_dict: # We handle the data move, by just moving all the data out of the extra files path # moving a directory and the target already exists, we move the contents instead diff --git a/lib/galaxy/tools/toolbox/watcher.py b/lib/galaxy/tools/toolbox/watcher.py index ffe1144b53e..23f8d2423ee 100644 --- a/lib/galaxy/tools/toolbox/watcher.py +++ b/lib/galaxy/tools/toolbox/watcher.py @@ -252,6 +252,10 @@ class LocFileEventHandler(FileSystemEventHandler): if self.loc_watcher.path_hash.get(path) == cur_hash: return else: + time.sleep(0.5) + if cur_hash != md5_hash_file(path): + # We're still modifying the file, it'll be picked up later + return self.loc_watcher.path_hash[path] = cur_hash self.loc_watcher.tool_data_tables.reload_tables(path=path) From 8c1807c2879950ef47ccd162b6a7eebc83bc892b Mon Sep 17 00:00:00 2001 From: mvdbeek Date: Thu, 18 Jan 2018 15:17:08 +0100 Subject: [PATCH 102/112] Trigger reload for each modified data table In unindeted one level too much in the previous commit, which would only reload the last table (thanks @dannon). The alternative would be to reload all tables, but I think this is more efficient. --- lib/galaxy/tools/data_manager/manager.py | 8 ++++---- 1 file changed, 4 insertions(+), 4 deletions(-) diff --git a/lib/galaxy/tools/data_manager/manager.py b/lib/galaxy/tools/data_manager/manager.py index 1dfa973abed..25f8b49f020 100644 --- a/lib/galaxy/tools/data_manager/manager.py +++ b/lib/galaxy/tools/data_manager/manager.py @@ -317,10 +317,10 @@ class DataManager(object): self.process_move(data_table_name, name, output_ref_values[name].extra_files_path, **data_table_value) data_table_value[name] = self.process_value_translation(data_table_name, name, **data_table_value) data_table.add_entry(data_table_value, persist=True, entry_source=self) - send_control_task(self.data_managers.app, - 'reload_tool_data_tables', - noop_self=True, - kwargs={'table_name': data_table_name}) + send_control_task(self.data_managers.app, + 'reload_tool_data_tables', + noop_self=True, + kwargs={'table_name': data_table_name}) if self.undeclared_tables and data_tables_dict: # We handle the data move, by just moving all the data out of the extra files path # moving a directory and the target already exists, we move the contents instead From 8f91ae0db9f0ebdc06e6e284fb2fb254db553181 Mon Sep 17 00:00:00 2001 From: mvdbeek Date: Thu, 18 Jan 2018 15:25:36 +0100 Subject: [PATCH 103/112] Reload tool data tables for 'undeclared_tables' Thanks @nsoranzo! --- lib/galaxy/tools/data_manager/manager.py | 6 +++--- 1 file changed, 3 insertions(+), 3 deletions(-) diff --git a/lib/galaxy/tools/data_manager/manager.py b/lib/galaxy/tools/data_manager/manager.py index 25f8b49f020..0d6e8ea157d 100644 --- a/lib/galaxy/tools/data_manager/manager.py +++ b/lib/galaxy/tools/data_manager/manager.py @@ -338,9 +338,9 @@ class DataManager(object): if name in path_column_names: data_table_value[name] = os.path.abspath(os.path.join(self.data_managers.app.config.galaxy_data_manager_data_path, value)) data_table.add_entry(data_table_value, persist=True, entry_source=self) - send_control_task(self.data_managers.app, 'reload_tool_data_tables', - noop_self=True, - kwargs={'table_name': data_table_name}) + send_control_task(self.data_managers.app, 'reload_tool_data_tables', + noop_self=True, + kwargs={'table_name': data_table_name}) else: for data_table_name, data_table_values in data_tables_dict.items(): # tool returned extra data table entries, but data table was not declared in data manager From 3681a4b77f29a9bbb6cbbd6841fc0a9c8a41106e Mon Sep 17 00:00:00 2001 From: Dannon Baker Date: Thu, 18 Jan 2018 10:34:04 -0500 Subject: [PATCH 104/112] Move the client build for selenium to run_tests.sh instead of in the external jenkins job configuration. Has the added benefit of skipping the client build when we don't want to run it. --- .ci/jenkins/selenium/run_tests.sh | 2 ++ 1 file changed, 2 insertions(+) diff --git a/.ci/jenkins/selenium/run_tests.sh b/.ci/jenkins/selenium/run_tests.sh index a516fc6aeda..6b49ce294af 100644 --- a/.ci/jenkins/selenium/run_tests.sh +++ b/.ci/jenkins/selenium/run_tests.sh @@ -16,6 +16,8 @@ fi mkdir -p "$GALAXY_TEST_ERRORS_DIRECTORY" mkdir -p "$GALAXY_TEST_SCREENSHOTS_DIRECTORY" +docker run -v `pwd`:`pwd`:rw -w `pwd` -u $UID node /bin/bash -c 'make client-production' + # Start Selenium server in the test Docker container. DOCKER_RUN_EXTRA_ARGS="-e USE_SELENIUM=1 -e GALAXY_TEST_SELENIUM_RETRIES=${GALAXY_TEST_SELENIUM_RETRIES} -e GALAXY_TEST_ERRORS_DIRECTORY=${GALAXY_TEST_ERRORS_DIRECTORY} -e GALAXY_TEST_SCREENSHOTS_DIRECTORY=${GALAXY_TEST_SCREENSHOTS_DIRECTORY} ${DOCKER_RUN_EXTRA_ARGS}" export DOCKER_RUN_EXTRA_ARGS From e61d5cdadfdd17b8879b6ec9a74937cb3eac3479 Mon Sep 17 00:00:00 2001 From: Dannon Baker Date: Thu, 18 Jan 2018 11:26:59 -0500 Subject: [PATCH 105/112] Build sourcemaps for the jenkins selenium tests -- I don't know that this actually gets resolved, but it doesn't have a huge impact on build time anyway --- .ci/jenkins/selenium/run_tests.sh | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/.ci/jenkins/selenium/run_tests.sh b/.ci/jenkins/selenium/run_tests.sh index 6b49ce294af..18cecbe5c11 100644 --- a/.ci/jenkins/selenium/run_tests.sh +++ b/.ci/jenkins/selenium/run_tests.sh @@ -16,7 +16,7 @@ fi mkdir -p "$GALAXY_TEST_ERRORS_DIRECTORY" mkdir -p "$GALAXY_TEST_SCREENSHOTS_DIRECTORY" -docker run -v `pwd`:`pwd`:rw -w `pwd` -u $UID node /bin/bash -c 'make client-production' +docker run -v `pwd`:`pwd`:rw -w `pwd` -u $UID node /bin/bash -c 'make client-production-maps' # Start Selenium server in the test Docker container. DOCKER_RUN_EXTRA_ARGS="-e USE_SELENIUM=1 -e GALAXY_TEST_SELENIUM_RETRIES=${GALAXY_TEST_SELENIUM_RETRIES} -e GALAXY_TEST_ERRORS_DIRECTORY=${GALAXY_TEST_ERRORS_DIRECTORY} -e GALAXY_TEST_SCREENSHOTS_DIRECTORY=${GALAXY_TEST_SCREENSHOTS_DIRECTORY} ${DOCKER_RUN_EXTRA_ARGS}" From 3fdbaa3dec07078388ce63bdb1a6f9251ffeb3f1 Mon Sep 17 00:00:00 2001 From: Nate Coraor Date: Thu, 18 Jan 2018 12:31:41 -0500 Subject: [PATCH 106/112] Regenerate galaxy.yml.sample and documentation for newly added/documented config options. --- config/galaxy.yml.sample | 21 ++++++++ doc/source/admin/galaxy_options.rst | 77 +++++++++++++++++++++++++++++ 2 files changed, 98 insertions(+) diff --git a/config/galaxy.yml.sample b/config/galaxy.yml.sample index 9911f4ab323..b49f9cff6b5 100644 --- a/config/galaxy.yml.sample +++ b/config/galaxy.yml.sample @@ -650,6 +650,21 @@ galaxy: # The URL linked by the "Support" link in the "Help" menu. #support_url: 'https://galaxyproject.org/support' + # Enable integration with a custom Biostar instance. + #biostar_url: null + + # Enable integration with a custom Biostar instance. + #biostar_key_name: null + + # Enable integration with a custom Biostar instance. + #biostar_key: null + + # Enable integration with a custom Biostar instance. + #biostar_enable_bug_reports: true + + # Enable integration with a custom Biostar instance. + #biostar_never_authenticate: false + # The URL linked by the "How to Cite Galaxy" link in the "Help" menu. #citation_url: 'https://galaxyproject.org/citing-galaxy' @@ -1044,6 +1059,12 @@ galaxy: # them). #user_library_import_symlink_whitelist: null + # In conjunction or alternatively, Galaxy can restrict user library + # imports to those files that the user can read (by checking basic + # unix permissions). For this to work, the username has to match the + # username on the filesystem. + #user_library_import_check_permissions: false + # Allow admins to paste filesystem paths during upload. For libraries # this adds an option to the admin library upload tool allowing admins # to paste filesystem paths to files and directories in a box, and diff --git a/doc/source/admin/galaxy_options.rst b/doc/source/admin/galaxy_options.rst index a5b8a34899c..d508627f824 100644 --- a/doc/source/admin/galaxy_options.rst +++ b/doc/source/admin/galaxy_options.rst @@ -1255,6 +1255,56 @@ :Type: str +~~~~~~~~~~~~~~~ +``biostar_url`` +~~~~~~~~~~~~~~~ + +:Description: + Enable integration with a custom Biostar instance. +:Default: ``None`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~ +``biostar_key_name`` +~~~~~~~~~~~~~~~~~~~~ + +:Description: + Enable integration with a custom Biostar instance. +:Default: ``None`` +:Type: str + + +~~~~~~~~~~~~~~~ +``biostar_key`` +~~~~~~~~~~~~~~~ + +:Description: + Enable integration with a custom Biostar instance. +:Default: ``None`` +:Type: str + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``biostar_enable_bug_reports`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Enable integration with a custom Biostar instance. +:Default: ``true`` +:Type: bool + + +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``biostar_never_authenticate`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + Enable integration with a custom Biostar instance. +:Default: ``false`` +:Type: bool + + ~~~~~~~~~~~~~~~~ ``citation_url`` ~~~~~~~~~~~~~~~~ @@ -1734,6 +1784,20 @@ :Type: str +~~~~~~~~~~~ +``logging`` +~~~~~~~~~~~ + +:Description: + Controls where and how the server logs messages. If unset, the + default is to log all messages to standard output at the level + defined by the `log_level` configuration option. Configuration is + described in the documentation at: + https://docs.galaxyproject.org/en/master/admin/config_logging.html +:Default: ``galaxy.config.LOGGING_CONFIG_DEFAULT`` +:Type: map + + ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ ``database_engine_option_echo`` ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ @@ -2140,6 +2204,19 @@ :Type: str +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +``user_library_import_check_permissions`` +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +:Description: + In conjunction or alternatively, Galaxy can restrict user library + imports to those files that the user can read (by checking basic + unix permissions). For this to work, the username has to match the + username on the filesystem. +:Default: ``false`` +:Type: bool + + ~~~~~~~~~~~~~~~~~~~~ ``allow_path_paste`` ~~~~~~~~~~~~~~~~~~~~ From dd0aeec50013e172a0f49c1e5681cc73ed635213 Mon Sep 17 00:00:00 2001 From: Nate Coraor Date: Thu, 18 Jan 2018 12:53:42 -0500 Subject: [PATCH 107/112] Fix lint error --- lib/galaxy/webapps/config_manage.py | 6 +++--- 1 file changed, 3 insertions(+), 3 deletions(-) diff --git a/lib/galaxy/webapps/config_manage.py b/lib/galaxy/webapps/config_manage.py index a17c1f9c9c0..5278835df9f 100644 --- a/lib/galaxy/webapps/config_manage.py +++ b/lib/galaxy/webapps/config_manage.py @@ -143,9 +143,9 @@ UWSGI_OPTIONS = OrderedDict([ # ('route-run', { # 'default': "['log:Proxy ${HTTP_HOST} to ${TARGET_HOST}', 'httpdumb:${TARGET_HOST}']", # }), - #('http-raw-body', { - # 'default': 'True' - #}), + # ('http-raw-body', { + # 'default': 'True' + # }), ]) DROP_OPTION_VALUE = object() From 7af6381e24c8bcd8efc5c56491eaa02571ba8f17 Mon Sep 17 00:00:00 2001 From: Dannon Baker Date: Thu, 18 Jan 2018 17:12:45 -0500 Subject: [PATCH 108/112] Disable galaxy tour 'path' navigation -- this style of tour nav behaves very poorly with Galaxy and it's pretty easy to get a tour completely *stuck* in reload loops from the user experience, forcing manual cache cleaning or the like to make Galaxy usable again. --- client/galaxy/scripts/mvc/tours.js | 12 +++++++++++- 1 file changed, 11 insertions(+), 1 deletion(-) diff --git a/client/galaxy/scripts/mvc/tours.js b/client/galaxy/scripts/mvc/tours.js index 8be51232877..44edf34c0d8 100644 --- a/client/galaxy/scripts/mvc/tours.js +++ b/client/galaxy/scripts/mvc/tours.js @@ -34,7 +34,7 @@ Select any tour to get started (and remember, you can click 'End Tour' at any ti > <%- tour.name || tour.id %> - - <%- tour.attributes.description || \"No description given.\" %> + - <%- tour.attributes.description || "No description given." %> <% _.each(tour.attributes.tags, function(tag) { %> <%- tag.charAt(0).toUpperCase() + tag.slice(1) %> @@ -83,6 +83,16 @@ var hooked_tour_from_data = data => { .trigger("change"); }; } + if (step.path) { + // Galaxy does *not* support automagic path navigation right now in + // Tours -- too many ways to get your client 'stuck' in automatic + // navigation loops. We can probably re-enable this as our client + // routing matures. + console.warn( + "This Galaxy Tour is attempting to use path navigation. This is known to be unstable and can possibly get the Galaxy client 'stuck' in a tour, and at this time is not allowed." + ); + delete step.path; + } }); return data; }; From 1a43ef5b83d7378faa653451ebc38a54725a7481 Mon Sep 17 00:00:00 2001 From: mvdbeek Date: Thu, 18 Jan 2018 17:48:32 +0100 Subject: [PATCH 109/112] Work around (temporarily) wrong getsize() output I'm not sure how/why this happens, but this can be reproduced by copying a file to a location in one process, while checking the size in another process: Run this to copy a file indefinitely: ``` import os import shutil open('test').write("foo") while True: shutil.copy('test', 'test.file') os.remove('test.file') ``` In the same directory run this ``` import os count = 0 wrong_size = False while True: try: size = os.path.getsize('test.file') if size == 0: wrong_size = True wrong_count = count elif wrong_size and os.path.getsize('test.file') != 0: # We have seen the wrong size being reported, but now it's correct again print("Got wrong file size at %dnd try, was fixed in %dnd try" % (wrong_count, count)) break except Exception: pass count += 1 ``` It'll (probably) fail like this: ``` Got wrong file size at 0nd try, was fixed in 1nd try ``` or more often: ``` Got wrong file size at 31nd try, was fixed in 32nd try ``` This seems to be fixed when running os.path.getsize() another time, so we simply do that here. --- lib/galaxy/objectstore/__init__.py | 8 +++++++- 1 file changed, 7 insertions(+), 1 deletion(-) diff --git a/lib/galaxy/objectstore/__init__.py b/lib/galaxy/objectstore/__init__.py index dc0c25668b6..bb9504f08f0 100644 --- a/lib/galaxy/objectstore/__init__.py +++ b/lib/galaxy/objectstore/__init__.py @@ -10,6 +10,7 @@ import os import random import shutil import threading +import time from xml.etree import ElementTree try: @@ -367,7 +368,12 @@ class DiskObjectStore(ObjectStore): """ if self.exists(obj, **kwargs): try: - return os.path.getsize(self.get_filename(obj, **kwargs)) + size = os.path.getsize(self.get_filename(obj, **kwargs)) + if size == 0: + # May be legitimately 0, or there may be an issue with the FS / kernel, so we try again + time.sleep(0.01) + size = os.path.getsize(self.get_filename(obj, **kwargs)) + return size except OSError: return 0 else: From 16344a62d3a8f30f4c468b552ce49ca989a1f0b7 Mon Sep 17 00:00:00 2001 From: mvdbeek Date: Thu, 18 Jan 2018 15:03:16 +0100 Subject: [PATCH 110/112] Alternative fix for missing metadata on datasets that report output size 0 --- lib/galaxy/jobs/__init__.py | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/lib/galaxy/jobs/__init__.py b/lib/galaxy/jobs/__init__.py index de1c32538bc..1bb036495de 100644 --- a/lib/galaxy/jobs/__init__.py +++ b/lib/galaxy/jobs/__init__.py @@ -1251,7 +1251,7 @@ class JobWrapper(object, HasResourceParameters): if job.states.ERROR == final_job_state: dataset.blurb = "error" dataset.mark_unhidden() - elif not purged and dataset.has_data(): + elif not purged: # If the tool was expected to set the extension, attempt to retrieve it if dataset.ext == 'auto': dataset.extension = context.get('ext', 'data') @@ -1299,7 +1299,7 @@ class JobWrapper(object, HasResourceParameters): except Exception: dataset.set_peek() else: - # Handle an empty dataset. + # Handle purged datasets. dataset.blurb = "empty" if dataset.ext == 'auto': dataset.extension = context.get('ext', 'txt') From 161467513b3f911cde15b890c404ed373f4571f4 Mon Sep 17 00:00:00 2001 From: mvdbeek Date: Thu, 18 Jan 2018 20:22:07 +0100 Subject: [PATCH 111/112] Use a for loop when checking size in object store and adjust `empty()` to use the new code. Thanks @nsoranzo. --- lib/galaxy/objectstore/__init__.py | 10 ++++++---- 1 file changed, 6 insertions(+), 4 deletions(-) diff --git a/lib/galaxy/objectstore/__init__.py b/lib/galaxy/objectstore/__init__.py index bb9504f08f0..8144f8167df 100644 --- a/lib/galaxy/objectstore/__init__.py +++ b/lib/galaxy/objectstore/__init__.py @@ -359,7 +359,7 @@ class DiskObjectStore(ObjectStore): def empty(self, obj, **kwargs): """Override `ObjectStore`'s stub by checking file size on disk.""" - return os.path.getsize(self.get_filename(obj, **kwargs)) == 0 + return self.size(obj, **kwargs) == 0 def size(self, obj, **kwargs): """Override `ObjectStore`'s stub by return file size on disk. @@ -368,11 +368,13 @@ class DiskObjectStore(ObjectStore): """ if self.exists(obj, **kwargs): try: - size = os.path.getsize(self.get_filename(obj, **kwargs)) - if size == 0: + filepath = self.get_filename(obj, **kwargs) + for _ in range(0, 2): + size = os.path.getsize(filepath) + if size != 0: + break # May be legitimately 0, or there may be an issue with the FS / kernel, so we try again time.sleep(0.01) - size = os.path.getsize(self.get_filename(obj, **kwargs)) return size except OSError: return 0 From dedb1d3f4ca83539baea9c4ff5654c3b44614540 Mon Sep 17 00:00:00 2001 From: mvdbeek Date: Fri, 19 Jan 2018 12:15:14 +0100 Subject: [PATCH 112/112] Fix history import by file on multi-handler setups The uploaded archive was going to be deleted before the job started running. --- lib/galaxy/webapps/galaxy/api/histories.py | 3 +++ 1 file changed, 3 insertions(+) diff --git a/lib/galaxy/webapps/galaxy/api/histories.py b/lib/galaxy/webapps/galaxy/api/histories.py index 69c8940e0ed..076fe7a5060 100644 --- a/lib/galaxy/webapps/galaxy/api/histories.py +++ b/lib/galaxy/webapps/galaxy/api/histories.py @@ -321,6 +321,9 @@ class HistoriesController(BaseAPIController, ExportsHistoryMixin, ImportsHistory if archive_source: archive_type = payload.get("archive_type", "url") elif hasattr(archive_file, "file"): + # archive_file.file is a TemporaryFile and will be deleted once it is closed. + # We prevent this by setting `delete` to `False`. + archive_file.file.delete = False archive_source = payload["archive_file"].file.name archive_type = "file" else: