diff --git a/tools/filters/remove_beginning.xml b/tools/filters/remove_beginning.xml
index 84ddc8742e5..6718a9b05a3 100644
--- a/tools/filters/remove_beginning.xml
+++ b/tools/filters/remove_beginning.xml
@@ -2,7 +2,7 @@
of a fileremove_beginning.pl $input $num_lines $out_file1
-
+
diff --git a/tools/filters/sorter.xml b/tools/filters/sorter.xml
index c67eb4472ea..e6403dbf3be 100644
--- a/tools/filters/sorter.xml
+++ b/tools/filters/sorter.xml
@@ -5,12 +5,12 @@
-
+
-
+
diff --git a/tools/metag_tools/megablast_wrapper.xml b/tools/metag_tools/megablast_wrapper.xml
index cbbc558d1d6..ae32272707f 100644
--- a/tools/metag_tools/megablast_wrapper.xml
+++ b/tools/metag_tools/megablast_wrapper.xml
@@ -2,16 +2,15 @@
for Metagenomics Projectsmegablast_wrapper.py $source_select $input_query $output1 $word_size $iden_cutoff $disc_word $disc_type $filter_query ${GALAXY_DATA_INDEX_DIR}
-
+
-
-
+
@@ -43,16 +42,15 @@
-.. class:: infomark
+.. class:: warningmark
-**TIP**. Searching might require few hours before returning the result.
+**Note**. Database searches may take substantial amount of time. For large input datasets it is advisable to allow overnight processing.
-----
**What it does**
-This tool runs **megablast** (for information about megablast, please see the reference below) and search against a nucleotide database.
-The query sequence could be any nucleotide sequences in fasta format.
+This tool runs **megablast** (for information about megablast, please see the reference below) a high performance nucleotide local aligner developed by Webb Miller and colleagues.
-----
@@ -81,7 +79,7 @@ The query sequence could be any nucleotide sequences in fasta format.
**Reference**
- **Megablast**: Zhang et al. A Greedy Algorithm for Aligning DNA Sequences. 2000. JCB: 203-214.
+Zhang et al. A Greedy Algorithm for Aligning DNA Sequences. 2000. JCB: 203-214.
diff --git a/tools/metag_tools/megablast_xml_parser.xml b/tools/metag_tools/megablast_xml_parser.xml
index bf2638c96db..b860df0d215 100644
--- a/tools/metag_tools/megablast_xml_parser.xml
+++ b/tools/metag_tools/megablast_xml_parser.xml
@@ -1,5 +1,5 @@
-
-
+
+XML output from blast programsmegablast_xml_parser.py $input1 $output1
@@ -20,40 +20,49 @@
.. class:: warningmark
-**IMPORTANT**. Please **zip** your xml file and upload the zipped file. This will help speeding up the process. (hint: under shell command, try: gzip -c your_xml_file > your_xml_file.gz)
-
-.. class:: infomark
-
-**TIP**. To get xml output from megablast, add option **-m 7** in the command line.
+Blast XML output **must** be uploaded to Galaxy in zipped form.
-----
**What it does**
-This tool is for users to upload their own megablast xml output and converts to tabular format, showing all information for retrieving alignment blocks.
+This tool will process XML output of any NCBI blast tool (if you run your own blast jobs, the XML output can be generated with **-m 7** option).
-----
-**Example**
+**Output fields**
-- Query sequence::
-
- >seq1
- CGGACAGCGCCGCCACCAACAAAGCCACCA
-
-- Parsed output::
-
- +------+------+-----------------+----------+--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------+
- | Qid | Qlen | Sid | Slen | HSP |
- +------+------+-----------------+----------+--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------+
- | seq1 | 30 | gnl|BL_ORD_ID|0 | 5528445 | 59.96 | 8.38112e-11 | 1 | 30 | 5436010 | 5436039 | 1 | 1 | 30 | 30 | CGGACAGCGCCGCCACCAACAAAGCCACCA | CGGACAGCGCCGCCACCAACAAAGCCACCA | |||||||||||||||||||||||||||||| |
- +------+------+-----------------+----------+--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------+
+This tools returns tab-delimted output with the following fields::
------
+ Description Example
+ ----------------------------------------- -----------------
-**Reference**
+ 1. Name of the query sequence Seq1
+ 2. Length of the query sequence 30
+ 3. Name of target sequence gnl|BL_ORD_ID|0
+ 4. Length of target sequence 5528445
+ 5. Alignment bit score 59.96
+ 6. E-value 8.38112e-11
+ 7. Start of alignment within query 1
+ 8. End of alignment within query 30
+ 9. Start of alignment within target 5436010
+ 10. End of alignment within target 5436039
+ 11. Query frame 1
+ 12. Target frame 1
+ 13. Number of identical bases within 29
+ the alignment
+ 14. Alignment length 30
+ 15. Aligned portion (sequence) of query CGGACAGCGCCGCCACCAACAAAGCCACCA
+ 16. Aligned portion (sequence) of target CGGACAGCGCCGCCACCAACAAAGCCATCA
+ 17. Midline indicating positions of ||||||||||||||||||||||||||| ||
+ matches within the alignment
+
+------
+
+.. class:: infomark
+
+Note that this form of output does not contain alignment identify value. However, it can be computed by dividing the number of identical bases wityh the alignment (Field 13) by the alignment length (Field 14) using *Text Manipulation->Compute* tool
- **Megablast**: Zhang et al. A Greedy Algorithm for Aligning DNA Sequences. 2000. JCB: 203-214.