From e130de1a26c39c508f7ed2a01fe9e314f6ba8794 Mon Sep 17 00:00:00 2001 From: Anton Nekrutenko Date: Tue, 17 Jul 2007 15:17:11 +0000 Subject: [PATCH] More interface changes and updates to tool_conf.xml.main and tool_conf.xml.sample --- templates/masthead.tmpl | 5 +- tool_conf.xml.main | 205 ++-------------------- tool_conf.xml.sample | 229 +++---------------------- tools/extract/fasta-subseq-wrapper.xml | 30 ++-- tools/extract/twoBitToFa_wrapper.xml | 34 ++-- tools/plotting/xy_plot.xml | 4 +- 6 files changed, 71 insertions(+), 436 deletions(-) diff --git a/templates/masthead.tmpl b/templates/masthead.tmpl index 8945ebc9812..48fbc31076f 100644 --- a/templates/masthead.tmpl +++ b/templates/masthead.tmpl @@ -21,8 +21,9 @@ *# Info: report bugs - | wiki - | screencasts + | wiki + | screencasts + | blog     diff --git a/tool_conf.xml.main b/tool_conf.xml.main index 68f4b190604..a7ec4bf8fdd 100644 --- a/tool_conf.xml.main +++ b/tool_conf.xml.main @@ -81,10 +81,10 @@ - --> +
@@ -111,12 +111,17 @@
- + - + +
+
+ + + +
@@ -174,194 +179,4 @@
- - - -
- - -
diff --git a/tool_conf.xml.sample b/tool_conf.xml.sample index 0abda398e91..9d15890d2dc 100644 --- a/tool_conf.xml.sample +++ b/tool_conf.xml.sample @@ -3,16 +3,13 @@
- - - + + - +
@@ -24,15 +21,14 @@
- +
-
+
- @@ -44,20 +40,21 @@
-
- +
+
+
+
- @@ -65,13 +62,18 @@
+
+ + +
-
+
- +
+
@@ -83,9 +85,7 @@ -
-
@@ -117,6 +117,11 @@
+
+ + + +
@@ -174,194 +179,4 @@
- - -
- - - - - - - - -
-
- - -
diff --git a/tools/extract/fasta-subseq-wrapper.xml b/tools/extract/fasta-subseq-wrapper.xml index 54a6889b81f..24a196af5e7 100644 --- a/tools/extract/fasta-subseq-wrapper.xml +++ b/tools/extract/fasta-subseq-wrapper.xml @@ -1,5 +1,5 @@ - corresponding to query coordinates + using coordinates from assembled genomes fasta-subseq-wrapper.pl -i $input -o $out_file1 -p $input_chromCol $input_startCol $input_endCol $input_strandCol -g $dbkey @@ -19,30 +19,32 @@ Make sure that the genome build is specified for the interval dataset you are extracting sequences for (click the pencil icon if it is not specified). However, if the build is specified and the tool still gives you an error, your genome of interest may only be partially assembled (ie, in scaffolds). To extract sequences from such partially assembled genomes use *Extract Genomic DNA from unassmebled genomes* tool. +.. class:: infomark + +Why do we have two sequence extractors? + + * **Extract genomic DNA using coordinates from ASSEMBLED genomes** (this tool) - will work for most cases when your intervals are located on assembled chromosomes (i.e., chr1, chrX, etc.) + * **Extract genomic DNA using coordinates from UNassembled genomes** - is designed to work on partially assembled or unassembled genomes when your intervals are located in contigs or scaffolds rather than assembled chromosomes (i.e., super_1 etc.) + +These two tools will be merged in the future. + ----- -**Syntax** +**What it does** This tool uses coordinate, strand, and build information to fetch genomic DNAs in FASTA format. -- **FASTA format** a text-based format for representing both nucleic and protein sequences, in which base pairs or proteins are represented using a single-letter code. - - - This format contains a one line header. It starts with a " >" symbol. The first word on this line is the name of the sequence. The rest of the line is a description of the sequence. - - The remaining lines contain the sequence itself. - - Blank lines in a FASTA file are ignored, and so are spaces or other gap symbols (dashes, underscores, periods) in a sequence. - - Fasta files containing multiple sequences are just the same, with one sequence listed right after another. This format is accepted for many multiple sequence alignment programs. - ----- **Example** -- Input dataset:: +Input dataset:: - chr7 127475281 127475310 NM_000230 0 + - chr7 127485994 127486166 NM_000230 0 + - chr7 127486011 127486166 D49487 0 + + chr7 127475281 127475310 NM_000230 0 + + chr7 127485994 127486166 NM_000230 0 + + chr7 127486011 127486166 D49487 0 + -- Fetch genomic DNAs of the above data:: +Fetch genomic DNAs of the above data:: >hg17_chr7_127475281_127475310_+ GTAGGAATCGCAGCGCCAGCGGTTGCAAG diff --git a/tools/extract/twoBitToFa_wrapper.xml b/tools/extract/twoBitToFa_wrapper.xml index ff85502dba6..0ca82e6d05d 100644 --- a/tools/extract/twoBitToFa_wrapper.xml +++ b/tools/extract/twoBitToFa_wrapper.xml @@ -1,5 +1,5 @@ - from unassembled genome coordinates + using coordinates from UNassembled genomes twoBitToFa_wrapper.py $input $out_file1 $input_chromCol $input_startCol $input_endCol $input_strandCol $dbkey "/depot/data2/galaxy/twobit.loc" @@ -17,32 +17,34 @@ .. class:: warningmark -Make sure the input data has been specified a database build. +Make sure that the genome build is specified for the interval dataset you are extracting sequences for (click the pencil icon if it is not specified). + +.. class:: infomark + +Why do we have two sequence extractors? + + * **Extract genomic DNA using coordinates from ASSEMBLED genomes** - will work for most cases when your intervals are located on assembled chromosomes (i.e., chr1, chrX, etc.) + * **Extract genomic DNA using coordinates from UNassembled genomes** (this tool) - is designed to work on partially assembled or unassembled genomes when your intervals are located in contigs or scaffolds rather than assembled chromosomes (i.e., super_1 etc.) + +These two tools will be merged in the future. ----- -**Syntax** +**What it does** -This tool uses coordinate, strand, and build information to fetch genomic DNAs from partially assembled and unassembled genomes in FASTA format. - -- **FASTA format** a text-based format for representing both nucleic and protein sequences, in which base pairs or proteins are represented using a single-letter code. - - - This format contains a one line header. It starts with a " >" symbol. The first word on this line is the name of the sequence. The rest of the line is a description of the sequence. - - The remaining lines contain the sequence itself. - - Blank lines in a FASTA file are ignored, and so are spaces or other gap symbols (dashes, underscores, periods) in a sequence. - - Fasta files containing multiple sequences are just the same, with one sequence listed right after another. This format is accepted for many multiple sequence alignment programs. +This tool uses coordinate, strand, and build information to fetch genomic DNAs in FASTA format. ----- **Example** -- Input dataset:: +Input dataset:: - super_1 127475281 127475310 NM_000230 0 + - super_1 127485994 127486166 NM_000230 0 + - super_1 127486011 127486166 D49487 0 + + super_1 127475281 127475310 NM_000230 0 + + super_1 127485994 127486166 NM_000230 0 + + super_1 127486011 127486166 D49487 0 + -- Fetch genomic DNAs of the above data:: +Fetch genomic DNAs of the above data:: >super_1:127475281-127475310 GTAGGAATCGCAGCGCCAGCGGTTGCAAG diff --git a/tools/plotting/xy_plot.xml b/tools/plotting/xy_plot.xml index b5394330eec..b84a2a76b60 100644 --- a/tools/plotting/xy_plot.xml +++ b/tools/plotting/xy_plot.xml @@ -1,5 +1,5 @@ - - of two numeric columns + + for multiple series and graph types r_wrapper.sh $script_file