diff --git a/doc/Makefile b/doc/Makefile index 048b8c10a6c..c03f12ec524 100644 --- a/doc/Makefile +++ b/doc/Makefile @@ -14,8 +14,22 @@ ALLSPHINXOPTS = -d $(BUILDDIR)/doctrees $(PAPEROPT_$(PAPER)) $(SPHINXOPTS) sou # the i18n builder cannot share the environment and doctrees with the others I18NSPHINXOPTS = $(PAPEROPT_$(PAPER)) $(SPHINXOPTS) source +# Galaxy Local variables + +TOOLDATASHAREDDIR = ../tool-data/shared +TOOLDATABUILDFILES = $(TOOLDATASHAREDDIR)/ensembl/builds.txt \ + $(TOOLDATASHAREDDIR)/ncbi/builds.txt \ + $(TOOLDATASHAREDDIR)/ucsc/publicbuilds.txt + .PHONY: help clean html dirhtml singlehtml pickle json htmlhelp qthelp devhelp epub latex latexpdf text man changes linkcheck doctest gettext + +# Sphinx wants the build files to be there; Copy the sample files into +# place if we don't already have the build files. +$(TOOLDATABUILDFILES) : + /bin/cp $@.sample $@ + + help: @echo "Please use \`make ' where is one of" @echo " html to make standalone HTML files" @@ -41,7 +55,7 @@ help: clean: -rm -rf $(BUILDDIR)/* -html: +html: $(TOOLDATABUILDFILES) $(SPHINXBUILD) -b html $(ALLSPHINXOPTS) $(BUILDDIR)/html @echo @echo "Build finished. The HTML pages are in $(BUILDDIR)/html." diff --git a/lib/galaxy/datatypes/assembly.py b/lib/galaxy/datatypes/assembly.py index 65021b96677..eab63570417 100644 --- a/lib/galaxy/datatypes/assembly.py +++ b/lib/galaxy/datatypes/assembly.py @@ -25,25 +25,26 @@ class Amos( data.Text ): # It should call get_headers() like other sniff methods. """ Determines whether the file is an amos assembly file format - Example: - {CTG - iid:1 - eid:1 - seq: - CCTCTCCTGTAGAGTTCAACCGA-GCCGGTAGAGTTTTATCA - . - qlt: - DDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDD - . - {TLE - src:1027 - off:0 - clr:618,0 - gap: - 250 612 - . - } - } + Example:: + + {CTG + iid:1 + eid:1 + seq: + CCTCTCCTGTAGAGTTCAACCGA-GCCGGTAGAGTTTTATCA + . + qlt: + DDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDD + . + {TLE + src:1027 + off:0 + clr:618,0 + gap: + 250 612 + . + } + } """ isAmos = False try: @@ -68,7 +69,8 @@ class Sequences( sequence.Fasta ): def sniff( self, filename ): """ Determines whether the file is a velveth produced fasta format - The id line has 3 fields separated by tabs: sequence_name sequence_index cataegory + The id line has 3 fields separated by tabs: sequence_name sequence_index cataegory:: + >SEQUENCE_0_length_35 1 1 GGATATAGGGCCAACCCAACTCAACGGCCTGTCTT >SEQUENCE_1_length_35 2 1 @@ -103,7 +105,7 @@ class Roadmaps( data.Text ): def sniff( self, filename ): """ - Determines whether the file is a velveth produced RoadMap + Determines whether the file is a velveth produced RoadMap:: 142858 21 1 ROADMAP 1 ROADMAP 2 diff --git a/lib/galaxy/datatypes/data.py b/lib/galaxy/datatypes/data.py index 103c63fe795..edb539d742c 100644 --- a/lib/galaxy/datatypes/data.py +++ b/lib/galaxy/datatypes/data.py @@ -797,13 +797,14 @@ def get_test_fname( fname ): path, name = os.path.split(__file__) full_path = os.path.join( path, 'test', fname ) return full_path + def get_file_peek( file_name, is_multi_byte=False, WIDTH=256, LINE_COUNT=5, skipchars=[] ): """ - Returns the first LINE_COUNT lines wrapped to WIDTH + Returns the first LINE_COUNT lines wrapped to WIDTH:: - ## >>> fname = get_test_fname('4.bed') - ## >>> get_file_peek(fname) - ## 'chr22 30128507 31828507 uc003bnx.1_cds_2_0_chr22_29227_f 0 +\n' + ## >>> fname = get_test_fname('4.bed') + ## >>> get_file_peek(fname) + ## 'chr22 30128507 31828507 uc003bnx.1_cds_2_0_chr22_29227_f 0 +\n' """ # Set size for file.readline() to a negative number to force it to # read until either a newline or EOF. Needed for datasets with very diff --git a/lib/galaxy/datatypes/genetics.py b/lib/galaxy/datatypes/genetics.py index f2be639e25c..011d0abf261 100644 --- a/lib/galaxy/datatypes/genetics.py +++ b/lib/galaxy/datatypes/genetics.py @@ -67,14 +67,18 @@ class GenomeGraphs( Tabular ): """ from the ever-helpful angie hinrichs angie@soe.ucsc.edu a genome graphs call looks like this + http://genome.ucsc.edu/cgi-bin/hgGenome?clade=mammal&org=Human&db=hg18&hgGenome_dataSetName=dname - &hgGenome_dataSetDescription=test&hgGenome_formatType=best%20guess&hgGenome_markerType=best%20guess + &hgGenome_dataSetDescription=test&hgGenome_formatType=best%20guess&hgGenome_markerType=best%20guess &hgGenome_columnLabels=best%20guess&hgGenome_maxVal=&hgGenome_labelVals= &hgGenome_maxGapToFill=25000000&hgGenome_uploadFile=http://galaxy.esphealth.org/datasets/333/display/index &hgGenome_doSubmitUpload=submit - Galaxy gives this for an interval file + + Galaxy gives this for an interval file + http://genome.ucsc.edu/cgi-bin/hgTracks?db=hg18&position=chr1:1-1000&hgt.customText= http%3A%2F%2Fgalaxy.esphealth.org%2Fdisplay_as%3Fid%3D339%26display_app%3Ducsc + """ ret_val = [] ggtail = 'hgGenome_doSubmitUpload=submit' diff --git a/lib/galaxy/datatypes/sequence.py b/lib/galaxy/datatypes/sequence.py index fd85ee6e2e2..196cddf5b9b 100644 --- a/lib/galaxy/datatypes/sequence.py +++ b/lib/galaxy/datatypes/sequence.py @@ -25,11 +25,14 @@ class SequenceSplitLocations( data.Text ): """ Class storing information about a sequence file composed of multiple gzip files concatenated as one OR an uncompressed file. In the GZIP case, each sub-file's location is stored in start and end. - The format of the file is JSON: - { "sections" : [ - { "start" : "x", "end" : "y", "sequences" : "z" }, - ... - ]} + + The format of the file is JSON:: + + { "sections" : [ + { "start" : "x", "end" : "y", "sequences" : "z" }, + ... + ]} + """ def set_peek( self, dataset, is_multi_byte=False ): if not dataset.dataset.purged: @@ -224,12 +227,19 @@ class Fasta( Sequence ): For complete details see http://www.ncbi.nlm.nih.gov/blast/fasta.shtml Rules for sniffing as True: + We don't care about line length (other than empty lines). + The first non-empty line must start with '>' and the Very Next line.strip() must have sequence data and not be a header. + 'sequence data' here is loosely defined as non-empty lines which do not start with '>' + This will cause Color Space FASTA (csfasta) to be detected as True (they are, after all, still FASTA files - they have a header line followed by sequence data) + Previously this method did some checking to determine if the sequence data had integers (presumably to differentiate between fasta and csfasta) + This should be done through sniff order, where csfasta (currently has a null sniff function) is detected for first (stricter definition) followed sometime after by fasta + We will only check that the first purported sequence is correctly formatted. >>> fname = get_test_fname( 'sequence.maf' )