diff --git a/tools/fastx_toolkit/fasta_clipping_histogram.xml b/tools/fastx_toolkit/fasta_clipping_histogram.xml index ac8d9107d3d..5294f40a2b0 100644 --- a/tools/fastx_toolkit/fasta_clipping_histogram.xml +++ b/tools/fastx_toolkit/fasta_clipping_histogram.xml @@ -99,6 +99,12 @@ The first sequence counts as 2, the second as 10, the third as 3, to produce the Use the **FASTA Collapser** tool to create FASTA files with multiplicity counts. +------ + +This tool is based on `FASTX-toolkit`__ by Assaf Gordon. + + .. __: http://hannonlab.cshl.edu/fastx_toolkit/ + diff --git a/tools/fastx_toolkit/fasta_formatter.xml b/tools/fastx_toolkit/fasta_formatter.xml index 799b05aead9..d068be7238d 100644 --- a/tools/fastx_toolkit/fasta_formatter.xml +++ b/tools/fastx_toolkit/fasta_formatter.xml @@ -76,5 +76,12 @@ Output FASTA file (with width=0 => single line):: AGGAATGATGACTACAATGATCAACTTAACCTATCTATTTAATTTAGTTCCCTAATGTCAGGGACCTACCTGTTTTTGTTATGTTTGGGTTTTGTTGTTGTTGTTTTTTTAATCTGAAGGTATTGTGCATTATATGACCTGTAATACACAATTAAAGTCAATTTTAATGAACATGTAGTAAAAACT >Scaffold9299 CAGCATCTACATAATATGATCGCTATTAAACTTAAATCTCCTTGACGGAGTCTTCGGTCATAACACAAACCCAGACCTACGTATATGACAAAGCTAATAGaactggtctttacctTTAAGTTG + +------ + +This tool is based on `FASTX-toolkit`__ by Assaf Gordon. + + .. __: http://hannonlab.cshl.edu/fastx_toolkit/ + diff --git a/tools/fastx_toolkit/fasta_nucleotide_changer.xml b/tools/fastx_toolkit/fasta_nucleotide_changer.xml index 236c0ae6d31..cd202fa11e7 100644 --- a/tools/fastx_toolkit/fasta_nucleotide_changer.xml +++ b/tools/fastx_toolkit/fasta_nucleotide_changer.xml @@ -62,5 +62,12 @@ Output DNA FASTA file (with RNA-to-DNA mode):: >cel-miR-1 MIMAT0000003 Caenorhabditis elegans miR-1 TGGAATGTAAAGAAGTATGTA + +------ + +This tool is based on `FASTX-toolkit`__ by Assaf Gordon. + + .. __: http://hannonlab.cshl.edu/fastx_toolkit/ + diff --git a/tools/fastx_toolkit/fastx_barcode_splitter.xml b/tools/fastx_toolkit/fastx_barcode_splitter.xml index da3cd932cd1..a3873054ae0 100644 --- a/tools/fastx_toolkit/fastx_barcode_splitter.xml +++ b/tools/fastx_toolkit/fastx_barcode_splitter.xml @@ -64,6 +64,13 @@ The output of this tool is an HTML file, displaying the split counts and the fil .. image:: ./static/fastx_icons/barcode_splitter_output_example.png + +------ + +This tool is based on `FASTX-toolkit`__ by Assaf Gordon. + + .. __: http://hannonlab.cshl.edu/fastx_toolkit/ + diff --git a/tools/fastx_toolkit/fastx_clipper.xml b/tools/fastx_toolkit/fastx_clipper.xml index 43be054dc6a..90c4f6db1ab 100644 --- a/tools/fastx_toolkit/fastx_clipper.xml +++ b/tools/fastx_toolkit/fastx_clipper.xml @@ -104,6 +104,12 @@ This tool clips adapters from the 3'-end of the sequences in a FASTA/FASTQ file. - + +------ + +This tool is based on `FASTX-toolkit`__ by Assaf Gordon. + + .. __: http://hannonlab.cshl.edu/fastx_toolkit/ + diff --git a/tools/fastx_toolkit/fastx_collapser.xml b/tools/fastx_toolkit/fastx_collapser.xml index f8fe06c81ce..28a6907774f 100644 --- a/tools/fastx_toolkit/fastx_collapser.xml +++ b/tools/fastx_toolkit/fastx_collapser.xml @@ -77,5 +77,12 @@ The following output:: means that the sequence "ATAT" is the second sequence in the file, and it appeared 4 times in the input FASTA file. + +------ + +This tool is based on `FASTX-toolkit`__ by Assaf Gordon. + + .. __: http://hannonlab.cshl.edu/fastx_toolkit/ + diff --git a/tools/plotting/boxplot.xml b/tools/plotting/boxplot.xml index ef8a35bb07e..6a97c5191f2 100644 --- a/tools/plotting/boxplot.xml +++ b/tools/plotting/boxplot.xml @@ -97,6 +97,12 @@ Creates a boxplot graph. Its main purpose is to display a distribution of qualit .. image:: ./static/images/solid_qual.png +------ + +**Citation** + +If you use this tool, please cite `Blankenberg D, Gordon A, Von Kuster G, Coraor N, Taylor J, Nekrutenko A; Galaxy Team. Manipulation of FASTQ data with Galaxy. Bioinformatics. 2010 Jul 15;26(14):1783-5. <http://www.ncbi.nlm.nih.gov/pubmed/20562416>`_ + diff --git a/tools/visualization/GMAJ.xml b/tools/visualization/GMAJ.xml index 4e952eea991..1716f86fa76 100644 --- a/tools/visualization/GMAJ.xml +++ b/tools/visualization/GMAJ.xml @@ -194,6 +194,16 @@ GMAJ is an interactive viewer for MAF alignments, with support for optional anno For detailed information on GMAJ, click here_. + +------ + +**Citation** + +If you use GMAJ, please cite `Blanchette M, Kent WJ, Riemer C, Elnitski L, Smit AF, Roskin KM, Baertsch R, Rosenbloom K, Clawson H, Green ED, Haussler D, Miller W. Aligning multiple genomic sequences with the threaded blockset aligner. Genome Res. 2004 Apr;14(4):708-15. <http://www.ncbi.nlm.nih.gov/pubmed/15060014>`_ and http://globin.cse.psu.edu/dist/gmaj/. + +If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. <http://www.ncbi.nlm.nih.gov/pubmed/21775304>`_ + + .. _here: /static/gmaj/docs/gmaj_readme.html .. _TBA: http://www.bx.psu.edu/miller_lab/