From 7d0ff14df9e2a569756fc4dcab3669191f412c8c Mon Sep 17 00:00:00 2001 From: Kelly Vincent Date: Mon, 8 Nov 2010 00:10:13 -0500 Subject: [PATCH] Converted several tools to data table style of loc file handling (Bowtie, BWA, Lastz, Megablast, PerM, SRMA). Cleaned up several tool XML files, removing unnecessary None parameters. --- test-data/phiX.fasta | 188 +++++------- tool-data/blastdb.loc.sample | 18 +- tool-data/blastdb_p.loc.sample | 27 +- tool-data/bowtie_indices.loc.sample | 34 ++- tool-data/bowtie_indices_color.loc.sample | 38 ++- tool-data/bwa_index.loc.sample | 29 +- tool-data/lastz_seqs.loc.sample | 23 +- tool-data/perm_base_index.loc.sample | 15 +- tool-data/perm_color_index.loc.sample | 13 +- tool-data/srma_index.loc.sample | 7 +- tool_data_table_conf.xml.sample | 54 +++- tools/metag_tools/megablast_wrapper.py | 27 +- tools/metag_tools/megablast_wrapper.xml | 35 +-- tools/ncbi_blast_plus/ncbi_blastn_wrapper.xml | 7 +- tools/ncbi_blast_plus/ncbi_blastp_wrapper.xml | 7 +- tools/ncbi_blast_plus/ncbi_blastx_wrapper.xml | 7 +- .../ncbi_blast_plus/ncbi_tblastn_wrapper.xml | 7 +- .../ncbi_blast_plus/ncbi_tblastx_wrapper.xml | 7 +- tools/sr_mapping/PerM.xml | 113 ++++--- tools/sr_mapping/bowtie_color_wrapper.xml | 281 ++++++------------ tools/sr_mapping/bowtie_wrapper.py | 62 ++-- tools/sr_mapping/bowtie_wrapper.xml | 270 ++++++----------- tools/sr_mapping/bwa_wrapper.py | 6 +- tools/sr_mapping/bwa_wrapper.xml | 86 +++--- .../sr_mapping/lastz_paired_reads_wrapper.py | 2 +- .../sr_mapping/lastz_paired_reads_wrapper.xml | 38 ++- tools/sr_mapping/lastz_wrapper.py | 2 +- tools/sr_mapping/lastz_wrapper.xml | 109 ++++--- tools/sr_mapping/srma_wrapper.py | 20 +- tools/sr_mapping/srma_wrapper.xml | 64 ++-- 30 files changed, 756 insertions(+), 840 deletions(-) diff --git a/test-data/phiX.fasta b/test-data/phiX.fasta index d047693d6b8..53df885dc48 100644 --- a/test-data/phiX.fasta +++ b/test-data/phiX.fasta @@ -1,109 +1,79 @@ ->phiX -GAGTTTTATCGCTTCCATGACGCAGAAGTTAACACTTTCGGATATTTCTG -ATGAGTCGAAAAATTATCTTGATAAAGCAGGAATTACTACTGCTTGTTTA -CGAATTAAATCGAAGTGGACTGCTGGCGGAAAATGAGAAAATTCGACCTA -TCCTTGCGCAGCTCGAGAAGCTCTTACTTTGCGACCTTTCGCCATCAACT -AACGATTCTGTCAAAAACTGACGCGTTGGATGAGGAGAAGTGGCTTAATA -TGCTTGGCACGTTCGTCAAGGACTGGTTTAGATATGAGTCACATTTTGTT -CATGGTAGAGATTCTCTTGTTGACATTTTAAAAGAGCGTGGATTACTATC -TGAGTCCGATGCTGTTCAACCACTAATAGGTAAGAAATCATGAGTCAAGT -TACTGAACAATCCGTACGTTTCCAGACCGCTTTGGCCTCTATTAAGCTCA -TTCAGGCTTCTGCCGTTTTGGATTTAACCGAAGATGATTTCGATTTTCTG -ACGAGTAACAAAGTTTGGATTGCTACTGACCGCTCTCGTGCTCGTCGCTG -CGTTGAGGCTTGCGTTTATGGTACGCTGGACTTTGTGGGATACCCTCGCT -TTCCTGCTCCTGTTGAGTTTATTGCTGCCGTCATTGCTTATTATGTTCAT -CCCGTCAACATTCAAACGGCCTGTCTCATCATGGAAGGCGCTGAATTTAC -GGAAAACATTATTAATGGCGTCGAGCGTCCGGTTAAAGCCGCTGAATTGT -TCGCGTTTACCTTGCGTGTACGCGCAGGAAACACTGACGTTCTTACTGAC -GCAGAAGAAAACGTGCGTCAAAAATTACGTGCaGAAGGAGTGATGTAATG -TCTAAAGGTAAAAAACGTTCTGGCGCTCGCCCTGGTCGTCCGCAGCCGTT -GCGAGGTACTAAAGGCAAGCGTAAAGGCGCTCGTCTTTGGTATGTAGGTG -GTCAACAATTTTAATTGCAGGGGCTTCGGCCCCTTACTTGAGGATAAATT -ATGTCTAATATTCAAACTGGCGCCGAGCGTATGCCGCATGACCTTTCCCA -TCTTGGCTTCCTTGCTGGTCAGATTGGTCGTCTTATTACCATTTCAACTA -CTCCGGTTATCGCTGGCGACTCCTTCGAGATGGACGCCGTTGGCGCTCTC -CGTCTTTCTCCATTGCGTCGTGGCCTTGCTATTGACTCTACTGTAGACAT -TTTTACTTTTTATGTCCCTCATCGTCACGTTTATGGTGAACAGTGGATTA -AGTTCATGAAGGATGGTGTTAATGCCACTCCTCTCCCGACTGTTAACACT -ACTGGTTATATTGACCATGCCGCTTTTCTTGGCACGATTAACCCTGATAC -CAATAAAATCCCTAAGCATTTGTTTCAGGGTTATTTGAATATCTATAACA -ACTATTTTAAAGCGCCGTGGATGCCTGACCGTACCGAGGCTAACCCTAAT -GAGCTTAATCAAGATGATGCTCGTTATGGTTTCCGTTGCTGCCATCTCAA -AAACATTTGGACTGCTCCGCTTCCTCCTGAGACTGAGCTTTCTCGCCAAA -TGACGACTTCTACCACATCTATTGACATTATGGGTCTGCAAGCTGCTTAT -GCTAATTTGCATACTGACCAAGAACGTGATTACTTCATGCAGCGTTACCg -TGATGTTATTTCTTCATTTGGAGGTAAAACCTCTTATGACGCTGACAACC -GTCCTTTACTTGTCATGCGCTCTAATCTCTGGGCATCTGGCTATGATGTT -GATGGAACTGACCAAACGTCGTTAGGCCAGTTTTCTGGTCGTGTTCAACA -GACCTATAAACATTCTGTGCCGCGTTTCTTTGTTCCTGAGCATGGCACTA -TGTTTACTCTTGCGCTTGTTCGTTTTCCGCCTACTGCGACTAAAGAGATT -CAGTACCTTAACGCTAAAGGTGCTTTGACTTATACCGATATTGCTGGCGA -CCCTGTTTTGTATGGCAACTTGCCGCCGCGTGAAATTTCTATGAAGGATG -TTTTCCGTTCTGGTGATTCGTCTAAGAAGTTTAAGATTGCTGAGGGTCAG -TGGTATCGTTATGCGCCTTCGTATGTTTCTCCTGCTTATCACCTTCTTGA -AGGCTTCCCATTCATTCAGGAACCGCCTTCTGGTGATTTGCAAGAACGCG -TACTTATTCGCCACCATGATTATGACCAGTGTTTCCAGTCCGTTCAGTTG -TTGCAGTGGAATAGTCAGGTTAAATTTAATGTGACCGTTTATCGCAATCT -GCCGACCACTCGCGATTCAATCATGACTTCGTGATAAAAGATTGAGTGTG -AGGTTATAACGCCGAAGCGGTAAAAATTTTAATTTTTGCCGCTGAGGGGT -TGACCAAGCGAAGCGCGGTAGGTTTTCTGCTTAGGAGTTTAATCATGTTT -CAGACTTTTATTTCTCGCCATAATTCAAACTTTTTTTCTGATAAGCTGGT -TCTCACTTCTGTTACTCCAGCTTCTTCGGCACCTGTTTTACAGACACCTA -AAGCTACATCGTCAACGTTATATTTTGATAGTTTGACGGTTAATGCTGGT -AATGGTGGTTTTCTTCATTGCATTCAGATGGATACATCTGTCAACGCCGC -TAATCAGGTTGTTTCTGTTGGTGCTGATATTGCTTTTGATGCCGACCCTA -AATTTTTTGCCTGTTTGGTTCGCTTTGAGTCTTCTTCGGTTCCGACTACC -CTCCCGACTGCCTATGATGTTTATCCTTTGAATGGTCGCCATGATGGTGG -TTATTATACCGTCAAGGACTGTGTGACTATTGACGTCCTTCCCCGTACGC -CGGGCAATAAtGTTTATGTTGGTTTCATGGTTTGGTCTAACTTTACCGCT -ACTAAATGCCGCGGATTGGTTTCGCTGAATCAGGTTATTAAAGAGATTAT -TTGTCTCCAGCCACTTAAGTGAGGTGATTTATGTTTGGTGCTATTGCTGG -CGGTATTGCTTCTGCTCTTGCTGGTGGCGCCATGTCTAAATTGTTTGGAG -GCGGTCAAAAAGCCGCCTCCGGTGGCATTCAAGGTGATGTGCTTGCTACC -GATAACAATACTGTAGGCATGGGTGATGCTGGTATTAAATCTGCCATTCA -AGGCTCTAATGTTCCTAACCCTGATGAGGCCGCCCCTAGTTTTGTTTCTG -GTGCTATGGCTAAAGCTGGTAAAGGACTTCTTGAAGGTACGTTGCAGGCT -GGCACTTCTGCCGTTTCTGATAAGTTGCTTGATTTGGTTGGACTTGGTGG -CAAGTCTGCCGCTGATAAAGGAAAGGATACTCGTGATTATCTTGCTGCTG -CATTTCCTGAGCTTAATGCTTGGGAGCGTGCTGGTGCTGATGCTTCCTCT -GCTGGTATGGTTGACGCCGGATTTGAGAATCAAAAAGAGCTTACTAAAAT -GCAACTGGACAATCAGAAAGAGATTGCCGAGATGCAAAATGAGACTCAAA -AAGAGATTGCTGGCATTCAGTCGGCGACTTCACGCCAGAATACGAAAGAC -CAGGTATATGCACAAAATGAGATGCTTGCTTATCAACAGAAGGAGTCTAC -TGCTCGCGTTGCGTCTATTATGGAAAACACCAATCTTTCCAAGCAACAGC -AGGTTTCCGAGATTATGCGCCAAATGCTTACTCAAGCTCAAACGGCTGGT -CAGTATTTTACCAATGACCAAATCAAAGAAATGACTCGCAAGGTTAGTGC -TGAGGTTGACTTAGTTCATCAGCAAACGCAGAATCAGCGGTATGGCTCTT -CTCATATTGGCGCTACTGCAAAGGATATTTCTAATGTCGTCACTGATGCT -GCTTCTGGTGTGGTTGATATTTTTCATGGTATTGATAAAGCTGTTGCCGA -TACTTGGAACAATTTCTGGAAAGACGGTAAAGCTGATGGTATTGGCTCTA -ATTTGTCTAGGAAATAACCGTCAGGATTGACACCCTCCCAATTGTATGTT -TTCATGCCTCCAAATCTTGGAGGCTTTTTTATGGTTCGTTCTTATTACCC -TTCTGAATGTCACGCTGATTATTTTGACTTTGAGCGTATCGAGGCTCTTA -AACCTGCTATTGAGGCTTGTGGCATTTCTACTCTTTCTCAATCCCCAATG -CTTGGCTTCCATAAGCAGATGGATAACCGCATCAAGCTCTTGGAAGAGAT -TCTGTCTTTTCGTATGCAGGGCGTTGAGTTCGATAATGGTGATATGTATG -TTGACGGCCATAAGGCTGCTTCTGACGTTCGTGATGAGTTTGTATCTGTT -ACTGAGAAGTTAATGGATGAATTGGCACAATGCTACAATGTGCTCCCCCA -ACTTGATATTAATAACACTATAGACCACCGCCCCGAAGGGGACGAAAAAT -GGTTTTTAGAGAACGAGAAGACGGTTACGCAGTTTTGCCGCAAGCTGGCT -GCTGAACGCCCTCTTAAGGATATTCGCGATGAGTATAATTACCCCAAAAA -GAAAGGTATTAAGGATGAGTGTTCAAGATTGCTGGAGGCCTCCACTATGA -AATCGCGTAGAGGCTTTaCTATTCAGCGTTTGATGAATGCAATGCGACAG -GCTCATGCTGATGGTTGGTTTATCGTTTTTGACACTCTCACGTTGGCTGA -CGACCGATTAGAGGCGTTTTATGATAATCCCAATGCTTTGCGTGACTATT -TTCGTGATATTGGTCGTATGGTTCTTGCTGCCGAGGGTCGCAAGGCTAAT -GATTCACACGCCGACTGCTATCAGTATTTTTGTGTGCCTGAGTATGGTAC -AGCTAATGGCCGTCTTCATTTCCATGCGGTGCAtTTTATGCGGACACTTC -CTACAGGTAGCGTTGACCCTAATTTTGGTCGTCGGGTACGCAATCGCCGC -CAGTTAAATAGCTTGCAAAATACGTGGCCTTATGGTTACAGTATGCCCAT -CGCAGTTCGCTACACGCAGGACGCTTTTTCACGTTCTGGTTGGTTGTGGC -CTGTTGATGCTAAAGGTGAGCCGCTTAAAGCTACCAGTTATATGGCTGTT -GGTTTCTATGTGGCTAAATACGTTAACAAAAAGTCAGATATGGACCTTGC -TGCTAAAGGTCTAGGAGCTAAAGAATGGAACAACTCACTAAAAACCAAGC -TGTCGCTACTTCCCAAGAAGCTGTTCAGAATCAGAATGAGCCGCAACTTC -GGGATGAAAATGCTCACAATGACAAATCTGTCCACGGAGTGCTTAATCCA -ACTTACCAAGCTGGGTTACGACGCGACGCCGTTCAACCAGATATTGAAGC -AGAACGCAAAAAGAGAGATGAGATTGAGGCTGGGAAAAGTTACTGTAGCC -GACGTTTTGGCGGCGCAACCTGTGACGACAAATCTGCTCAAATTTATGCG -CGCTTCGATAAAAATGATTGGCGTATCCAACCTGCA +>phiX174 +GAGTTTTATCGCTTCCATGACGCAGAAGTTAACACTTTCGGATATTTCTGATGAGTCGAAAAATTATCTT +GATAAAGCAGGAATTACTACTGCTTGTTTACGAATTAAATCGAAGTGGACTGCTGGCGGAAAATGAGAAA +ATTCGACCTATCCTTGCGCAGCTCGAGAAGCTCTTACTTTGCGACCTTTCGCCATCAACTAACGATTCTG +TCAAAAACTGACGCGTTGGATGAGGAGAAGTGGCTTAATATGCTTGGCACGTTCGTCAAGGACTGGTTTA +GATATGAGTCACATTTTGTTCATGGTAGAGATTCTCTTGTTGACATTTTAAAAGAGCGTGGATTACTATC +TGAGTCCGATGCTGTTCAACCACTAATAGGTAAGAAATCATGAGTCAAGTTACTGAACAATCCGTACGTT +TCCAGACCGCTTTGGCCTCTATTAAGCTCATTCAGGCTTCTGCCGTTTTGGATTTAACCGAAGATGATTT +CGATTTTCTGACGAGTAACAAAGTTTGGATTGCTACTGACCGCTCTCGTGCTCGTCGCTGCGTTGAGGCT +TGCGTTTATGGTACGCTGGACTTTGTGGGATACCCTCGCTTTCCTGCTCCTGTTGAGTTTATTGCTGCCG +TCATTGCTTATTATGTTCATCCCGTCAACATTCAAACGGCCTGTCTCATCATGGAAGGCGCTGAATTTAC +GGAAAACATTATTAATGGCGTCGAGCGTCCGGTTAAAGCCGCTGAATTGTTCGCGTTTACCTTGCGTGTA +CGCGCAGGAAACACTGACGTTCTTACTGACGCAGAAGAAAACGTGCGTCAAAAATTACGTGCAGAAGGAG +TGATGTAATGTCTAAAGGTAAAAAACGTTCTGGCGCTCGCCCTGGTCGTCCGCAGCCGTTGCGAGGTACT +AAAGGCAAGCGTAAAGGCGCTCGTCTTTGGTATGTAGGTGGTCAACAATTTTAATTGCAGGGGCTTCGGC +CCCTTACTTGAGGATAAATTATGTCTAATATTCAAACTGGCGCCGAGCGTATGCCGCATGACCTTTCCCA +TCTTGGCTTCCTTGCTGGTCAGATTGGTCGTCTTATTACCATTTCAACTACTCCGGTTATCGCTGGCGAC +TCCTTCGAGATGGACGCCGTTGGCGCTCTCCGTCTTTCTCCATTGCGTCGTGGCCTTGCTATTGACTCTA +CTGTAGACATTTTTACTTTTTATGTCCCTCATCGTCACGTTTATGGTGAACAGTGGATTAAGTTCATGAA +GGATGGTGTTAATGCCACTCCTCTCCCGACTGTTAACACTACTGGTTATATTGACCATGCCGCTTTTCTT +GGCACGATTAACCCTGATACCAATAAAATCCCTAAGCATTTGTTTCAGGGTTATTTGAATATCTATAACA +ACTATTTTAAAGCGCCGTGGATGCCTGACCGTACCGAGGCTAACCCTAATGAGCTTAATCAAGATGATGC +TCGTTATGGTTTCCGTTGCTGCCATCTCAAAAACATTTGGACTGCTCCGCTTCCTCCTGAGACTGAGCTT +TCTCGCCAAATGACGACTTCTACCACATCTATTGACATTATGGGTCTGCAAGCTGCTTATGCTAATTTGC +ATACTGACCAAGAACGTGATTACTTCATGCAGCGTTACCGTGATGTTATTTCTTCATTTGGAGGTAAAAC +CTCTTATGACGCTGACAACCGTCCTTTACTTGTCATGCGCTCTAATCTCTGGGCATCTGGCTATGATGTT +GATGGAACTGACCAAACGTCGTTAGGCCAGTTTTCTGGTCGTGTTCAACAGACCTATAAACATTCTGTGC +CGCGTTTCTTTGTTCCTGAGCATGGCACTATGTTTACTCTTGCGCTTGTTCGTTTTCCGCCTACTGCGAC +TAAAGAGATTCAGTACCTTAACGCTAAAGGTGCTTTGACTTATACCGATATTGCTGGCGACCCTGTTTTG +TATGGCAACTTGCCGCCGCGTGAAATTTCTATGAAGGATGTTTTCCGTTCTGGTGATTCGTCTAAGAAGT +TTAAGATTGCTGAGGGTCAGTGGTATCGTTATGCGCCTTCGTATGTTTCTCCTGCTTATCACCTTCTTGA +AGGCTTCCCATTCATTCAGGAACCGCCTTCTGGTGATTTGCAAGAACGCGTACTTATTCGCCACCATGAT +TATGACCAGTGTTTCCAGTCCGTTCAGTTGTTGCAGTGGAATAGTCAGGTTAAATTTAATGTGACCGTTT +ATCGCAATCTGCCGACCACTCGCGATTCAATCATGACTTCGTGATAAAAGATTGAGTGTGAGGTTATAAC +GCCGAAGCGGTAAAAATTTTAATTTTTGCCGCTGAGGGGTTGACCAAGCGAAGCGCGGTAGGTTTTCTGC +TTAGGAGTTTAATCATGTTTCAGACTTTTATTTCTCGCCATAATTCAAACTTTTTTTCTGATAAGCTGGT +TCTCACTTCTGTTACTCCAGCTTCTTCGGCACCTGTTTTACAGACACCTAAAGCTACATCGTCAACGTTA +TATTTTGATAGTTTGACGGTTAATGCTGGTAATGGTGGTTTTCTTCATTGCATTCAGATGGATACATCTG +TCAACGCCGCTAATCAGGTTGTTTCTGTTGGTGCTGATATTGCTTTTGATGCCGACCCTAAATTTTTTGC +CTGTTTGGTTCGCTTTGAGTCTTCTTCGGTTCCGACTACCCTCCCGACTGCCTATGATGTTTATCCTTTG +AATGGTCGCCATGATGGTGGTTATTATACCGTCAAGGACTGTGTGACTATTGACGTCCTTCCCCGTACGC +CGGGCAATAATGTTTATGTTGGTTTCATGGTTTGGTCTAACTTTACCGCTACTAAATGCCGCGGATTGGT +TTCGCTGAATCAGGTTATTAAAGAGATTATTTGTCTCCAGCCACTTAAGTGAGGTGATTTATGTTTGGTG +CTATTGCTGGCGGTATTGCTTCTGCTCTTGCTGGTGGCGCCATGTCTAAATTGTTTGGAGGCGGTCAAAA +AGCCGCCTCCGGTGGCATTCAAGGTGATGTGCTTGCTACCGATAACAATACTGTAGGCATGGGTGATGCT +GGTATTAAATCTGCCATTCAAGGCTCTAATGTTCCTAACCCTGATGAGGCCGCCCCTAGTTTTGTTTCTG +GTGCTATGGCTAAAGCTGGTAAAGGACTTCTTGAAGGTACGTTGCAGGCTGGCACTTCTGCCGTTTCTGA +TAAGTTGCTTGATTTGGTTGGACTTGGTGGCAAGTCTGCCGCTGATAAAGGAAAGGATACTCGTGATTAT +CTTGCTGCTGCATTTCCTGAGCTTAATGCTTGGGAGCGTGCTGGTGCTGATGCTTCCTCTGCTGGTATGG +TTGACGCCGGATTTGAGAATCAAAAAGAGCTTACTAAAATGCAACTGGACAATCAGAAAGAGATTGCCGA +GATGCAAAATGAGACTCAAAAAGAGATTGCTGGCATTCAGTCGGCGACTTCACGCCAGAATACGAAAGAC +CAGGTATATGCACAAAATGAGATGCTTGCTTATCAACAGAAGGAGTCTACTGCTCGCGTTGCGTCTATTA +TGGAAAACACCAATCTTTCCAAGCAACAGCAGGTTTCCGAGATTATGCGCCAAATGCTTACTCAAGCTCA +AACGGCTGGTCAGTATTTTACCAATGACCAAATCAAAGAAATGACTCGCAAGGTTAGTGCTGAGGTTGAC +TTAGTTCATCAGCAAACGCAGAATCAGCGGTATGGCTCTTCTCATATTGGCGCTACTGCAAAGGATATTT +CTAATGTCGTCACTGATGCTGCTTCTGGTGTGGTTGATATTTTTCATGGTATTGATAAAGCTGTTGCCGA +TACTTGGAACAATTTCTGGAAAGACGGTAAAGCTGATGGTATTGGCTCTAATTTGTCTAGGAAATAACCG +TCAGGATTGACACCCTCCCAATTGTATGTTTTCATGCCTCCAAATCTTGGAGGCTTTTTTATGGTTCGTT +CTTATTACCCTTCTGAATGTCACGCTGATTATTTTGACTTTGAGCGTATCGAGGCTCTTAAACCTGCTAT +TGAGGCTTGTGGCATTTCTACTCTTTCTCAATCCCCAATGCTTGGCTTCCATAAGCAGATGGATAACCGC +ATCAAGCTCTTGGAAGAGATTCTGTCTTTTCGTATGCAGGGCGTTGAGTTCGATAATGGTGATATGTATG +TTGACGGCCATAAGGCTGCTTCTGACGTTCGTGATGAGTTTGTATCTGTTACTGAGAAGTTAATGGATGA +ATTGGCACAATGCTACAATGTGCTCCCCCAACTTGATATTAATAACACTATAGACCACCGCCCCGAAGGG +GACGAAAAATGGTTTTTAGAGAACGAGAAGACGGTTACGCAGTTTTGCCGCAAGCTGGCTGCTGAACGCC +CTCTTAAGGATATTCGCGATGAGTATAATTACCCCAAAAAGAAAGGTATTAAGGATGAGTGTTCAAGATT +GCTGGAGGCCTCCACTATGAAATCGCGTAGAGGCTTTACTATTCAGCGTTTGATGAATGCAATGCGACAG +GCTCATGCTGATGGTTGGTTTATCGTTTTTGACACTCTCACGTTGGCTGACGACCGATTAGAGGCGTTTT +ATGATAATCCCAATGCTTTGCGTGACTATTTTCGTGATATTGGTCGTATGGTTCTTGCTGCCGAGGGTCG +CAAGGCTAATGATTCACACGCCGACTGCTATCAGTATTTTTGTGTGCCTGAGTATGGTACAGCTAATGGC +CGTCTTCATTTCCATGCGGTGCATTTTATGCGGACACTTCCTACAGGTAGCGTTGACCCTAATTTTGGTC +GTCGGGTACGCAATCGCCGCCAGTTAAATAGCTTGCAAAATACGTGGCCTTATGGTTACAGTATGCCCAT +CGCAGTTCGCTACACGCAGGACGCTTTTTCACGTTCTGGTTGGTTGTGGCCTGTTGATGCTAAAGGTGAG +CCGCTTAAAGCTACCAGTTATATGGCTGTTGGTTTCTATGTGGCTAAATACGTTAACAAAAAGTCAGATA +TGGACCTTGCTGCTAAAGGTCTAGGAGCTAAAGAATGGAACAACTCACTAAAAACCAAGCTGTCGCTACT +TCCCAAGAAGCTGTTCAGAATCAGAATGAGCCGCAACTTCGGGATGAAAATGCTCACAATGACAAATCTG +TCCACGGAGTGCTTAATCCAACTTACCAAGCTGGGTTACGACGCGACGCCGTTCAACCAGATATTGAAGC +AGAACGCAAAAAGAGAGATGAGATTGAGGCTGGGAAAAGTTACTGTAGCCGACGTTTTGGCGGCGCAACC +TGTGACGACAAATCTGCTCAAATTTATGCGCGCTTCGATAAAAATGATTGGCGTATCCAACCTGCA + diff --git a/tool-data/blastdb.loc.sample b/tool-data/blastdb.loc.sample index 3405b9defd5..5f33d7b138a 100644 --- a/tool-data/blastdb.loc.sample +++ b/tool-data/blastdb.loc.sample @@ -1,7 +1,8 @@ #This is a sample file distributed with Galaxy that is used to define a -#list of nucelotide BLAST databases, using two columns tab separated: +#list of nucleotide BLAST databases, using three columns tab separated +#(longer whitespace are TAB characters): # -# +# # #The captions typically contain spaces and might end with the build date. #It is important that the actual database name does not have a space in it, @@ -11,7 +12,7 @@ #is /depot/data2/galaxy/blastdb/nt/nt.chunk, then the blastdb.loc entry #would look like this: # -#nt 02 Dec 2009 /depot/data2/galaxy/blastdb/nt/nt.chunk +#nt_02_Dec_2009 nt 02 Dec 2009 /depot/data2/galaxy/blastdb/nt/nt.chunk # #and your /depot/data2/galaxy/blastdb/nt directory would contain all of #your "base names" (e.g.): @@ -24,9 +25,14 @@ #Your blastdb.loc file should include an entry per line for each "base name" #you have stored. For example: # -#nt 02 Dec 2009 /depot/data2/galaxy/blastdb/nt/nt.chunk -#wgs 30 Nov 2009 /depot/data2/galaxy/blastdb/wgs/wgs.chunk -#test 20 Sep 2008 /depot/data2/galaxy/blastdb/test/test +#nt_02_Dec_2009 nt 02 Dec 2009 /depot/data2/galaxy/blastdb/nt/nt.chunk +#wgs_30_Nov_2009 wgs 30 Nov 2009 /depot/data2/galaxy/blastdb/wgs/wgs.chunk +#test_20_Sep_2008 test 20 Sep 2008 /depot/data2/galaxy/blastdb/test/test #...etc... # #See also blastdb_p.loc which is for any protein BLAST database. +# +#Note that for backwards compatibility with workflows, the unique ID of +#an entry must be the path that was in the original loc file, because that +#is the value stored in the workflow for that parameter. +# diff --git a/tool-data/blastdb_p.loc.sample b/tool-data/blastdb_p.loc.sample index 161a244cc54..5fc4b8e38f9 100644 --- a/tool-data/blastdb_p.loc.sample +++ b/tool-data/blastdb_p.loc.sample @@ -1,12 +1,27 @@ #This is a sample file distributed with Galaxy that is used to define a -#list of protein BLAST databases, using two columns tab separated: +#list of protein BLAST databases, using three columns tab separated +#(longer whitespace are TAB characters): # -# +# # -#For example: +#The captions typically contain spaces and might end with the build date. +#It is important that the actual database name does not have a space in it, +#and that the first tab that appears in the line is right before the path. # -#NCBI NR (non redundant) /data/blastdb/nr +#So, for example, if your database is NR and the path to your base name +#is /data/blastdb/nr, then the blastdb_p.loc entry would look like this: # -#where /data/blastdb/nr.* are the files making up the NR database. +#nr NCBI NR (non redundant) /data/blastdb/nr +# +#and your /data/blastdb directory would contain all of the files associated +#with the database, /data/blastdb/nr.*. +# +#Your blastdb_p.loc file should include an entry per line for each "base name" +#you have stored. For example: +# +#nr_05Jun2010 NCBI NR (non redundant) 05 Jun 2010 /data/blastdb/05Jun2010/nr +#nr_15Aug2010 NCBI NR (non redundant) 15 Aug 2010 /data/blastdb/15Aug2010/nr +#...etc... +# +#See also blastdb.loc which is for any nucleotide BLAST database. # -#See also the blastdb.loc file which is for any nucleotide databases. diff --git a/tool-data/bowtie_indices.loc.sample b/tool-data/bowtie_indices.loc.sample index a06ec87e648..091ea4d3b7e 100644 --- a/tool-data/bowtie_indices.loc.sample +++ b/tool-data/bowtie_indices.loc.sample @@ -1,29 +1,37 @@ #This is a sample file distributed with Galaxy that enables tools -#to use a directory of Bowtie indexed sequences data files. You will need -#to create these data files and then create a bowtie_indices.loc file -#similar to this one (store it in this directory) that points to -#the directories in which those files are stored. The bowtie_indices.loc -#file has this format (white space characters are TAB characters): +#to use a directory of Bowtie indexed sequences data files. You will +#need to create these data files and then create a bowtie_indices.loc +#file similar to this one (store it in this directory) that points to +#the directories in which those files are stored. The bowtie_indices.loc +#file has this format (longer white space characters are TAB characters): # -# +# # #So, for example, if you had hg18 indexed stored in #/depot/data2/galaxy/bowtie/hg18/, #then the bowtie_indices.loc entry would look like this: # -#hg18 /depot/data2/galaxy/bowtie/hg18/hg18 +#hg18 hg18 hg18 /depot/data2/galaxy/bowtie/hg18/hg18 # #and your /depot/data2/galaxy/bowtie/hg18/ directory #would contain hg18.*.ebwt files: # #-rw-r--r-- 1 james universe 830134 2005-09-13 10:12 hg18.1.ebwt #-rw-r--r-- 1 james universe 527388 2005-09-13 10:12 hg18.2.ebwt -#-rw-r--r-- 1 james universe 269808 2005-09-13 10:12 gh18.3.ebwt +#-rw-r--r-- 1 james universe 269808 2005-09-13 10:12 hg18.3.ebwt #...etc... # -#Your bowtie_indices.loc file should include an entry per line for -#each index set you have stored. The "file" in the path does not actually -#exist, but it is the prefix for the actual index files. For example: +#Your bowtie_indices.loc file should include an entry per line for each +#index set you have stored. The "file" in the path does not actually +#exist, but it is the prefix for the actual index files. For example: +# +#hg18canon hg18 hg18 Canonical /depot/data2/galaxy/bowtie/hg18/hg18canon +#hg18full hg18 hg18 Full /depot/data2/galaxy/bowtie/hg18/hg18full +#/orig/path/hg19 hg19 hg19 /depot/data2/galaxy/bowtie/hg19/hg19 +#...etc... +# +#Note that for backwards compatibility with workflows, the unique ID of +#an entry must be the path that was in the original loc file, because that +#is the value stored in the workflow for that parameter. That is why the +#hg19 entry above looks odd. New genomes can be better-looking. # -#hg18 /depot/data2/galaxy/bowtie/hg18/hg18 -#hg19 /depot/data2/galaxy/bowtie/hg19/hg19 diff --git a/tool-data/bowtie_indices_color.loc.sample b/tool-data/bowtie_indices_color.loc.sample index 69cb0d74590..091ea4d3b7e 100644 --- a/tool-data/bowtie_indices_color.loc.sample +++ b/tool-data/bowtie_indices_color.loc.sample @@ -1,31 +1,37 @@ #This is a sample file distributed with Galaxy that enables tools -#to use a directory of colorspace Bowtie indexed sequences data files. -#You will need to create these data files and then create a -#bowtie_indices_color.loc file similar to this one (store it in this -#directory) that points to the directories in which those files are -#stored. The bowtie_indices_color.loc file has this format (white -#space characters are TAB characters): +#to use a directory of Bowtie indexed sequences data files. You will +#need to create these data files and then create a bowtie_indices.loc +#file similar to this one (store it in this directory) that points to +#the directories in which those files are stored. The bowtie_indices.loc +#file has this format (longer white space characters are TAB characters): # -# +# # #So, for example, if you had hg18 indexed stored in #/depot/data2/galaxy/bowtie/hg18/, -#then the bowtie_indices_color.loc entry would look like this: +#then the bowtie_indices.loc entry would look like this: # -#hg18 /depot/data2/galaxy/bowtie/hg18/hg18 +#hg18 hg18 hg18 /depot/data2/galaxy/bowtie/hg18/hg18 # #and your /depot/data2/galaxy/bowtie/hg18/ directory #would contain hg18.*.ebwt files: # #-rw-r--r-- 1 james universe 830134 2005-09-13 10:12 hg18.1.ebwt #-rw-r--r-- 1 james universe 527388 2005-09-13 10:12 hg18.2.ebwt -#-rw-r--r-- 1 james universe 269808 2005-09-13 10:12 gh18.3.ebwt +#-rw-r--r-- 1 james universe 269808 2005-09-13 10:12 hg18.3.ebwt #...etc... # -#Your bowtie_indices_color.loc file should include an entry per line -#for each index set you have stored. The "file" in the path does not -#actually exist, but it is the prefix for the actual index files. For -#example: +#Your bowtie_indices.loc file should include an entry per line for each +#index set you have stored. The "file" in the path does not actually +#exist, but it is the prefix for the actual index files. For example: +# +#hg18canon hg18 hg18 Canonical /depot/data2/galaxy/bowtie/hg18/hg18canon +#hg18full hg18 hg18 Full /depot/data2/galaxy/bowtie/hg18/hg18full +#/orig/path/hg19 hg19 hg19 /depot/data2/galaxy/bowtie/hg19/hg19 +#...etc... +# +#Note that for backwards compatibility with workflows, the unique ID of +#an entry must be the path that was in the original loc file, because that +#is the value stored in the workflow for that parameter. That is why the +#hg19 entry above looks odd. New genomes can be better-looking. # -#hg18 /depot/data2/galaxy/bowtie/hg18/hg18 -#hg19 /depot/data2/galaxy/bowtie/hg19/hg19 diff --git a/tool-data/bwa_index.loc.sample b/tool-data/bwa_index.loc.sample index 5500d8460fe..58fa49d1108 100644 --- a/tool-data/bwa_index.loc.sample +++ b/tool-data/bwa_index.loc.sample @@ -1,17 +1,17 @@ #This is a sample file distributed with Galaxy that enables tools -#to use a directory of BWA indexed sequences data files. You will need -#to create these data files and then create a bwa_index.loc file -#similar to this one (store it in this directory) that points to -#the directories in which those files are stored. The bwa_index.loc -#file has this format (white space characters are TAB characters): +#to use a directory of BWA indexed sequences data files. You will need +#to create these data files and then create a bwa_index.loc file +#similar to this one (store it in this directory) that points to +#the directories in which those files are stored. The bwa_index.loc +#file has this format (longer white space characters are TAB characters): # -# +# # #So, for example, if you had phiX indexed stored in #/depot/data2/galaxy/phiX/base/, #then the bwa_index.loc entry would look like this: # -#phiX /depot/data2/galaxy/phiX/base/phiX.fa +#phiX174 phiX phiX Pretty /depot/data2/galaxy/phiX/base/phiX.fa # #and your /depot/data2/galaxy/phiX/base/ directory #would contain phiX.fa.* files: @@ -22,8 +22,17 @@ #...etc... # #Your bwa_index.loc file should include an entry per line for each -#index set you have stored. The "file" in the path does not actually +#index set you have stored. The "file" in the path does not actually #exist, but it is the prefix for the actual index files. For example: # -#phiX /depot/data2/galaxy/phiX/base/phiX.fa -#hg18 /depot/data2/galaxy/hg18/base/hg18.fa +#phiX174 phiX phiX174 /depot/data2/galaxy/phiX/base/phiX.fa +#hg18canon hg18 hg18 Canonical /depot/data2/galaxy/hg18/base/hg18canon.fa +#hg18full hg18 hg18 Full /depot/data2/galaxy/hg18/base/hg18full.fa +#/orig/path/hg19.fa hg19 hg19 /depot/data2/galaxy/hg19/base/hg19.fa +#...etc... +# +#Note that for backwards compatibility with workflows, the unique ID of +#an entry must be the path that was in the original loc file, because that +#is the value stored in the workflow for that parameter. That is why the +#hg19 entry above looks odd. New genomes can be better-looking. +# diff --git a/tool-data/lastz_seqs.loc.sample b/tool-data/lastz_seqs.loc.sample index 75763949023..def67ec684e 100644 --- a/tool-data/lastz_seqs.loc.sample +++ b/tool-data/lastz_seqs.loc.sample @@ -1,17 +1,17 @@ #This is a sample file distributed with Galaxy that enables tools -#to use a directory of 2bit genome files for use with Lastz. You will -#need to supply these files and then create a lastz_seqs.loc file -#similar to this one (store it in this directory) that points to -#the directories in which those files are stored. The lastz_seqs.loc +#to use a directory of 2bit genome files for use with Lastz. You will +#need to supply these files and then create a lastz_seqs.loc file +#similar to this one (store it in this directory) that points to +#the directories in which those files are stored. The lastz_seqs.loc #file has this format (white space characters are TAB characters): # -# +# # #So, for example, if your lastz_seqs.loc began like this: # -#hg18 /depot/data2/galaxy/twobit/hg18.2bit -#hg19 /depot/data2/galaxy/twobit/hg19.2bit -#mm9 /depot/data2/galaxy/twobit/mm9.2bit +#hg18 Human (Homo sapiens): hg18 /depot/data2/galaxy/twobit/hg18.2bit +#hg19 Human (Homo sapiens): hg19 /depot/data2/galaxy/twobit/hg19.2bit +#mm9 Mouse (Mus musculus): mm9 /depot/data2/galaxy/twobit/mm9.2bit # #then your /depot/data2/galaxy/twobit/ directory #would need to contain the following 2bit files: @@ -22,4 +22,9 @@ # #Your lastz_seqs.loc file should include an entry per line for #each file you have stored that you want to be available. Note that -#your files should all have the extension '2bit'. \ No newline at end of file +#your files should all have the extension '2bit'. +# +#Note that for backwards compatibility with workflows, the unique ID of +#an entry must be the path that was in the original loc file, because that +#is the value stored in the workflow for that parameter. +# diff --git a/tool-data/perm_base_index.loc.sample b/tool-data/perm_base_index.loc.sample index 94b228b5e34..fddaa86de8c 100644 --- a/tool-data/perm_base_index.loc.sample +++ b/tool-data/perm_base_index.loc.sample @@ -3,9 +3,9 @@ #to create these data files and then create a perm_base_index.loc file #similar to this one (store it in this directory) that points to #the directories in which those files are stored. The perm_base_index.loc -#file has this format (white space characters are TAB characters): +#file has this format (longer white space characters are TAB characters): # -# +# # #Because each PerM index is built with a specific seed and a specific read #length, this needs to be specified so the user can choose the appropriate @@ -13,7 +13,7 @@ #50, and stored in /depot/data/galaxy/phiX/perm_index/, #then the perm_base_index.loc entry would look something like this: # -#phiX_F3_50 /depot/data/galaxy/phiX/perm_index/phiX_base_F3_50.index +#phiX_F3_50 phiX: seed=F3, read length=50 /depot/data/galaxy/phiX/perm_index/phiX_base_F3_50.index # #and your /depot/data/galaxy/phiX/perm_index/ directory #would contain the file phiX_base_F3_50.index: @@ -21,7 +21,8 @@ #Your perm_base_index.loc file should include an entry per line for each #index set you have stored. For example: # -#phiX_F3_50 /depot/data/galaxy/phiX/perm_index/phiX_base_F3_50.index -#phiX_F4_50 /depot/data/galaxy/phiX/perm_index/phiX_base_F3_50.index -#hg19_F3_50 /depot/data/galaxy/hg19/perm_index/hg19_base_F3_50.index -#hg19_F4_50 /depot/data/galaxy/hg19/perm_index/hg19_base_F3_50.index +#phiX_F3_50 /depot/data/galaxy/phiX/perm_index/phiX_base_F3_50.index +#phiX_F4_50 /depot/data/galaxy/phiX/perm_index/phiX_base_F3_50.index +#hg19_F3_50 /depot/data/galaxy/hg19/perm_index/hg19_base_F3_50.index +#hg19_F4_50 /depot/data/galaxy/hg19/perm_index/hg19_base_F3_50.index +# diff --git a/tool-data/perm_color_index.loc.sample b/tool-data/perm_color_index.loc.sample index 2f45b4bca77..1ef6c14d890 100644 --- a/tool-data/perm_color_index.loc.sample +++ b/tool-data/perm_color_index.loc.sample @@ -5,7 +5,7 @@ #the directories in which those files are stored. The perm_color_index.loc #file has this format (white space characters are TAB characters): # -# +# # #Because each PerM index is built with a specific seed and a specific read #length, this needs to be specified so the user can choose the appropriate @@ -13,7 +13,7 @@ #50, and stored in /depot/data/galaxy/phiX/perm_index/, #then the perm_color_index.loc entry would look something like this: # -#phiX_F3_50 /depot/data/galaxy/phiX/perm_index/phiX_color_F3_50.index +#phiX_F3_50 phiX: seed=F3, read length=50 /depot/data/galaxy/phiX/perm_index/phiX_color_F3_50.index # #and your /depot/data/galaxy/phiX/perm_index/ directory #would contain the file phiX_color_F3_50.index: @@ -21,7 +21,8 @@ #Your perm_color_index.loc file should include an entry per line for each #index set you have stored. For example: # -#phiX_F3_50 /depot/data/galaxy/phiX/perm_index/phiX_color_F3_50.index -#phiX_F4_50 /depot/data/galaxy/phiX/perm_index/phiX_color_F3_50.index -#hg19_F3_50 /depot/data/galaxy/hg19/perm_index/hg19_color_F3_50.index -#hg19_F4_50 /depot/data/galaxy/hg19/perm_index/hg19_color_F3_50.index +#phiX_F3_50 /depot/data/galaxy/phiX/perm_index/phiX_color_F3_50.index +#phiX_F4_50 /depot/data/galaxy/phiX/perm_index/phiX_color_F3_50.index +#hg19_F3_50 /depot/data/galaxy/hg19/perm_index/hg19_color_F3_50.index +#hg19_F4_50 /depot/data/galaxy/hg19/perm_index/hg19_color_F3_50.index +# diff --git a/tool-data/srma_index.loc.sample b/tool-data/srma_index.loc.sample index 9c6bcca6d3e..ad8c0938462 100644 --- a/tool-data/srma_index.loc.sample +++ b/tool-data/srma_index.loc.sample @@ -3,15 +3,15 @@ #to create these data files and then create a srma_index.loc file #similar to this one (store it in this directory) that points to #the directories in which those files are stored. The srma_index.loc -#file has this format (white space is the TAB character): +#file has this format (longer white space is the TAB character): # -# +# # #So, for example, if you had hg18 indexed and stored in #/depot/data2/galaxy/srma/hg18/, #then the srma_index.loc entry would look like this: # -#hg18 /depot/data2/galaxy/srma/hg18/hg18.fa +#hg18 hg18 hg18 Pretty /depot/data2/galaxy/srma/hg18/hg18.fa # #and your /depot/data2/galaxy/srma/hg18/ directory #would contain the following three files: @@ -23,3 +23,4 @@ #created via Picard (http://picard.sourceforge.net). Note that #the dict file does not have the .fa extension although the #path list in the loc file does include it. +# diff --git a/tool_data_table_conf.xml.sample b/tool_data_table_conf.xml.sample index a08299bb45a..ad0e387926b 100644 --- a/tool_data_table_conf.xml.sample +++ b/tool_data_table_conf.xml.sample @@ -1,17 +1,37 @@ + + + value, dbkey, name, path + +
value, dbkey, formats, name, path
+ + + value, name, path + +
+ + + value, name, path + +
- - name, value +
+ value, dbkey, name, path
+ + + value, dbkey, name, path + +
- - name, value +
+ value, dbkey, name, path
@@ -24,4 +44,30 @@ value, dbkey, name, path + + + value, name, path + +
+ + + value, name, path + +
+ + + value, name, path + +
+ + + value, dbkey, name, path + +
+ +
diff --git a/tools/metag_tools/megablast_wrapper.py b/tools/metag_tools/megablast_wrapper.py index 34a57894c8a..68060a87c59 100644 --- a/tools/metag_tools/megablast_wrapper.py +++ b/tools/metag_tools/megablast_wrapper.py @@ -29,15 +29,12 @@ def stop_err( msg ): def __main__(): #Parse Command Line options, args = doc_optparse.parse( __doc__ ) - - db_build = options.db_build query_filename = options.input.strip() output_filename = options.output.strip() mega_word_size = options.word_size # -W mega_iden_cutoff = options.identity_cutoff # -p mega_evalue_cutoff = options.eval_cutoff # -e mega_temp_output = tempfile.NamedTemporaryFile().name - mega_filter = options.filter_query # -F GALAXY_DATA_INDEX_DIR = options.index_dir DB_LOC = "%s/blastdb.loc" % GALAXY_DATA_INDEX_DIR @@ -47,30 +44,20 @@ def __main__(): except: stop_err( 'Invalid value for word size' ) try: - float(mega_iden_cutoff) + float( mega_iden_cutoff ) except: stop_err( 'Invalid value for identity cut-off' ) try: - float(mega_evalue_cutoff) + float( mega_evalue_cutoff ) except: stop_err( 'Invalid value for Expectation value' ) - # prepare the database - db = {} - for i, line in enumerate( file( DB_LOC ) ): - line = line.rstrip( '\r\n' ) - if not line or line.startswith( '#' ): - continue - fields = line.split( '\t' ) - db[ fields[0] ] = fields[1] + if not os.path.exists( os.path.split( options.db_build )[0] ): + stop_err( 'Cannot locate the target database directory. Please check your location file.' ) - if not db.has_key( db_build ): - stop_err( 'Cannot locate the target database. Please check your location file.' ) - - # arguments for megablast - chunk = db[ ( db_build ) ] - megablast_command = "megablast -d %s -i %s -o %s -m 8 -a 8 -W %s -p %s -e %s -F %s > /dev/null " \ - % ( chunk, query_filename, mega_temp_output, mega_word_size, mega_iden_cutoff, mega_evalue_cutoff, mega_filter ) + # arguments for megablast + megablast_command = "megablast -d %s -i %s -o %s -m 8 -a 8 -W %s -p %s -e %s -F %s > /dev/null" \ + % ( options.db_build, query_filename, mega_temp_output, mega_word_size, mega_iden_cutoff, mega_evalue_cutoff, options.filter_query ) print megablast_command diff --git a/tools/metag_tools/megablast_wrapper.xml b/tools/metag_tools/megablast_wrapper.xml index ec2a654b60c..92092e8d0a6 100644 --- a/tools/metag_tools/megablast_wrapper.xml +++ b/tools/metag_tools/megablast_wrapper.xml @@ -1,31 +1,28 @@ - + compare short reads against htgs, nt, and wgs databases - megablast_wrapper.py - --db_build="$source_select" - --input=$input_query - --word_size=$word_size - --identity_cutoff=$iden_cutoff - --eval_cutoff=$evalue_cutoff - --filter_query=$filter_query - --index_dir=${GALAXY_DATA_INDEX_DIR} - --output=$output1 + megablast_wrapper.py + --db_build="${ filter( lambda x: str( x[0] ) == str( $source_select ), $__app__.tool_data_tables[ 'blastdb' ].get_fields() )[0][-1] }" + --input=$input_query + --word_size=$word_size + --identity_cutoff=$iden_cutoff + --eval_cutoff=$evalue_cutoff + --filter_query=$filter_query + --index_dir=${GALAXY_DATA_INDEX_DIR} + --output=$output1 - - - - + - + - - - + + + @@ -40,7 +37,7 @@ - + diff --git a/tools/ncbi_blast_plus/ncbi_blastn_wrapper.xml b/tools/ncbi_blast_plus/ncbi_blastn_wrapper.xml index 33141688f3a..6e71809176b 100644 --- a/tools/ncbi_blast_plus/ncbi_blastn_wrapper.xml +++ b/tools/ncbi_blast_plus/ncbi_blastn_wrapper.xml @@ -1,4 +1,4 @@ - + Search nucleotide database with nucleotide query sequence(s) ## The command is a Cheetah template which allows some Python based syntax. @@ -36,9 +36,10 @@ $adv_opts.ungapped + - - + + diff --git a/tools/ncbi_blast_plus/ncbi_blastp_wrapper.xml b/tools/ncbi_blast_plus/ncbi_blastp_wrapper.xml index f73ee45e1ac..6861edb6edd 100644 --- a/tools/ncbi_blast_plus/ncbi_blastp_wrapper.xml +++ b/tools/ncbi_blast_plus/ncbi_blastp_wrapper.xml @@ -1,4 +1,4 @@ - + Search protein database with protein query sequence(s) ## The command is a Cheetah template which allows some Python based syntax. @@ -37,9 +37,10 @@ $out_format + - - + + diff --git a/tools/ncbi_blast_plus/ncbi_blastx_wrapper.xml b/tools/ncbi_blast_plus/ncbi_blastx_wrapper.xml index 0e2c93afa27..81bdaaf2970 100644 --- a/tools/ncbi_blast_plus/ncbi_blastx_wrapper.xml +++ b/tools/ncbi_blast_plus/ncbi_blastx_wrapper.xml @@ -1,4 +1,4 @@ - + Search protein database with translated nucleotide query sequence(s) ## The command is a Cheetah template which allows some Python based syntax. @@ -36,9 +36,10 @@ $adv_opts.ungapped + - - + + diff --git a/tools/ncbi_blast_plus/ncbi_tblastn_wrapper.xml b/tools/ncbi_blast_plus/ncbi_tblastn_wrapper.xml index 17d6ebbae0c..1ddbd7c2d3f 100644 --- a/tools/ncbi_blast_plus/ncbi_tblastn_wrapper.xml +++ b/tools/ncbi_blast_plus/ncbi_tblastn_wrapper.xml @@ -1,4 +1,4 @@ - + Search translated nucleotide database with protein query sequence(s) ## The command is a Cheetah template which allows some Python based syntax. @@ -36,9 +36,10 @@ $out_format + - - + + diff --git a/tools/ncbi_blast_plus/ncbi_tblastx_wrapper.xml b/tools/ncbi_blast_plus/ncbi_tblastx_wrapper.xml index 6b20733e65c..66f2ff3a499 100644 --- a/tools/ncbi_blast_plus/ncbi_tblastx_wrapper.xml +++ b/tools/ncbi_blast_plus/ncbi_tblastx_wrapper.xml @@ -1,4 +1,4 @@ - + Search translated nucleotide database with translated nucleotide query sequence(s) ## The command is a Cheetah template which allows some Python based syntax. @@ -35,9 +35,10 @@ $out_format + - - + + diff --git a/tools/sr_mapping/PerM.xml b/tools/sr_mapping/PerM.xml index 7e6e0da4e38..601bda39a06 100644 --- a/tools/sr_mapping/PerM.xml +++ b/tools/sr_mapping/PerM.xml @@ -1,49 +1,55 @@ - + for SOLiD and Illumina perm -PerM -#if $s.sourceOfRef.refSource == "history": - $s.sourceOfRef.ref -#else: - $s.sourceOfRef.index -#end if -#if $s.mate.singleOrPairs == "single": - $s.mate.reads -#else: - -1 $s.mate.reads1 -2 $s.mate.reads2 - -U $s.mate.upperbound - -L $s.mate.lowerbound - $s.mate.excludeAmbiguousPairs -#end if -#if $s.space == "color": - --readFormat "csfastq" -#else: - --readFormat "fastq" -#end if -#if $int($str($valAlign)) >= 0: - -v $valAlign -#end if -#if $align.options == "full": - --seed $align.seed - -$align.alignments - #if $str($align.delimiter) != "None": - --delimiter $align.delimiter - #end if - -T $align.sTrimL - $align.includeReadsWN - $align.statsOnly - $align.ignoreQS -#end if -#if $str($bUnmappedRead) == "true" and $s.space == "color": - -u $unmappedReadOutCS -#elif $str($bUnmappedRead) == "true" and $s.space == "base": - -u $unmappedReadOut -#end if --o $output --outputFormat sam --noSamHeader | tr '\r' '\n' | tr -cd "[:print:]\t\n " | grep "Reads\|Sub0\|Pairs\|single" | sed 's/.*Reads:,//' | sed 's/\/.*dat,_ Sub0/Sub0/' + PerM + #if $s.sourceOfRef.refSource == "history" + $s.sourceOfRef.ref + #else + #if $s.space == "color" + "${ filter( lambda x: str( x[0] ) == str( $s.sourceOfRef.index ), $__app__.tool_data_tables[ 'perm_color_indexes' ].get_fields() )[0][-1] }" + #elif $s.space == "base" + "${ filter( lambda x: str( x[0] ) == str( $s.sourceOfRef.index ), $__app__.tool_data_tables[ 'perm_base_indexes' ].get_fields() )[0][-1] }" + #end if + #end if + #if $s.mate.singleOrPairs == "single": + $s.mate.reads + #else: + -1 $s.mate.reads1 -2 $s.mate.reads2 + -U $s.mate.upperbound + -L $s.mate.lowerbound + $s.mate.excludeAmbiguousPairs + #end if + #if $s.space == "color": + --readFormat "csfastq" + #else: + --readFormat "fastq" + #end if + #if $int($str($valAlign)) >= 0 + -v $valAlign + #end if + #if $align.options == "full": + --seed $align.seed + -$align.alignments + #if $str($align.delimiter) != "None" + --delimiter $align.delimiter + #end if + -T $align.sTrimL + $align.includeReadsWN + $align.statsOnly + $align.ignoreQS + #end if + #if $str($bUnmappedRead) == "true" and $s.space == "color" + -u $unmappedReadOutCS + #elif $str($bUnmappedRead) == "true" and $s.space == "base" + -u $unmappedReadOut + #end if + -o $output + --outputFormat sam + --noSamHeader | tr '\r' '\n' | tr -cd "[:print:]\t\n " | grep "Reads\|Sub0\|Pairs\|single" | sed 's/.*Reads:,//' | sed 's/\/.*dat,_ Sub0/Sub0/' @@ -59,10 +65,7 @@ PerM - - - - + @@ -94,10 +97,7 @@ PerM - - - - + @@ -148,7 +148,7 @@ PerM - + @@ -170,8 +170,7 @@ PerM @@ -186,7 +185,7 @@ PerM - + @@ -198,7 +197,7 @@ PerM @@ -215,7 +214,7 @@ PerM @@ -231,14 +230,12 @@ PerM - + diff --git a/tools/sr_mapping/bowtie_color_wrapper.xml b/tools/sr_mapping/bowtie_color_wrapper.xml index 71ceb52749f..2a7c73d0afa 100644 --- a/tools/sr_mapping/bowtie_color_wrapper.xml +++ b/tools/sr_mapping/bowtie_color_wrapper.xml @@ -1,4 +1,4 @@ - + bowtie @@ -9,191 +9,105 @@ --suppressHeader=$suppressHeader --genomeSource=$refGenomeSource.genomeSource #if $refGenomeSource.genomeSource == "history": - #if $refGenomeSource.ownFile.extension.startswith( 'bowtie_' ): - --ref="${refGenomeSource.ownFile.extra_files_path}/${refGenomeSource.ownFile.metadata.base_name}" - --do_not_build_index - #else: - --ref=$refGenomeSource.ownFile - --indexSettings=$refGenomeSource.indexParams.indexSettings - #if $refGenomeSource.indexParams.indexSettings == "indexFull": - --iautoB=$refGenomeSource.indexParams.autoBehavior.autoB - #if $refGenomeSource.indexParams.autoBehavior.autoB == "set": - --ipacked=$refGenomeSource.indexParams.autoBehavior.packed - --ibmax=$refGenomeSource.indexParams.autoBehavior.bmax - --ibmaxdivn=$refGenomeSource.indexParams.autoBehavior.bmaxdivn - --idcv=$refGenomeSource.indexParams.autoBehavior.dcv + ##index already exists + #if $refGenomeSource.ownFile.extension.startswith( 'bowtie_' ): + ##user previously built + --ref="${refGenomeSource.ownFile.extra_files_path}/${refGenomeSource.ownFile.metadata.base_name}" + --do_not_build_index #else: - --ipacked="None" - --ibmax="None" - --ibmaxdivn="None" - --idcv="None" + ##build index on the fly + --ref=$refGenomeSource.ownFile + --indexSettings=$refGenomeSource.indexParams.indexSettings + #if $refGenomeSource.indexParams.indexSettings == "indexFull": + --iautoB=$refGenomeSource.indexParams.autoBehavior.autoB + #if $refGenomeSource.indexParams.autoBehavior.autoB == "set": + --ipacked=$refGenomeSource.indexParams.autoBehavior.packed + --ibmax=$refGenomeSource.indexParams.autoBehavior.bmax + --ibmaxdivn=$refGenomeSource.indexParams.autoBehavior.bmaxdivn + --idcv=$refGenomeSource.indexParams.autoBehavior.dcv + #end if + --inodc=$refGenomeSource.indexParams.nodc + --inoref=$refGenomeSource.indexParams.noref + --ioffrate=$refGenomeSource.indexParams.offrate + --iftab=$refGenomeSource.indexParams.ftab + --intoa=$refGenomeSource.indexParams.ntoa + --iendian=$refGenomeSource.indexParams.endian + --iseed=$refGenomeSource.indexParams.seed + --icutoff=$refGenomeSource.indexParams.cutoff + #end if #end if - --inodc=$refGenomeSource.indexParams.nodc - --inoref=$refGenomeSource.indexParams.noref - --ioffrate=$refGenomeSource.indexParams.offrate - --iftab=$refGenomeSource.indexParams.ftab - --intoa=$refGenomeSource.indexParams.ntoa - --iendian=$refGenomeSource.indexParams.endian - --iseed=$refGenomeSource.indexParams.seed - --icutoff=$refGenomeSource.indexParams.cutoff - #else: - --iautoB="None" - --ipacked="None" - --ibmax="None" - --ibmaxdivn="None" - --idcv="None" - --inodc="None" - --inoref="None" - --ioffrate="None" - --iftab="None" - --intoa="None" - --iendian="None" - --iseed="None" - --icutoff="None" - #end if - #end if - #else: - --ref=$refGenomeSource.index - --indexSettings="None" - --iautoB="None" - --ipacked="None" - --ibmax="None" - --ibmaxdivn="None" - --idcv="None" - --inodc="None" - --inoref="None" - --ioffrate="None" - --iftab="None" - --intoa="None" - --iendian="None" - --iseed="None" - --icutoff="None" + #else + ##use pre-built index + --ref="${ filter( lambda x: str( x[0] ) == str( $refGenomeSource.index ), $__app__.tool_data_tables[ 'bowtie_indexes_color' ].get_fields() )[0][-1] }" #end if --paired=$singlePaired.sPaired #if $singlePaired.sPaired == "single": - --input1=$singlePaired.sInput1 - --input2="None" - --params=$singlePaired.sParams.sSettingsType - #if $singlePaired.sParams.sSettingsType == "full": - --skip=$singlePaired.sParams.sSkip - --alignLimit=$singlePaired.sParams.sAlignLimit - --trimH=$singlePaired.sParams.sTrimH - --trimL=$singlePaired.sParams.sTrimL - --mismatchSeed=$singlePaired.sParams.sMismatchSeed - --mismatchQual=$singlePaired.sParams.sMismatchQual - --seedLen=$singlePaired.sParams.sSeedLen - --rounding=$singlePaired.sParams.sRounding - --maqSoapAlign=$singlePaired.sParams.sMaqSoapAlign - --tryHard=$singlePaired.sParams.sTryHard - --valAlign=$singlePaired.sParams.sValAlign - --allValAligns=$singlePaired.sParams.sAllValAligns - --suppressAlign=$singlePaired.sParams.sSuppressAlign - --best=$singlePaired.sParams.sBestOption.sBest - #if $singlePaired.sParams.sBestOption.sBest == "doBest": - --maxBacktracks=$singlePaired.sParams.sBestOption.sdMaxBacktracks - --strata=$singlePaired.sParams.sBestOption.sdStrata - #else: - --maxBacktracks=$singlePaired.sParams.sBestOption.snMaxBacktracks - --strata="None" + --input1=$singlePaired.sInput1 + --params=$singlePaired.sParams.sSettingsType + #if $singlePaired.sParams.sSettingsType == "full": + --skip=$singlePaired.sParams.sSkip + --alignLimit=$singlePaired.sParams.sAlignLimit + --trimH=$singlePaired.sParams.sTrimH + --trimL=$singlePaired.sParams.sTrimL + --mismatchSeed=$singlePaired.sParams.sMismatchSeed + --mismatchQual=$singlePaired.sParams.sMismatchQual + --seedLen=$singlePaired.sParams.sSeedLen + --rounding=$singlePaired.sParams.sRounding + --maqSoapAlign=$singlePaired.sParams.sMaqSoapAlign + --tryHard=$singlePaired.sParams.sTryHard + --valAlign=$singlePaired.sParams.sValAlign + --allValAligns=$singlePaired.sParams.sAllValAligns + --suppressAlign=$singlePaired.sParams.sSuppressAlign + --best=$singlePaired.sParams.sBestOption.sBest + #if $singlePaired.sParams.sBestOption.sBest == "doBest": + --maxBacktracks=$singlePaired.sParams.sBestOption.sdMaxBacktracks + --strata=$singlePaired.sParams.sBestOption.sdStrata + #else: + --maxBacktracks=$singlePaired.sParams.sBestOption.snMaxBacktracks + #end if + --offrate=$singlePaired.sParams.sOffrate + --seed=$singlePaired.sParams.sSeed + --snpphred=$singlePaired.sParams.sSnpphred + --snpfrac=$singlePaired.sParams.sSnpfrac + --keepends=$singlePaired.sParams.sKeepends #end if - --offrate=$singlePaired.sParams.sOffrate - --seed=$singlePaired.sParams.sSeed - --snpphred=$singlePaired.sParams.sSnpphred - --snpfrac=$singlePaired.sParams.sSnpfrac - --keepends=$singlePaired.sParams.sKeepends - #else: - --skip="None" - --alignLimit="None" - --trimH="None" - --trimL="None" - --mismatchSeed="None" - --mismatchQual="None" - --seedLen="None" - --rounding="None" - --maqSoapAlign="None" - --tryHard="None" - --valAlign="None" - --allValAligns="None" - --suppressAlign="None" - --best="None" - --maxBacktracks="None" - --strata="None" - --offrate="None" - --seed="None" - --snpphred="None" - --snpfrac="None" - --keepends="None" - #end if - --minInsert="None" - --maxInsert="None" - --mateOrient="None" - --maxAlignAttempt="None" - --forwardAlign="None" - --reverseAlign="None" #else: - --input1=$singlePaired.pInput1 - --input2=$singlePaired.pInput2 - --maxInsert=$singlePaired.pMaxInsert - --mateOrient=$singlePaired.pMateOrient - --params=$singlePaired.pParams.pSettingsType - #if $singlePaired.pParams.pSettingsType == "full": - --skip=$singlePaired.pParams.pSkip - --alignLimit=$singlePaired.pParams.pAlignLimit - --trimH=$singlePaired.pParams.pTrimH - --trimL=$singlePaired.pParams.pTrimL - --mismatchSeed=$singlePaired.pParams.pMismatchSeed - --mismatchQual=$singlePaired.pParams.pMismatchQual - --seedLen=$singlePaired.pParams.pSeedLen - --rounding=$singlePaired.pParams.pRounding - --maqSoapAlign=$singlePaired.pParams.pMaqSoapAlign - --minInsert=$singlePaired.pParams.pMinInsert - --maxAlignAttempt=$singlePaired.pParams.pMaxAlignAttempt - --forwardAlign=$singlePaired.pParams.pForwardAlign - --reverseAlign=$singlePaired.pParams.pReverseAlign - --tryHard=$singlePaired.pParams.pTryHard - --valAlign=$singlePaired.pParams.pValAlign - --allValAligns=$singlePaired.pParams.pAllValAligns - --suppressAlign=$singlePaired.pParams.pSuppressAlign - --best=$singlePaired.pParams.pBestOption.pBest - #if $singlePaired.pParams.pBestOption.pBest == "doBest": - --maxBacktracks=$singlePaired.pParams.pBestOption.pdMaxBacktracks - --strata=$singlePaired.pParams.pBestOption.pdStrata - #else: - --maxBacktracks=$singlePaired.pParams.pBestOption.pnMaxBacktracks - --strata="None" + --input1=$singlePaired.pInput1 + --input2=$singlePaired.pInput2 + --maxInsert=$singlePaired.pMaxInsert + --mateOrient=$singlePaired.pMateOrient + --params=$singlePaired.pParams.pSettingsType + #if $singlePaired.pParams.pSettingsType == "full": + --skip=$singlePaired.pParams.pSkip + --alignLimit=$singlePaired.pParams.pAlignLimit + --trimH=$singlePaired.pParams.pTrimH + --trimL=$singlePaired.pParams.pTrimL + --mismatchSeed=$singlePaired.pParams.pMismatchSeed + --mismatchQual=$singlePaired.pParams.pMismatchQual + --seedLen=$singlePaired.pParams.pSeedLen + --rounding=$singlePaired.pParams.pRounding + --maqSoapAlign=$singlePaired.pParams.pMaqSoapAlign + --minInsert=$singlePaired.pParams.pMinInsert + --maxAlignAttempt=$singlePaired.pParams.pMaxAlignAttempt + --forwardAlign=$singlePaired.pParams.pForwardAlign + --reverseAlign=$singlePaired.pParams.pReverseAlign + --tryHard=$singlePaired.pParams.pTryHard + --valAlign=$singlePaired.pParams.pValAlign + --allValAligns=$singlePaired.pParams.pAllValAligns + --suppressAlign=$singlePaired.pParams.pSuppressAlign + --best=$singlePaired.pParams.pBestOption.pBest + #if $singlePaired.pParams.pBestOption.pBest == "doBest": + --maxBacktracks=$singlePaired.pParams.pBestOption.pdMaxBacktracks + --strata=$singlePaired.pParams.pBestOption.pdStrata + #else: + --maxBacktracks=$singlePaired.pParams.pBestOption.pnMaxBacktracks + #end if + --offrate=$singlePaired.pParams.pOffrate + --seed=$singlePaired.pParams.pSeed + --snpphred=$singlePaired.pParams.pSnpphred + --snpfrac=$singlePaired.pParams.pSnpfrac + --keepends=$singlePaired.pParams.pKeepends #end if - --offrate=$singlePaired.pParams.pOffrate - --seed=$singlePaired.pParams.pSeed - --snpphred=$singlePaired.pParams.pSnpphred - --snpfrac=$singlePaired.pParams.pSnpfrac - --keepends=$singlePaired.pParams.pKeepends - #else: - --skip="None" - --alignLimit="None" - --trimH="None" - --trimL="None" - --mismatchSeed="None" - --mismatchQual="None" - --seedLen="None" - --rounding="None" - --maqSoapAlign="None" - --minInsert="None" - --maxAlignAttempt="None" - --forwardAlign="None" - --reverseAlign="None" - --tryHard="None" - --valAlign="None" - --allValAligns="None" - --suppressAlign="None" - --best="None" - --maxBacktracks="None" - --strata="None" - --offrate="None" - --seed="None" - --snpphred="None" - --snpfrac="None" - --keepends="None" - #end if #end if @@ -204,10 +118,7 @@ - - - - + @@ -433,7 +344,8 @@ chrM_color needs to be the base location/name of the index files. --> - + + @@ -492,7 +404,8 @@ chrM_base is the index files' location/base name. --> - + + diff --git a/tools/sr_mapping/bowtie_wrapper.py b/tools/sr_mapping/bowtie_wrapper.py index a1d19271d97..5e02fbf686e 100644 --- a/tools/sr_mapping/bowtie_wrapper.py +++ b/tools/sr_mapping/bowtie_wrapper.py @@ -137,51 +137,51 @@ def __main__(): indexing_cmds = '%s' % colorspace else: try: - if options.iautoB != 'None' and options.iautoB == 'set': + if options.iautoB and options.iautoB == 'set': iautoB = '--noauto' else: iautoB = '' - if options. ipacked != 'None' and options.ipacked == 'packed': + if options. ipacked and options.ipacked == 'packed': ipacked = '--packed' else: ipacked = '' - if options.ibmax != 'None' and int( options.ibmax ) >= 1: + if options.ibmax and int( options.ibmax ) >= 1: ibmax = '--bmax %s' % options.ibmax else: ibmax = '' - if options.ibmaxdivn != 'None' and int( options.ibmaxdivn ) >= 0: + if options.ibmaxdivn and int( options.ibmaxdivn ) >= 0: ibmaxdivn = '--bmaxdivn %s' % options.ibmaxdivn else: ibmaxdivn = '' - if options.idcv != 'None' and int( options.idcv ) > 0: + if options.idcv and int( options.idcv ) > 0: idcv = '--dcv %s' % options.idcv else: idcv = '' - if options.inodc != 'None' and options.inodc == 'nodc': + if options.inodc and options.inodc == 'nodc': inodc = '--nodc' else: inodc = '' - if options.inoref != 'None' and options.inoref == 'noref': + if options.inoref and options.inoref == 'noref': inoref = '--noref' else: inoref = '' - if options.iftab != 'None' and int( options.iftab ) >= 0: + if options.iftab and int( options.iftab ) >= 0: iftab = '--ftabchars %s' % options.iftab else: iftab = '' - if options.intoa != 'None' and options.intoa == 'yes': + if options.intoa and options.intoa == 'yes': intoa = '--ntoa' else: intoa = '' - if options.iendian != 'None' and options.iendian == 'big': + if options.iendian and options.iendian == 'big': iendian = '--big' else: iendian = '--little' - if options.iseed != 'None' and int( options.iseed ) > 0: + if options.iseed and int( options.iseed ) > 0: iseed = '--seed %s' % options.iseed else: iseed = '' - if options.icutoff != 'None' and int( options.icutoff ) > 0: + if options.icutoff and int( options.icutoff ) > 0: icutoff = '--cutoff %s' % options.icutoff else: icutoff = '' @@ -233,11 +233,11 @@ def __main__(): suppressHeader = '--sam-nohead' else: suppressHeader = '' - if options.maxInsert != 'None' and int( options.maxInsert ) > 0: + if options.maxInsert and int( options.maxInsert ) > 0: maxInsert = '-X %s' % options.maxInsert else: maxInsert = '' - if options.mateOrient != 'None': + if options.mateOrient: mateOrient = '--%s' % options.mateOrient else: mateOrient = '' @@ -246,32 +246,32 @@ def __main__(): ( maxInsert, mateOrient, options.threads, suppressHeader, colorspace ) else: try: - if options.skip != 'None' and int( options.skip ) > 0: + if options.skip and int( options.skip ) > 0: skip = '-s %s' % options.skip else: skip = '' - if options.alignLimit != 'None' and int( options.alignLimit ) >= 0: + if options.alignLimit and int( options.alignLimit ) >= 0: alignLimit = '-u %s' % options.alignLimit else: alignLimit = '' - if options.trimH != 'None' and int( options.trimH ) > 0: + if options.trimH and int( options.trimH ) > 0: trimH = '-5 %s' % options.trimH else: trimH = '' - if options.trimL != 'None' and int( options.trimL ) > 0: + if options.trimL and int( options.trimL ) > 0: trimL = '-3 %s' % options.trimL else: trimL = '' - if options.mismatchSeed != 'None' and (options.mismatchSeed == '0' or options.mismatchSeed == '1' \ + if options.mismatchSeed and (options.mismatchSeed == '0' or options.mismatchSeed == '1' \ or options.mismatchSeed == '2' or options.mismatchSeed == '3'): mismatchSeed = '-n %s' % options.mismatchSeed else: mismatchSeed = '' - if options.mismatchQual != 'None' and int( options.mismatchQual ) >= 0: + if options.mismatchQual and int( options.mismatchQual ) >= 0: mismatchQual = '-e %s' % options.mismatchQual else: mismatchQual = '' - if options.seedLen != 'None' and int( options.seedLen ) >= 5: + if options.seedLen and int( options.seedLen ) >= 5: seedLen = '-l %s' % options.seedLen else: seedLen = '' @@ -283,11 +283,11 @@ def __main__(): maqSoapAlign = '-v %s' % options.maqSoapAlign else: maqSoapAlign = '' - if options.minInsert != 'None' and int( options.minInsert ) > 0: + if options.minInsert and int( options.minInsert ) > 0: minInsert = '-I %s' % options.minInsert else: minInsert = '' - if options.maxAlignAttempt != 'None' and int( options.maxAlignAttempt ) >= 0: + if options.maxAlignAttempt and int( options.maxAlignAttempt ) >= 0: maxAlignAttempt = '--pairtries %s' % options.maxAlignAttempt else: maxAlignAttempt = '' @@ -299,7 +299,7 @@ def __main__(): reverseAlign = '--norc' else: reverseAlign = '' - if options.maxBacktracks != 'None' and int( options.maxBacktracks ) > 0 and \ + if options.maxBacktracks and int( options.maxBacktracks ) > 0 and \ ( options.mismatchSeed == '2' or options.mismatchSeed == '3' ): maxBacktracks = '--maxbts %s' % options.maxBacktracks else: @@ -308,7 +308,7 @@ def __main__(): tryHard = '-y' else: tryHard = '' - if options.valAlign != 'None' and int( options.valAlign ) >= 0: + if options.valAlign and int( options.valAlign ) >= 0: valAlign = '-k %s' % options.valAlign else: valAlign = '' @@ -316,7 +316,7 @@ def __main__(): allValAligns = '-a' else: allValAligns = '' - if options.suppressAlign != 'None' and int( options.suppressAlign ) >= 0: + if options.suppressAlign and int( options.suppressAlign ) >= 0: suppressAlign = '-m %s' % options.suppressAlign else: suppressAlign = '' @@ -328,23 +328,23 @@ def __main__(): strata = '--strata' else: strata = '' - if options.offrate != 'None' and int( options.offrate ) >= 0: + if options.offrate and int( options.offrate ) >= 0: offrate = '-o %s' % options.offrate else: offrate = '' - if options.seed != 'None' and int( options.seed ) >= 0: + if options.seed and int( options.seed ) >= 0: seed = '--seed %s' % options.seed else: seed = '' - if options.snpphred != 'None' and int( options.snpphred ) >= 0: + if options.snpphred and int( options.snpphred ) >= 0: snpphred = '--snpphred %s' % options.snpphred else: snpphred = '' - if options.snpfrac != 'None' and float( options.snpfrac ) >= 0: + if options.snpfrac and float( options.snpfrac ) >= 0: snpfrac = '--snpfrac %s' % options.snpfrac else: snpfrac = '' - if options.keepends != 'None' and options.keepends == 'doKeepends': + if options.keepends and options.keepends == 'doKeepends': keepends = '--col-keepends' else: keepends = '' diff --git a/tools/sr_mapping/bowtie_wrapper.xml b/tools/sr_mapping/bowtie_wrapper.xml index a38ba0e802e..74d2ba82ef0 100644 --- a/tools/sr_mapping/bowtie_wrapper.xml +++ b/tools/sr_mapping/bowtie_wrapper.xml @@ -1,4 +1,4 @@ - + bowtie @@ -8,186 +8,100 @@ --output=$output --suppressHeader=$suppressHeader --genomeSource=$refGenomeSource.genomeSource - --snpphred="None" - --snpfrac="None" - --keepends="None" #if $refGenomeSource.genomeSource == "history": - #if $refGenomeSource.ownFile.extension.startswith( 'bowtie_' ): - --ref="${refGenomeSource.ownFile.extra_files_path}/${refGenomeSource.ownFile.metadata.base_name}" - --do_not_build_index - #else: - --ref=$refGenomeSource.ownFile - --indexSettings=$refGenomeSource.indexParams.indexSettings - #if $refGenomeSource.indexParams.indexSettings == "indexFull": - --iautoB=$refGenomeSource.indexParams.autoBehavior.autoB - #if $refGenomeSource.indexParams.autoBehavior.autoB == "set": - --ipacked=$refGenomeSource.indexParams.autoBehavior.packed - --ibmax=$refGenomeSource.indexParams.autoBehavior.bmax - --ibmaxdivn=$refGenomeSource.indexParams.autoBehavior.bmaxdivn - --idcv=$refGenomeSource.indexParams.autoBehavior.dcv + ##index already exists + #if $refGenomeSource.ownFile.extension.startswith( 'bowtie_' ): + ##user previously built + --ref="${refGenomeSource.ownFile.extra_files_path}/${refGenomeSource.ownFile.metadata.base_name}" + --do_not_build_index #else: - --ipacked="None" - --ibmax="None" - --ibmaxdivn="None" - --idcv="None" + ##build index on the fly + --ref=$refGenomeSource.ownFile + --indexSettings=$refGenomeSource.indexParams.indexSettings + #if $refGenomeSource.indexParams.indexSettings == "indexFull": + --iautoB=$refGenomeSource.indexParams.autoBehavior.autoB + #if $refGenomeSource.indexParams.autoBehavior.autoB == "set": + --ipacked=$refGenomeSource.indexParams.autoBehavior.packed + --ibmax=$refGenomeSource.indexParams.autoBehavior.bmax + --ibmaxdivn=$refGenomeSource.indexParams.autoBehavior.bmaxdivn + --idcv=$refGenomeSource.indexParams.autoBehavior.dcv + #end if + --inodc=$refGenomeSource.indexParams.nodc + --inoref=$refGenomeSource.indexParams.noref + --ioffrate=$refGenomeSource.indexParams.offrate + --iftab=$refGenomeSource.indexParams.ftab + --intoa=$refGenomeSource.indexParams.ntoa + --iendian=$refGenomeSource.indexParams.endian + --iseed=$refGenomeSource.indexParams.seed + --icutoff=$refGenomeSource.indexParams.cutoff + #end if #end if - --inodc=$refGenomeSource.indexParams.nodc - --inoref=$refGenomeSource.indexParams.noref - --ioffrate=$refGenomeSource.indexParams.offrate - --iftab=$refGenomeSource.indexParams.ftab - --intoa=$refGenomeSource.indexParams.ntoa - --iendian=$refGenomeSource.indexParams.endian - --iseed=$refGenomeSource.indexParams.seed - --icutoff=$refGenomeSource.indexParams.cutoff - #else: - --iautoB="None" - --ipacked="None" - --ibmax="None" - --ibmaxdivn="None" - --idcv="None" - --inodc="None" - --inoref="None" - --ioffrate="None" - --iftab="None" - --intoa="None" - --iendian="None" - --iseed="None" - --icutoff="None" - #end if - #end if - #else: - --ref=$refGenomeSource.index - --indexSettings="None" - --iautoB="None" - --ipacked="None" - --ibmax="None" - --ibmaxdivn="None" - --idcv="None" - --inodc="None" - --inoref="None" - --ioffrate="None" - --iftab="None" - --intoa="None" - --iendian="None" - --iseed="None" - --icutoff="None" + #else + ##use pre-built index + --ref="${ filter( lambda x: str( x[0] ) == str( $refGenomeSource.index ), $__app__.tool_data_tables[ 'bowtie_indexes' ].get_fields() )[0][-1] }" #end if --paired=$singlePaired.sPaired #if $singlePaired.sPaired == "single": - --input1=$singlePaired.sInput1 - --input2="None" - --params=$singlePaired.sParams.sSettingsType - #if $singlePaired.sParams.sSettingsType == "full": - --skip=$singlePaired.sParams.sSkip - --alignLimit=$singlePaired.sParams.sAlignLimit - --trimH=$singlePaired.sParams.sTrimH - --trimL=$singlePaired.sParams.sTrimL - --mismatchSeed=$singlePaired.sParams.sMismatchSeed - --mismatchQual=$singlePaired.sParams.sMismatchQual - --seedLen=$singlePaired.sParams.sSeedLen - --rounding=$singlePaired.sParams.sRounding - --maqSoapAlign=$singlePaired.sParams.sMaqSoapAlign - --tryHard=$singlePaired.sParams.sTryHard - --valAlign=$singlePaired.sParams.sValAlign - --allValAligns=$singlePaired.sParams.sAllValAligns - --suppressAlign=$singlePaired.sParams.sSuppressAlign - --best=$singlePaired.sParams.sBestOption.sBest - #if $singlePaired.sParams.sBestOption.sBest == "doBest": - --maxBacktracks=$singlePaired.sParams.sBestOption.sdMaxBacktracks - --strata=$singlePaired.sParams.sBestOption.sdStrata - #else: - --maxBacktracks=$singlePaired.sParams.sBestOption.snMaxBacktracks - --strata="None" + --input1=$singlePaired.sInput1 + --params=$singlePaired.sParams.sSettingsType + #if $singlePaired.sParams.sSettingsType == "full": + --skip=$singlePaired.sParams.sSkip + --alignLimit=$singlePaired.sParams.sAlignLimit + --trimH=$singlePaired.sParams.sTrimH + --trimL=$singlePaired.sParams.sTrimL + --mismatchSeed=$singlePaired.sParams.sMismatchSeed + --mismatchQual=$singlePaired.sParams.sMismatchQual + --seedLen=$singlePaired.sParams.sSeedLen + --rounding=$singlePaired.sParams.sRounding + --maqSoapAlign=$singlePaired.sParams.sMaqSoapAlign + --tryHard=$singlePaired.sParams.sTryHard + --valAlign=$singlePaired.sParams.sValAlign + --allValAligns=$singlePaired.sParams.sAllValAligns + --suppressAlign=$singlePaired.sParams.sSuppressAlign + --best=$singlePaired.sParams.sBestOption.sBest + #if $singlePaired.sParams.sBestOption.sBest == "doBest": + --maxBacktracks=$singlePaired.sParams.sBestOption.sdMaxBacktracks + --strata=$singlePaired.sParams.sBestOption.sdStrata + #else: + --maxBacktracks=$singlePaired.sParams.sBestOption.snMaxBacktracks + #end if + --offrate=$singlePaired.sParams.sOffrate + --seed=$singlePaired.sParams.sSeed #end if - --offrate=$singlePaired.sParams.sOffrate - --seed=$singlePaired.sParams.sSeed - #else: - --skip="None" - --alignLimit="None" - --trimH="None" - --trimL="None" - --mismatchSeed="None" - --mismatchQual="None" - --seedLen="None" - --rounding="None" - --maqSoapAlign="None" - --tryHard="None" - --valAlign="None" - --allValAligns="None" - --suppressAlign="None" - --best="None" - --maxBacktracks="None" - --strata="None" - --offrate="None" - --seed="None" - --snpphred="None" - --snpfrac="None" - --keepends="None" - #end if - --minInsert="None" - --maxInsert="None" - --mateOrient="None" - --maxAlignAttempt="None" - --forwardAlign="None" - --reverseAlign="None" #else: - --input1=$singlePaired.pInput1 - --input2=$singlePaired.pInput2 - --maxInsert=$singlePaired.pMaxInsert - --mateOrient=$singlePaired.pMateOrient - --params=$singlePaired.pParams.pSettingsType - #if $singlePaired.pParams.pSettingsType == "full": - --skip=$singlePaired.pParams.pSkip - --alignLimit=$singlePaired.pParams.pAlignLimit - --trimH=$singlePaired.pParams.pTrimH - --trimL=$singlePaired.pParams.pTrimL - --mismatchSeed=$singlePaired.pParams.pMismatchSeed - --mismatchQual=$singlePaired.pParams.pMismatchQual - --seedLen=$singlePaired.pParams.pSeedLen - --rounding=$singlePaired.pParams.pRounding - --maqSoapAlign=$singlePaired.pParams.pMaqSoapAlign - --minInsert=$singlePaired.pParams.pMinInsert - --maxAlignAttempt=$singlePaired.pParams.pMaxAlignAttempt - --forwardAlign=$singlePaired.pParams.pForwardAlign - --reverseAlign=$singlePaired.pParams.pReverseAlign - --tryHard=$singlePaired.pParams.pTryHard - --valAlign=$singlePaired.pParams.pValAlign - --allValAligns=$singlePaired.pParams.pAllValAligns - --suppressAlign=$singlePaired.pParams.pSuppressAlign - --best=$singlePaired.pParams.pBestOption.pBest - #if $singlePaired.pParams.pBestOption.pBest == "doBest": - --maxBacktracks=$singlePaired.pParams.pBestOption.pdMaxBacktracks - --strata=$singlePaired.pParams.pBestOption.pdStrata - #else: - --maxBacktracks=$singlePaired.pParams.pBestOption.pnMaxBacktracks - --strata="None" + --input1=$singlePaired.pInput1 + --input2=$singlePaired.pInput2 + --maxInsert=$singlePaired.pMaxInsert + --mateOrient=$singlePaired.pMateOrient + --params=$singlePaired.pParams.pSettingsType + #if $singlePaired.pParams.pSettingsType == "full": + --skip=$singlePaired.pParams.pSkip + --alignLimit=$singlePaired.pParams.pAlignLimit + --trimH=$singlePaired.pParams.pTrimH + --trimL=$singlePaired.pParams.pTrimL + --mismatchSeed=$singlePaired.pParams.pMismatchSeed + --mismatchQual=$singlePaired.pParams.pMismatchQual + --seedLen=$singlePaired.pParams.pSeedLen + --rounding=$singlePaired.pParams.pRounding + --maqSoapAlign=$singlePaired.pParams.pMaqSoapAlign + --minInsert=$singlePaired.pParams.pMinInsert + --maxAlignAttempt=$singlePaired.pParams.pMaxAlignAttempt + --forwardAlign=$singlePaired.pParams.pForwardAlign + --reverseAlign=$singlePaired.pParams.pReverseAlign + --tryHard=$singlePaired.pParams.pTryHard + --valAlign=$singlePaired.pParams.pValAlign + --allValAligns=$singlePaired.pParams.pAllValAligns + --suppressAlign=$singlePaired.pParams.pSuppressAlign + --best=$singlePaired.pParams.pBestOption.pBest + #if $singlePaired.pParams.pBestOption.pBest == "doBest": + --maxBacktracks=$singlePaired.pParams.pBestOption.pdMaxBacktracks + --strata=$singlePaired.pParams.pBestOption.pdStrata + #else: + --maxBacktracks=$singlePaired.pParams.pBestOption.pnMaxBacktracks + #end if + --offrate=$singlePaired.pParams.pOffrate + --seed=$singlePaired.pParams.pSeed #end if - --offrate=$singlePaired.pParams.pOffrate - --seed=$singlePaired.pParams.pSeed - #else: - --skip="None" - --alignLimit="None" - --trimH="None" - --trimL="None" - --mismatchSeed="None" - --mismatchQual="None" - --seedLen="None" - --rounding="None" - --maqSoapAlign="None" - --tryHard="None" - --valAlign="None" - --allValAligns="None" - --suppressAlign="None" - --best="None" - --maxBacktracks="None" - --strata="None" - --offrate="None" - --seed="None" - --minInsert="None" - --maxAlignAttempt="None" - --forwardAlign="None" - --reverseAlign="None" - #end if #end if @@ -199,12 +113,6 @@ - @@ -418,7 +326,8 @@ chrM_base needs to be the base location/name of the index files. --> - + + @@ -475,7 +384,8 @@ chrM_base is the index files' location/base name. --> - + + diff --git a/tools/sr_mapping/bwa_wrapper.py b/tools/sr_mapping/bwa_wrapper.py index 89acfeb2984..246ba8705c4 100644 --- a/tools/sr_mapping/bwa_wrapper.py +++ b/tools/sr_mapping/bwa_wrapper.py @@ -30,8 +30,9 @@ usage: bwa_wrapper.py [options] -T, --outputTopN=T: Output top specified hits -S, --maxInsertSize=S: Maximum insert size for a read pair to be considered mapped good -P, --maxOccurPairing=P: Maximum occurrences of a read for pairings - -D, --dbkey=D: Dbkey for reference genome -H, --suppressHeader=h: Suppress header + -D, --dbkey=D: Dbkey for reference genome + -X, --do_not_build_index: Flag to specify that provided file is already indexed and to just use 'as is' """ import optparse, os, shutil, subprocess, sys, tempfile @@ -68,13 +69,14 @@ def __main__(): parser.add_option( '-S', '--maxInsertSize', dest='maxInsertSize', help='Maximum insert size for a read pair to be considered mapped good' ) parser.add_option( '-P', '--maxOccurPairing', dest='maxOccurPairing', help='Maximum occurrences of a read for pairings' ) parser.add_option( '-D', '--dbkey', dest='dbkey', help='Dbkey for reference genome' ) + parser.add_option( '-X', '--do_not_build_index', dest='do_not_build_index', help="Don't build index" ) parser.add_option( '-H', '--suppressHeader', dest='suppressHeader', help='Suppress header' ) (options, args) = parser.parse_args() # make temp directory for placement of indices tmp_index_dir = tempfile.mkdtemp() tmp_dir = tempfile.mkdtemp() # index if necessary - if options.fileSource == 'history': + if options.fileSource == 'history' and not options.do_not_build_index: ref_file = tempfile.NamedTemporaryFile( dir=tmp_index_dir ) ref_file_name = ref_file.name ref_file.close() diff --git a/tools/sr_mapping/bwa_wrapper.xml b/tools/sr_mapping/bwa_wrapper.xml index 60aec4de023..31666d555fd 100644 --- a/tools/sr_mapping/bwa_wrapper.xml +++ b/tools/sr_mapping/bwa_wrapper.xml @@ -1,30 +1,44 @@ - + - bwa_wrapper.py ---threads="4" -#if $genomeSource.refGenomeSource == "history": ---ref=$genomeSource.ownFile -#else: ---ref=$genomeSource.indices -#end if ---fastq=$paired.input1 -#if $paired.sPaired == "paired": ---rfastq=$paired.input2 -#else: ---rfastq="None" -#end if ---output=$output --genAlignType=$paired.sPaired --params=$params.source_select --fileSource=$genomeSource.refGenomeSource -#if $params.source_select == "pre_set": ---maxEditDist="None" --fracMissingAligns="None" --maxGapOpens="None" --maxGapExtens="None" --disallowLongDel="None" --disallowIndel="None" --seed="None" --maxEditDistSeed="None" --mismatchPenalty="None" --gapOpenPenalty="None" --gapExtensPenalty="None" --suboptAlign="None" --noIterSearch="None" --outputTopN="None" --maxInsertSize="None" --maxOccurPairing="None" -#else: ---maxEditDist=$params.maxEditDist --fracMissingAligns=$params.fracMissingAligns --maxGapOpens=$params.maxGapOpens --maxGapExtens=$params.maxGapExtens --disallowLongDel=$params.disallowLongDel --disallowIndel=$params.disallowIndel --seed=$params.seed --maxEditDistSeed=$params.maxEditDistSeed --mismatchPenalty=$params.mismatchPenalty --gapOpenPenalty=$params.gapOpenPenalty --gapExtensPenalty=$params.gapExtensPenalty --suboptAlign=$params.suboptAlign --noIterSearch=$params.noIterSearch --outputTopN=$params.outputTopN --maxInsertSize=$params.maxInsertSize --maxOccurPairing=$params.maxOccurPairing -#end if -#if $genomeSource.refGenomeSource == "history": ---dbkey=$dbkey -#else: ---dbkey="None" -#end if ---suppressHeader=$suppressHeader + + bwa_wrapper.py + --threads="4" + #if $genomeSource.refGenomeSource == "history": + ##build index on the fly + --ref="${genomeSource.ownFile}" + --dbkey=$dbkey + #else: + ##use precomputed indexes + --ref="${ filter( lambda x: str( x[0] ) == str( $genomeSource.indices ), $__app__.tool_data_tables[ 'bwa_indexes' ].get_fields() )[0][-1] }" + --do_not_build_index=True + #end if + --fastq=$paired.input1 + #if $paired.sPaired == "paired": + --rfastq=$paired.input2 + #end if + --output=$output + --genAlignType=$paired.sPaired + --params=$params.source_select + --fileSource=$genomeSource.refGenomeSource + #if $params.source_select != "pre_set": + --maxEditDist=$params.maxEditDist + --fracMissingAligns=$params.fracMissingAligns + --maxGapOpens=$params.maxGapOpens + --maxGapExtens=$params.maxGapExtens + --disallowLongDel=$params.disallowLongDel + --disallowIndel=$params.disallowIndel + --seed=$params.seed + --maxEditDistSeed=$params.maxEditDistSeed + --mismatchPenalty=$params.mismatchPenalty + --gapOpenPenalty=$params.gapOpenPenalty + --gapExtensPenalty=$params.gapExtensPenalty + --suboptAlign=$params.suboptAlign + --noIterSearch=$params.noIterSearch + --outputTopN=$params.outputTopN + --maxInsertSize=$params.maxInsertSize + --maxOccurPairing=$params.maxOccurPairing + #end if + --suppressHeader=$suppressHeader bwa @@ -38,12 +52,6 @@ - @@ -62,7 +70,7 @@ - + @@ -110,12 +118,13 @@ - + + @@ -155,18 +164,19 @@ - + - + + diff --git a/tools/sr_mapping/lastz_paired_reads_wrapper.py b/tools/sr_mapping/lastz_paired_reads_wrapper.py index f7a54dac3ba..e9ea4835a96 100644 --- a/tools/sr_mapping/lastz_paired_reads_wrapper.py +++ b/tools/sr_mapping/lastz_paired_reads_wrapper.py @@ -758,7 +758,7 @@ def __main__(): parser.add_option( '', '--lastz_seqs_file_dir', dest='lastz_seqs_file_dir', help='Directory of local lastz_seqs.loc file' ) ( options, args ) = parser.parse_args() - if options.ref_name != 'None': + if options.ref_name: ref_name = '[nickname=%s]' % options.ref_name else: ref_name = '' diff --git a/tools/sr_mapping/lastz_paired_reads_wrapper.xml b/tools/sr_mapping/lastz_paired_reads_wrapper.xml index fa28ee84a1e..0d6a431e385 100644 --- a/tools/sr_mapping/lastz_paired_reads_wrapper.xml +++ b/tools/sr_mapping/lastz_paired_reads_wrapper.xml @@ -1,20 +1,21 @@ - + map short paired reads against reference sequence lastz_paired_reads_wrapper.py -#if $seq_name.how_to_name=="yes": ---ref_name=$seq_name.ref_name -#else: ---ref_name="None" -#end if ---ref_source=$source.ref_source --input2=$input2 --input3=$input3 --input4=$input4 -#if $source.ref_source=="history": ---input1=$source.input1 ---ref_sequences=$input1.metadata.sequences -#else: ---input1=$source.input1_2bit ---ref_sequences="None" -#end if ---output=$output1 --lastz_seqs_file_dir=${GALAXY_DATA_INDEX_DIR} + #if $seq_name.how_to_name=="yes": + --ref_name=$seq_name.ref_name + #end if + --ref_source=$source.ref_source + --input2=$input2 + --input3=$input3 + --input4=$input4 + #if $source.ref_source=="history": + --input1=$source.input1 + --ref_sequences=$input1.metadata.sequences + #else: + --input1="${ filter( lambda x: str( x[0] ) == str( $source.input1_2bit ), $__app__.tool_data_tables[ 'lastz_seqs' ].get_fields() )[0][-1] }" + #end if + --output=$output1 + --lastz_seqs_file_dir=${GALAXY_DATA_INDEX_DIR} @@ -25,10 +26,7 @@ - - - - + @@ -64,7 +62,7 @@ --> - + diff --git a/tools/sr_mapping/lastz_wrapper.py b/tools/sr_mapping/lastz_wrapper.py index 8ada5e4392e..33f20b8c25b 100644 --- a/tools/sr_mapping/lastz_wrapper.py +++ b/tools/sr_mapping/lastz_wrapper.py @@ -156,7 +156,7 @@ def __main__(): unmask = '[unmask]' else: unmask = '' - if options.ref_name != 'None': + if options.ref_name: ref_name = '[nickname=%s]' % options.ref_name else: ref_name = '' diff --git a/tools/sr_mapping/lastz_wrapper.xml b/tools/sr_mapping/lastz_wrapper.xml index 7dd5424d6aa..8909acfe6e7 100644 --- a/tools/sr_mapping/lastz_wrapper.xml +++ b/tools/sr_mapping/lastz_wrapper.xml @@ -1,25 +1,42 @@ - + map short reads against reference sequence lastz_wrapper.py -#if $seq_name.how_to_name=="yes": ---ref_name=$seq_name.ref_name -#else: ---ref_name="None" -#end if ---ref_source=$source.ref_source --source_select=$params.source_select --out_format=$out_format --input2=$input2 -#if $source.ref_source=="history": ---input1=$source.input1 ---ref_sequences=$input1.metadata.sequences -#else: ---input1=$source.input1_2bit ---ref_sequences="None" -#end if -#if $params.source_select=="pre_set": ---pre_set_options=${params.pre_set_options} --strand="None" --seed="None" --gfextend="None" --chain="None" --transition="None" --O="None" --E="None" --X="None" --Y="None" --K="None" --L="None" --entropy="None" -#else: ---pre_set_options="None" --strand=$params.strand --seed=$params.seed --gfextend=$params.gfextend --chain=$params.chain --transition="$params.transition" --O=$params.O --E=$params.E --X=$params.X --Y=$params.Y --K=$params.K --L=$params.L --entropy=$params.entropy -#end if ---identity_min=$min_ident --identity_max=$max_ident --coverage=$min_cvrg --output=$output1 --unmask=$unmask --lastzSeqsFileDir=${GALAXY_DATA_INDEX_DIR} + #if $seq_name.how_to_name=="yes": + --ref_name=$seq_name.ref_name + #end if + --ref_source=$source.ref_source + --source_select=$params.source_select + --out_format=$out_format + --input2=$input2 + #if $source.ref_source=="history": + --input1=$source.input1 + --ref_sequences=$input1.metadata.sequences + #else: + --input1="${ filter( lambda x: str( x[0] ) == str( $source.input1_2bit ), $__app__.tool_data_tables[ 'lastz_seqs' ].get_fields() )[0][-1] }" + --ref_sequences="None" + #end if + #if $params.source_select=="pre_set": + --pre_set_options=${params.pre_set_options} + #else: + --strand=$params.strand + --seed=$params.seed + --gfextend=$params.gfextend + --chain=$params.chain + --transition="$params.transition" + --O=$params.O + --E=$params.E + --X=$params.X + --Y=$params.Y + --K=$params.K + --L=$params.L + --entropy=$params.entropy + #end if + --identity_min=$min_ident + --identity_max=$max_ident + --coverage=$min_cvrg + --output=$output1 + --unmask=$unmask + --lastzSeqsFileDir=${GALAXY_DATA_INDEX_DIR} @@ -30,10 +47,7 @@ - - - - + @@ -127,14 +141,15 @@ - + - + + @@ -150,8 +165,8 @@ @@ -163,10 +178,10 @@ @@ -183,17 +198,17 @@ diff --git a/tools/sr_mapping/srma_wrapper.py b/tools/sr_mapping/srma_wrapper.py index 90eb7553bf3..c819f9d54fe 100644 --- a/tools/sr_mapping/srma_wrapper.py +++ b/tools/sr_mapping/srma_wrapper.py @@ -28,6 +28,15 @@ def stop_err( msg ): sys.stderr.write( '%s\n' % msg ) sys.exit() +def parseRefLoc( refLoc, refUID ): + for line in open( refLoc ): + if not line.startswith( '#' ): + fields = line.strip().split( '\t' ) + if len( fields ) >= 3: + if fields[0] == refUID: + return fields[1] + return None + def __main__(): #Parse Command Line parser = optparse.OptionParser() @@ -125,13 +134,10 @@ def __main__(): stop_err( 'Problem handling SRMA index (dict file) for custom genome file: %s\n' % str( e ) ) # using built-in dict/index files else: - for line in open( options.refLocations ): - if not line.startswith( '#' ): - fields = line.strip().split( '\t' ) - if len( fields ) >= 2: - if fields[0] == options.refUID: - reference_filepath_name = fields[1] - break + if options.ref: + reference_filepath_name = options.ref + else: + reference_filepath_name = parseRefLoc( options.refLocation, options.refUID ) if reference_filepath_name is None: raise ValueError( 'A valid genome reference was not provided.' ) diff --git a/tools/sr_mapping/srma_wrapper.xml b/tools/sr_mapping/srma_wrapper.xml index 1bf94f9e37e..2738b3fca7c 100644 --- a/tools/sr_mapping/srma_wrapper.xml +++ b/tools/sr_mapping/srma_wrapper.xml @@ -1,17 +1,28 @@ - + srma_wrapper.py #if $refGenomeSource.refGenomeSource_type == "history": - --ref=$refGenomeSource.ownFile + --ref=$refGenomeSource.ownFile #else: - --refUID=$refGenomeSource.ref - --refLocations=${GALAXY_DATA_INDEX_DIR}/srma_index.loc + --ref="${ filter( lambda x: str( x[0] ) == str( $refGenomeSource.ref ), $__app__.tool_data_tables[ 'srma_indexes' ].get_fields() )[0][-1] }" + --refUID=$refGenomeSource.ref + --refLocations=${GALAXY_DATA_INDEX_DIR}/srma_index.loc #end if - --input=$input --inputIndex=${input.metadata.bam_index} --output=$output - --params=$params.source_select --fileSource=$refGenomeSource.refGenomeSource_type + --input=$input + --inputIndex=${input.metadata.bam_index} + --output=$output + --params=$params.source_select + --fileSource=$refGenomeSource.refGenomeSource_type --jarBin="${GALAXY_DATA_INDEX_DIR}/shared/jars" #if $params.source_select == "full": - --offset=$params.offset --minMappingQuality=$params.minMappingQuality --minAlleleProbability=$params.minAlleleProbability --minAlleleCoverage=$params.minAlleleCoverage --range=$params.range --correctBases=$params.correctBases --useSequenceQualities=$params.useSequenceQualities --maxHeapSize=$params.maxHeapSize + --offset=$params.offset + --minMappingQuality=$params.minMappingQuality + --minAlleleProbability=$params.minAlleleProbability + --minAlleleCoverage=$params.minAlleleCoverage + --range=$params.range + --correctBases=$params.correctBases + --useSequenceQualities=$params.useSequenceQualities + --maxHeapSize=$params.maxHeapSize #end if --jarFile="srma.jar" @@ -23,10 +34,7 @@ - - - - + @@ -71,13 +79,13 @@ @@ -87,16 +95,16 @@