diff --git a/test-data/phiX.fasta b/test-data/phiX.fasta
index d047693d6b8..53df885dc48 100644
--- a/test-data/phiX.fasta
+++ b/test-data/phiX.fasta
@@ -1,109 +1,79 @@
->phiX
-GAGTTTTATCGCTTCCATGACGCAGAAGTTAACACTTTCGGATATTTCTG
-ATGAGTCGAAAAATTATCTTGATAAAGCAGGAATTACTACTGCTTGTTTA
-CGAATTAAATCGAAGTGGACTGCTGGCGGAAAATGAGAAAATTCGACCTA
-TCCTTGCGCAGCTCGAGAAGCTCTTACTTTGCGACCTTTCGCCATCAACT
-AACGATTCTGTCAAAAACTGACGCGTTGGATGAGGAGAAGTGGCTTAATA
-TGCTTGGCACGTTCGTCAAGGACTGGTTTAGATATGAGTCACATTTTGTT
-CATGGTAGAGATTCTCTTGTTGACATTTTAAAAGAGCGTGGATTACTATC
-TGAGTCCGATGCTGTTCAACCACTAATAGGTAAGAAATCATGAGTCAAGT
-TACTGAACAATCCGTACGTTTCCAGACCGCTTTGGCCTCTATTAAGCTCA
-TTCAGGCTTCTGCCGTTTTGGATTTAACCGAAGATGATTTCGATTTTCTG
-ACGAGTAACAAAGTTTGGATTGCTACTGACCGCTCTCGTGCTCGTCGCTG
-CGTTGAGGCTTGCGTTTATGGTACGCTGGACTTTGTGGGATACCCTCGCT
-TTCCTGCTCCTGTTGAGTTTATTGCTGCCGTCATTGCTTATTATGTTCAT
-CCCGTCAACATTCAAACGGCCTGTCTCATCATGGAAGGCGCTGAATTTAC
-GGAAAACATTATTAATGGCGTCGAGCGTCCGGTTAAAGCCGCTGAATTGT
-TCGCGTTTACCTTGCGTGTACGCGCAGGAAACACTGACGTTCTTACTGAC
-GCAGAAGAAAACGTGCGTCAAAAATTACGTGCaGAAGGAGTGATGTAATG
-TCTAAAGGTAAAAAACGTTCTGGCGCTCGCCCTGGTCGTCCGCAGCCGTT
-GCGAGGTACTAAAGGCAAGCGTAAAGGCGCTCGTCTTTGGTATGTAGGTG
-GTCAACAATTTTAATTGCAGGGGCTTCGGCCCCTTACTTGAGGATAAATT
-ATGTCTAATATTCAAACTGGCGCCGAGCGTATGCCGCATGACCTTTCCCA
-TCTTGGCTTCCTTGCTGGTCAGATTGGTCGTCTTATTACCATTTCAACTA
-CTCCGGTTATCGCTGGCGACTCCTTCGAGATGGACGCCGTTGGCGCTCTC
-CGTCTTTCTCCATTGCGTCGTGGCCTTGCTATTGACTCTACTGTAGACAT
-TTTTACTTTTTATGTCCCTCATCGTCACGTTTATGGTGAACAGTGGATTA
-AGTTCATGAAGGATGGTGTTAATGCCACTCCTCTCCCGACTGTTAACACT
-ACTGGTTATATTGACCATGCCGCTTTTCTTGGCACGATTAACCCTGATAC
-CAATAAAATCCCTAAGCATTTGTTTCAGGGTTATTTGAATATCTATAACA
-ACTATTTTAAAGCGCCGTGGATGCCTGACCGTACCGAGGCTAACCCTAAT
-GAGCTTAATCAAGATGATGCTCGTTATGGTTTCCGTTGCTGCCATCTCAA
-AAACATTTGGACTGCTCCGCTTCCTCCTGAGACTGAGCTTTCTCGCCAAA
-TGACGACTTCTACCACATCTATTGACATTATGGGTCTGCAAGCTGCTTAT
-GCTAATTTGCATACTGACCAAGAACGTGATTACTTCATGCAGCGTTACCg
-TGATGTTATTTCTTCATTTGGAGGTAAAACCTCTTATGACGCTGACAACC
-GTCCTTTACTTGTCATGCGCTCTAATCTCTGGGCATCTGGCTATGATGTT
-GATGGAACTGACCAAACGTCGTTAGGCCAGTTTTCTGGTCGTGTTCAACA
-GACCTATAAACATTCTGTGCCGCGTTTCTTTGTTCCTGAGCATGGCACTA
-TGTTTACTCTTGCGCTTGTTCGTTTTCCGCCTACTGCGACTAAAGAGATT
-CAGTACCTTAACGCTAAAGGTGCTTTGACTTATACCGATATTGCTGGCGA
-CCCTGTTTTGTATGGCAACTTGCCGCCGCGTGAAATTTCTATGAAGGATG
-TTTTCCGTTCTGGTGATTCGTCTAAGAAGTTTAAGATTGCTGAGGGTCAG
-TGGTATCGTTATGCGCCTTCGTATGTTTCTCCTGCTTATCACCTTCTTGA
-AGGCTTCCCATTCATTCAGGAACCGCCTTCTGGTGATTTGCAAGAACGCG
-TACTTATTCGCCACCATGATTATGACCAGTGTTTCCAGTCCGTTCAGTTG
-TTGCAGTGGAATAGTCAGGTTAAATTTAATGTGACCGTTTATCGCAATCT
-GCCGACCACTCGCGATTCAATCATGACTTCGTGATAAAAGATTGAGTGTG
-AGGTTATAACGCCGAAGCGGTAAAAATTTTAATTTTTGCCGCTGAGGGGT
-TGACCAAGCGAAGCGCGGTAGGTTTTCTGCTTAGGAGTTTAATCATGTTT
-CAGACTTTTATTTCTCGCCATAATTCAAACTTTTTTTCTGATAAGCTGGT
-TCTCACTTCTGTTACTCCAGCTTCTTCGGCACCTGTTTTACAGACACCTA
-AAGCTACATCGTCAACGTTATATTTTGATAGTTTGACGGTTAATGCTGGT
-AATGGTGGTTTTCTTCATTGCATTCAGATGGATACATCTGTCAACGCCGC
-TAATCAGGTTGTTTCTGTTGGTGCTGATATTGCTTTTGATGCCGACCCTA
-AATTTTTTGCCTGTTTGGTTCGCTTTGAGTCTTCTTCGGTTCCGACTACC
-CTCCCGACTGCCTATGATGTTTATCCTTTGAATGGTCGCCATGATGGTGG
-TTATTATACCGTCAAGGACTGTGTGACTATTGACGTCCTTCCCCGTACGC
-CGGGCAATAAtGTTTATGTTGGTTTCATGGTTTGGTCTAACTTTACCGCT
-ACTAAATGCCGCGGATTGGTTTCGCTGAATCAGGTTATTAAAGAGATTAT
-TTGTCTCCAGCCACTTAAGTGAGGTGATTTATGTTTGGTGCTATTGCTGG
-CGGTATTGCTTCTGCTCTTGCTGGTGGCGCCATGTCTAAATTGTTTGGAG
-GCGGTCAAAAAGCCGCCTCCGGTGGCATTCAAGGTGATGTGCTTGCTACC
-GATAACAATACTGTAGGCATGGGTGATGCTGGTATTAAATCTGCCATTCA
-AGGCTCTAATGTTCCTAACCCTGATGAGGCCGCCCCTAGTTTTGTTTCTG
-GTGCTATGGCTAAAGCTGGTAAAGGACTTCTTGAAGGTACGTTGCAGGCT
-GGCACTTCTGCCGTTTCTGATAAGTTGCTTGATTTGGTTGGACTTGGTGG
-CAAGTCTGCCGCTGATAAAGGAAAGGATACTCGTGATTATCTTGCTGCTG
-CATTTCCTGAGCTTAATGCTTGGGAGCGTGCTGGTGCTGATGCTTCCTCT
-GCTGGTATGGTTGACGCCGGATTTGAGAATCAAAAAGAGCTTACTAAAAT
-GCAACTGGACAATCAGAAAGAGATTGCCGAGATGCAAAATGAGACTCAAA
-AAGAGATTGCTGGCATTCAGTCGGCGACTTCACGCCAGAATACGAAAGAC
-CAGGTATATGCACAAAATGAGATGCTTGCTTATCAACAGAAGGAGTCTAC
-TGCTCGCGTTGCGTCTATTATGGAAAACACCAATCTTTCCAAGCAACAGC
-AGGTTTCCGAGATTATGCGCCAAATGCTTACTCAAGCTCAAACGGCTGGT
-CAGTATTTTACCAATGACCAAATCAAAGAAATGACTCGCAAGGTTAGTGC
-TGAGGTTGACTTAGTTCATCAGCAAACGCAGAATCAGCGGTATGGCTCTT
-CTCATATTGGCGCTACTGCAAAGGATATTTCTAATGTCGTCACTGATGCT
-GCTTCTGGTGTGGTTGATATTTTTCATGGTATTGATAAAGCTGTTGCCGA
-TACTTGGAACAATTTCTGGAAAGACGGTAAAGCTGATGGTATTGGCTCTA
-ATTTGTCTAGGAAATAACCGTCAGGATTGACACCCTCCCAATTGTATGTT
-TTCATGCCTCCAAATCTTGGAGGCTTTTTTATGGTTCGTTCTTATTACCC
-TTCTGAATGTCACGCTGATTATTTTGACTTTGAGCGTATCGAGGCTCTTA
-AACCTGCTATTGAGGCTTGTGGCATTTCTACTCTTTCTCAATCCCCAATG
-CTTGGCTTCCATAAGCAGATGGATAACCGCATCAAGCTCTTGGAAGAGAT
-TCTGTCTTTTCGTATGCAGGGCGTTGAGTTCGATAATGGTGATATGTATG
-TTGACGGCCATAAGGCTGCTTCTGACGTTCGTGATGAGTTTGTATCTGTT
-ACTGAGAAGTTAATGGATGAATTGGCACAATGCTACAATGTGCTCCCCCA
-ACTTGATATTAATAACACTATAGACCACCGCCCCGAAGGGGACGAAAAAT
-GGTTTTTAGAGAACGAGAAGACGGTTACGCAGTTTTGCCGCAAGCTGGCT
-GCTGAACGCCCTCTTAAGGATATTCGCGATGAGTATAATTACCCCAAAAA
-GAAAGGTATTAAGGATGAGTGTTCAAGATTGCTGGAGGCCTCCACTATGA
-AATCGCGTAGAGGCTTTaCTATTCAGCGTTTGATGAATGCAATGCGACAG
-GCTCATGCTGATGGTTGGTTTATCGTTTTTGACACTCTCACGTTGGCTGA
-CGACCGATTAGAGGCGTTTTATGATAATCCCAATGCTTTGCGTGACTATT
-TTCGTGATATTGGTCGTATGGTTCTTGCTGCCGAGGGTCGCAAGGCTAAT
-GATTCACACGCCGACTGCTATCAGTATTTTTGTGTGCCTGAGTATGGTAC
-AGCTAATGGCCGTCTTCATTTCCATGCGGTGCAtTTTATGCGGACACTTC
-CTACAGGTAGCGTTGACCCTAATTTTGGTCGTCGGGTACGCAATCGCCGC
-CAGTTAAATAGCTTGCAAAATACGTGGCCTTATGGTTACAGTATGCCCAT
-CGCAGTTCGCTACACGCAGGACGCTTTTTCACGTTCTGGTTGGTTGTGGC
-CTGTTGATGCTAAAGGTGAGCCGCTTAAAGCTACCAGTTATATGGCTGTT
-GGTTTCTATGTGGCTAAATACGTTAACAAAAAGTCAGATATGGACCTTGC
-TGCTAAAGGTCTAGGAGCTAAAGAATGGAACAACTCACTAAAAACCAAGC
-TGTCGCTACTTCCCAAGAAGCTGTTCAGAATCAGAATGAGCCGCAACTTC
-GGGATGAAAATGCTCACAATGACAAATCTGTCCACGGAGTGCTTAATCCA
-ACTTACCAAGCTGGGTTACGACGCGACGCCGTTCAACCAGATATTGAAGC
-AGAACGCAAAAAGAGAGATGAGATTGAGGCTGGGAAAAGTTACTGTAGCC
-GACGTTTTGGCGGCGCAACCTGTGACGACAAATCTGCTCAAATTTATGCG
-CGCTTCGATAAAAATGATTGGCGTATCCAACCTGCA
+>phiX174
+GAGTTTTATCGCTTCCATGACGCAGAAGTTAACACTTTCGGATATTTCTGATGAGTCGAAAAATTATCTT
+GATAAAGCAGGAATTACTACTGCTTGTTTACGAATTAAATCGAAGTGGACTGCTGGCGGAAAATGAGAAA
+ATTCGACCTATCCTTGCGCAGCTCGAGAAGCTCTTACTTTGCGACCTTTCGCCATCAACTAACGATTCTG
+TCAAAAACTGACGCGTTGGATGAGGAGAAGTGGCTTAATATGCTTGGCACGTTCGTCAAGGACTGGTTTA
+GATATGAGTCACATTTTGTTCATGGTAGAGATTCTCTTGTTGACATTTTAAAAGAGCGTGGATTACTATC
+TGAGTCCGATGCTGTTCAACCACTAATAGGTAAGAAATCATGAGTCAAGTTACTGAACAATCCGTACGTT
+TCCAGACCGCTTTGGCCTCTATTAAGCTCATTCAGGCTTCTGCCGTTTTGGATTTAACCGAAGATGATTT
+CGATTTTCTGACGAGTAACAAAGTTTGGATTGCTACTGACCGCTCTCGTGCTCGTCGCTGCGTTGAGGCT
+TGCGTTTATGGTACGCTGGACTTTGTGGGATACCCTCGCTTTCCTGCTCCTGTTGAGTTTATTGCTGCCG
+TCATTGCTTATTATGTTCATCCCGTCAACATTCAAACGGCCTGTCTCATCATGGAAGGCGCTGAATTTAC
+GGAAAACATTATTAATGGCGTCGAGCGTCCGGTTAAAGCCGCTGAATTGTTCGCGTTTACCTTGCGTGTA
+CGCGCAGGAAACACTGACGTTCTTACTGACGCAGAAGAAAACGTGCGTCAAAAATTACGTGCAGAAGGAG
+TGATGTAATGTCTAAAGGTAAAAAACGTTCTGGCGCTCGCCCTGGTCGTCCGCAGCCGTTGCGAGGTACT
+AAAGGCAAGCGTAAAGGCGCTCGTCTTTGGTATGTAGGTGGTCAACAATTTTAATTGCAGGGGCTTCGGC
+CCCTTACTTGAGGATAAATTATGTCTAATATTCAAACTGGCGCCGAGCGTATGCCGCATGACCTTTCCCA
+TCTTGGCTTCCTTGCTGGTCAGATTGGTCGTCTTATTACCATTTCAACTACTCCGGTTATCGCTGGCGAC
+TCCTTCGAGATGGACGCCGTTGGCGCTCTCCGTCTTTCTCCATTGCGTCGTGGCCTTGCTATTGACTCTA
+CTGTAGACATTTTTACTTTTTATGTCCCTCATCGTCACGTTTATGGTGAACAGTGGATTAAGTTCATGAA
+GGATGGTGTTAATGCCACTCCTCTCCCGACTGTTAACACTACTGGTTATATTGACCATGCCGCTTTTCTT
+GGCACGATTAACCCTGATACCAATAAAATCCCTAAGCATTTGTTTCAGGGTTATTTGAATATCTATAACA
+ACTATTTTAAAGCGCCGTGGATGCCTGACCGTACCGAGGCTAACCCTAATGAGCTTAATCAAGATGATGC
+TCGTTATGGTTTCCGTTGCTGCCATCTCAAAAACATTTGGACTGCTCCGCTTCCTCCTGAGACTGAGCTT
+TCTCGCCAAATGACGACTTCTACCACATCTATTGACATTATGGGTCTGCAAGCTGCTTATGCTAATTTGC
+ATACTGACCAAGAACGTGATTACTTCATGCAGCGTTACCGTGATGTTATTTCTTCATTTGGAGGTAAAAC
+CTCTTATGACGCTGACAACCGTCCTTTACTTGTCATGCGCTCTAATCTCTGGGCATCTGGCTATGATGTT
+GATGGAACTGACCAAACGTCGTTAGGCCAGTTTTCTGGTCGTGTTCAACAGACCTATAAACATTCTGTGC
+CGCGTTTCTTTGTTCCTGAGCATGGCACTATGTTTACTCTTGCGCTTGTTCGTTTTCCGCCTACTGCGAC
+TAAAGAGATTCAGTACCTTAACGCTAAAGGTGCTTTGACTTATACCGATATTGCTGGCGACCCTGTTTTG
+TATGGCAACTTGCCGCCGCGTGAAATTTCTATGAAGGATGTTTTCCGTTCTGGTGATTCGTCTAAGAAGT
+TTAAGATTGCTGAGGGTCAGTGGTATCGTTATGCGCCTTCGTATGTTTCTCCTGCTTATCACCTTCTTGA
+AGGCTTCCCATTCATTCAGGAACCGCCTTCTGGTGATTTGCAAGAACGCGTACTTATTCGCCACCATGAT
+TATGACCAGTGTTTCCAGTCCGTTCAGTTGTTGCAGTGGAATAGTCAGGTTAAATTTAATGTGACCGTTT
+ATCGCAATCTGCCGACCACTCGCGATTCAATCATGACTTCGTGATAAAAGATTGAGTGTGAGGTTATAAC
+GCCGAAGCGGTAAAAATTTTAATTTTTGCCGCTGAGGGGTTGACCAAGCGAAGCGCGGTAGGTTTTCTGC
+TTAGGAGTTTAATCATGTTTCAGACTTTTATTTCTCGCCATAATTCAAACTTTTTTTCTGATAAGCTGGT
+TCTCACTTCTGTTACTCCAGCTTCTTCGGCACCTGTTTTACAGACACCTAAAGCTACATCGTCAACGTTA
+TATTTTGATAGTTTGACGGTTAATGCTGGTAATGGTGGTTTTCTTCATTGCATTCAGATGGATACATCTG
+TCAACGCCGCTAATCAGGTTGTTTCTGTTGGTGCTGATATTGCTTTTGATGCCGACCCTAAATTTTTTGC
+CTGTTTGGTTCGCTTTGAGTCTTCTTCGGTTCCGACTACCCTCCCGACTGCCTATGATGTTTATCCTTTG
+AATGGTCGCCATGATGGTGGTTATTATACCGTCAAGGACTGTGTGACTATTGACGTCCTTCCCCGTACGC
+CGGGCAATAATGTTTATGTTGGTTTCATGGTTTGGTCTAACTTTACCGCTACTAAATGCCGCGGATTGGT
+TTCGCTGAATCAGGTTATTAAAGAGATTATTTGTCTCCAGCCACTTAAGTGAGGTGATTTATGTTTGGTG
+CTATTGCTGGCGGTATTGCTTCTGCTCTTGCTGGTGGCGCCATGTCTAAATTGTTTGGAGGCGGTCAAAA
+AGCCGCCTCCGGTGGCATTCAAGGTGATGTGCTTGCTACCGATAACAATACTGTAGGCATGGGTGATGCT
+GGTATTAAATCTGCCATTCAAGGCTCTAATGTTCCTAACCCTGATGAGGCCGCCCCTAGTTTTGTTTCTG
+GTGCTATGGCTAAAGCTGGTAAAGGACTTCTTGAAGGTACGTTGCAGGCTGGCACTTCTGCCGTTTCTGA
+TAAGTTGCTTGATTTGGTTGGACTTGGTGGCAAGTCTGCCGCTGATAAAGGAAAGGATACTCGTGATTAT
+CTTGCTGCTGCATTTCCTGAGCTTAATGCTTGGGAGCGTGCTGGTGCTGATGCTTCCTCTGCTGGTATGG
+TTGACGCCGGATTTGAGAATCAAAAAGAGCTTACTAAAATGCAACTGGACAATCAGAAAGAGATTGCCGA
+GATGCAAAATGAGACTCAAAAAGAGATTGCTGGCATTCAGTCGGCGACTTCACGCCAGAATACGAAAGAC
+CAGGTATATGCACAAAATGAGATGCTTGCTTATCAACAGAAGGAGTCTACTGCTCGCGTTGCGTCTATTA
+TGGAAAACACCAATCTTTCCAAGCAACAGCAGGTTTCCGAGATTATGCGCCAAATGCTTACTCAAGCTCA
+AACGGCTGGTCAGTATTTTACCAATGACCAAATCAAAGAAATGACTCGCAAGGTTAGTGCTGAGGTTGAC
+TTAGTTCATCAGCAAACGCAGAATCAGCGGTATGGCTCTTCTCATATTGGCGCTACTGCAAAGGATATTT
+CTAATGTCGTCACTGATGCTGCTTCTGGTGTGGTTGATATTTTTCATGGTATTGATAAAGCTGTTGCCGA
+TACTTGGAACAATTTCTGGAAAGACGGTAAAGCTGATGGTATTGGCTCTAATTTGTCTAGGAAATAACCG
+TCAGGATTGACACCCTCCCAATTGTATGTTTTCATGCCTCCAAATCTTGGAGGCTTTTTTATGGTTCGTT
+CTTATTACCCTTCTGAATGTCACGCTGATTATTTTGACTTTGAGCGTATCGAGGCTCTTAAACCTGCTAT
+TGAGGCTTGTGGCATTTCTACTCTTTCTCAATCCCCAATGCTTGGCTTCCATAAGCAGATGGATAACCGC
+ATCAAGCTCTTGGAAGAGATTCTGTCTTTTCGTATGCAGGGCGTTGAGTTCGATAATGGTGATATGTATG
+TTGACGGCCATAAGGCTGCTTCTGACGTTCGTGATGAGTTTGTATCTGTTACTGAGAAGTTAATGGATGA
+ATTGGCACAATGCTACAATGTGCTCCCCCAACTTGATATTAATAACACTATAGACCACCGCCCCGAAGGG
+GACGAAAAATGGTTTTTAGAGAACGAGAAGACGGTTACGCAGTTTTGCCGCAAGCTGGCTGCTGAACGCC
+CTCTTAAGGATATTCGCGATGAGTATAATTACCCCAAAAAGAAAGGTATTAAGGATGAGTGTTCAAGATT
+GCTGGAGGCCTCCACTATGAAATCGCGTAGAGGCTTTACTATTCAGCGTTTGATGAATGCAATGCGACAG
+GCTCATGCTGATGGTTGGTTTATCGTTTTTGACACTCTCACGTTGGCTGACGACCGATTAGAGGCGTTTT
+ATGATAATCCCAATGCTTTGCGTGACTATTTTCGTGATATTGGTCGTATGGTTCTTGCTGCCGAGGGTCG
+CAAGGCTAATGATTCACACGCCGACTGCTATCAGTATTTTTGTGTGCCTGAGTATGGTACAGCTAATGGC
+CGTCTTCATTTCCATGCGGTGCATTTTATGCGGACACTTCCTACAGGTAGCGTTGACCCTAATTTTGGTC
+GTCGGGTACGCAATCGCCGCCAGTTAAATAGCTTGCAAAATACGTGGCCTTATGGTTACAGTATGCCCAT
+CGCAGTTCGCTACACGCAGGACGCTTTTTCACGTTCTGGTTGGTTGTGGCCTGTTGATGCTAAAGGTGAG
+CCGCTTAAAGCTACCAGTTATATGGCTGTTGGTTTCTATGTGGCTAAATACGTTAACAAAAAGTCAGATA
+TGGACCTTGCTGCTAAAGGTCTAGGAGCTAAAGAATGGAACAACTCACTAAAAACCAAGCTGTCGCTACT
+TCCCAAGAAGCTGTTCAGAATCAGAATGAGCCGCAACTTCGGGATGAAAATGCTCACAATGACAAATCTG
+TCCACGGAGTGCTTAATCCAACTTACCAAGCTGGGTTACGACGCGACGCCGTTCAACCAGATATTGAAGC
+AGAACGCAAAAAGAGAGATGAGATTGAGGCTGGGAAAAGTTACTGTAGCCGACGTTTTGGCGGCGCAACC
+TGTGACGACAAATCTGCTCAAATTTATGCGCGCTTCGATAAAAATGATTGGCGTATCCAACCTGCA
+
diff --git a/tool-data/blastdb.loc.sample b/tool-data/blastdb.loc.sample
index 3405b9defd5..5f33d7b138a 100644
--- a/tool-data/blastdb.loc.sample
+++ b/tool-data/blastdb.loc.sample
@@ -1,7 +1,8 @@
 #This is a sample file distributed with Galaxy that is used to define a
-#list of nucelotide BLAST databases, using two columns tab separated:
+#list of nucleotide BLAST databases, using three columns tab separated
+#(longer whitespace are TAB characters):
 #
-#<database caption>     <path to base name>
+#<unique_id>      <database_caption>     <base_name_path>
 #
 #The captions typically contain spaces and might end with the build date.
 #It is important that the actual database name does not have a space in it,
@@ -11,7 +12,7 @@
 #is /depot/data2/galaxy/blastdb/nt/nt.chunk, then the blastdb.loc entry 
 #would look like this:
 #
-#nt 02 Dec 2009      /depot/data2/galaxy/blastdb/nt/nt.chunk
+#nt_02_Dec_2009      nt 02 Dec 2009      /depot/data2/galaxy/blastdb/nt/nt.chunk
 #
 #and your /depot/data2/galaxy/blastdb/nt directory would contain all of 
 #your "base names" (e.g.):
@@ -24,9 +25,14 @@
 #Your blastdb.loc file should include an entry per line for each "base name" 
 #you have stored.  For example:
 #
-#nt 02 Dec 2009	/depot/data2/galaxy/blastdb/nt/nt.chunk
-#wgs 30 Nov 2009	/depot/data2/galaxy/blastdb/wgs/wgs.chunk
-#test 20 Sep 2008	/depot/data2/galaxy/blastdb/test/test
+#nt_02_Dec_2009      nt 02 Dec 2009      /depot/data2/galaxy/blastdb/nt/nt.chunk
+#wgs_30_Nov_2009     wgs 30 Nov 2009     /depot/data2/galaxy/blastdb/wgs/wgs.chunk
+#test_20_Sep_2008    test 20 Sep 2008    /depot/data2/galaxy/blastdb/test/test
 #...etc...
 #
 #See also blastdb_p.loc which is for any protein BLAST database.
+#
+#Note that for backwards compatibility with workflows, the unique ID of
+#an entry must be the path that was in the original loc file, because that
+#is the value stored in the workflow for that parameter.
+#
diff --git a/tool-data/blastdb_p.loc.sample b/tool-data/blastdb_p.loc.sample
index 161a244cc54..5fc4b8e38f9 100644
--- a/tool-data/blastdb_p.loc.sample
+++ b/tool-data/blastdb_p.loc.sample
@@ -1,12 +1,27 @@
 #This is a sample file distributed with Galaxy that is used to define a
-#list of protein BLAST databases, using two columns tab separated:
+#list of protein BLAST databases, using three columns tab separated
+#(longer whitespace are TAB characters):
 #
-#<database caption>     <path to base name>
+#<unique_id>      <database_caption>     <base_name_path>
 #
-#For example:
+#The captions typically contain spaces and might end with the build date.
+#It is important that the actual database name does not have a space in it,
+#and that the first tab that appears in the line is right before the path.
 #
-#NCBI NR (non redundant)      /data/blastdb/nr
+#So, for example, if your database is NR and the path to your base name 
+#is /data/blastdb/nr, then the blastdb_p.loc entry would look like this:
 #
-#where /data/blastdb/nr.* are the files making up the NR database.
+#nr    NCBI NR (non redundant)      /data/blastdb/nr
+#
+#and your /data/blastdb directory would contain all of the files associated
+#with the database, /data/blastdb/nr.*.
+#
+#Your blastdb_p.loc file should include an entry per line for each "base name" 
+#you have stored. For example:
+#
+#nr_05Jun2010    NCBI NR (non redundant) 05 Jun 2010      /data/blastdb/05Jun2010/nr
+#nr_15Aug2010    NCBI NR (non redundant) 15 Aug 2010      /data/blastdb/15Aug2010/nr
+#...etc...
+#
+#See also blastdb.loc which is for any nucleotide BLAST database.
 #
-#See also the blastdb.loc file which is for any nucleotide databases.
diff --git a/tool-data/bowtie_indices.loc.sample b/tool-data/bowtie_indices.loc.sample
index a06ec87e648..091ea4d3b7e 100644
--- a/tool-data/bowtie_indices.loc.sample
+++ b/tool-data/bowtie_indices.loc.sample
@@ -1,29 +1,37 @@
 #This is a sample file distributed with Galaxy that enables tools
-#to use a directory of Bowtie indexed sequences data files.  You will need
-#to create these data files and then create a bowtie_indices.loc file 
-#similar to this one (store it in this directory) that points to 
-#the directories in which those files are stored. The bowtie_indices.loc 
-#file has this format (white space characters are TAB characters):
+#to use a directory of Bowtie indexed sequences data files. You will
+#need to create these data files and then create a bowtie_indices.loc
+#file similar to this one (store it in this directory) that points to
+#the directories in which those files are stored. The bowtie_indices.loc
+#file has this format (longer white space characters are TAB characters):
 #
-#<build>	<file_base>
+#<unique_build_id>   <dbkey>   <display_name>   <file_base_path>
 #
 #So, for example, if you had hg18 indexed stored in 
 #/depot/data2/galaxy/bowtie/hg18/, 
 #then the bowtie_indices.loc entry would look like this:
 #
-#hg18	/depot/data2/galaxy/bowtie/hg18/hg18
+#hg18   hg18   hg18   /depot/data2/galaxy/bowtie/hg18/hg18
 #
 #and your /depot/data2/galaxy/bowtie/hg18/ directory
 #would contain hg18.*.ebwt files:
 #
 #-rw-r--r--  1 james    universe 830134 2005-09-13 10:12 hg18.1.ebwt
 #-rw-r--r--  1 james    universe 527388 2005-09-13 10:12 hg18.2.ebwt
-#-rw-r--r--  1 james    universe 269808 2005-09-13 10:12 gh18.3.ebwt
+#-rw-r--r--  1 james    universe 269808 2005-09-13 10:12 hg18.3.ebwt
 #...etc...
 #
-#Your bowtie_indices.loc file should include an entry per line for 
-#each index set you have stored.  The "file" in the path does not actually
-#exist, but it is the prefix for the actual index files.  For example:
+#Your bowtie_indices.loc file should include an entry per line for each
+#index set you have stored. The "file" in the path does not actually
+#exist, but it is the prefix for the actual index files. For example:
+#
+#hg18canon          hg18   hg18 Canonical   /depot/data2/galaxy/bowtie/hg18/hg18canon
+#hg18full           hg18   hg18 Full        /depot/data2/galaxy/bowtie/hg18/hg18full
+#/orig/path/hg19    hg19   hg19             /depot/data2/galaxy/bowtie/hg19/hg19
+#...etc...
+#
+#Note that for backwards compatibility with workflows, the unique ID of
+#an entry must be the path that was in the original loc file, because that
+#is the value stored in the workflow for that parameter. That is why the
+#hg19 entry above looks odd. New genomes can be better-looking.
 #
-#hg18	/depot/data2/galaxy/bowtie/hg18/hg18
-#hg19	/depot/data2/galaxy/bowtie/hg19/hg19
diff --git a/tool-data/bowtie_indices_color.loc.sample b/tool-data/bowtie_indices_color.loc.sample
index 69cb0d74590..091ea4d3b7e 100644
--- a/tool-data/bowtie_indices_color.loc.sample
+++ b/tool-data/bowtie_indices_color.loc.sample
@@ -1,31 +1,37 @@
 #This is a sample file distributed with Galaxy that enables tools
-#to use a directory of colorspace Bowtie indexed sequences data files.  
-#You will need to create these data files and then create a 
-#bowtie_indices_color.loc file similar to this one (store it in this 
-#directory) that points to the directories in which those files are 
-#stored. The bowtie_indices_color.loc file has this format (white 
-#space characters are TAB characters):
+#to use a directory of Bowtie indexed sequences data files. You will
+#need to create these data files and then create a bowtie_indices.loc
+#file similar to this one (store it in this directory) that points to
+#the directories in which those files are stored. The bowtie_indices.loc
+#file has this format (longer white space characters are TAB characters):
 #
-#<build>	<file_base>
+#<unique_build_id>   <dbkey>   <display_name>   <file_base_path>
 #
 #So, for example, if you had hg18 indexed stored in 
 #/depot/data2/galaxy/bowtie/hg18/, 
-#then the bowtie_indices_color.loc entry would look like this:
+#then the bowtie_indices.loc entry would look like this:
 #
-#hg18	/depot/data2/galaxy/bowtie/hg18/hg18
+#hg18   hg18   hg18   /depot/data2/galaxy/bowtie/hg18/hg18
 #
 #and your /depot/data2/galaxy/bowtie/hg18/ directory
 #would contain hg18.*.ebwt files:
 #
 #-rw-r--r--  1 james    universe 830134 2005-09-13 10:12 hg18.1.ebwt
 #-rw-r--r--  1 james    universe 527388 2005-09-13 10:12 hg18.2.ebwt
-#-rw-r--r--  1 james    universe 269808 2005-09-13 10:12 gh18.3.ebwt
+#-rw-r--r--  1 james    universe 269808 2005-09-13 10:12 hg18.3.ebwt
 #...etc...
 #
-#Your bowtie_indices_color.loc file should include an entry per line 
-#for each index set you have stored.  The "file" in the path does not 
-#actually exist, but it is the prefix for the actual index files. For 
-#example:
+#Your bowtie_indices.loc file should include an entry per line for each
+#index set you have stored. The "file" in the path does not actually
+#exist, but it is the prefix for the actual index files. For example:
+#
+#hg18canon          hg18   hg18 Canonical   /depot/data2/galaxy/bowtie/hg18/hg18canon
+#hg18full           hg18   hg18 Full        /depot/data2/galaxy/bowtie/hg18/hg18full
+#/orig/path/hg19    hg19   hg19             /depot/data2/galaxy/bowtie/hg19/hg19
+#...etc...
+#
+#Note that for backwards compatibility with workflows, the unique ID of
+#an entry must be the path that was in the original loc file, because that
+#is the value stored in the workflow for that parameter. That is why the
+#hg19 entry above looks odd. New genomes can be better-looking.
 #
-#hg18	/depot/data2/galaxy/bowtie/hg18/hg18
-#hg19	/depot/data2/galaxy/bowtie/hg19/hg19
diff --git a/tool-data/bwa_index.loc.sample b/tool-data/bwa_index.loc.sample
index 5500d8460fe..58fa49d1108 100644
--- a/tool-data/bwa_index.loc.sample
+++ b/tool-data/bwa_index.loc.sample
@@ -1,17 +1,17 @@
 #This is a sample file distributed with Galaxy that enables tools
-#to use a directory of BWA indexed sequences data files.  You will need
-#to create these data files and then create a bwa_index.loc file 
-#similar to this one (store it in this directory) that points to 
-#the directories in which those files are stored. The bwa_index.loc 
-#file has this format (white space characters are TAB characters):
+#to use a directory of BWA indexed sequences data files. You will need
+#to create these data files and then create a bwa_index.loc file
+#similar to this one (store it in this directory) that points to
+#the directories in which those files are stored. The bwa_index.loc
+#file has this format (longer white space characters are TAB characters):
 #
-#<build>	<file_base>
+#<unique_build_id>   <dbkey>   <display_name>   <file_path>
 #
 #So, for example, if you had phiX indexed stored in 
 #/depot/data2/galaxy/phiX/base/, 
 #then the bwa_index.loc entry would look like this:
 #
-#phiX	/depot/data2/galaxy/phiX/base/phiX.fa
+#phiX174   phiX   phiX Pretty   /depot/data2/galaxy/phiX/base/phiX.fa
 #
 #and your /depot/data2/galaxy/phiX/base/ directory
 #would contain phiX.fa.* files:
@@ -22,8 +22,17 @@
 #...etc...
 #
 #Your bwa_index.loc file should include an entry per line for each
-#index set you have stored.  The "file" in the path does not actually
+#index set you have stored. The "file" in the path does not actually
 #exist, but it is the prefix for the actual index files.  For example:
 #
-#phiX	/depot/data2/galaxy/phiX/base/phiX.fa
-#hg18	/depot/data2/galaxy/hg18/base/hg18.fa
+#phiX174              phiX   phiX174          /depot/data2/galaxy/phiX/base/phiX.fa
+#hg18canon            hg18   hg18 Canonical   /depot/data2/galaxy/hg18/base/hg18canon.fa
+#hg18full             hg18   hg18 Full        /depot/data2/galaxy/hg18/base/hg18full.fa
+#/orig/path/hg19.fa   hg19   hg19             /depot/data2/galaxy/hg19/base/hg19.fa
+#...etc...
+#
+#Note that for backwards compatibility with workflows, the unique ID of
+#an entry must be the path that was in the original loc file, because that
+#is the value stored in the workflow for that parameter. That is why the
+#hg19 entry above looks odd. New genomes can be better-looking.
+#
diff --git a/tool-data/lastz_seqs.loc.sample b/tool-data/lastz_seqs.loc.sample
index 75763949023..def67ec684e 100644
--- a/tool-data/lastz_seqs.loc.sample
+++ b/tool-data/lastz_seqs.loc.sample
@@ -1,17 +1,17 @@
 #This is a sample file distributed with Galaxy that enables tools
-#to use a directory of 2bit genome files for use with Lastz.  You will 
-#need to supply these files and then create a lastz_seqs.loc file 
-#similar to this one (store it in this directory) that points to 
-#the directories in which those files are stored. The lastz_seqs.loc 
+#to use a directory of 2bit genome files for use with Lastz. You will
+#need to supply these files and then create a lastz_seqs.loc file
+#similar to this one (store it in this directory) that points to
+#the directories in which those files are stored. The lastz_seqs.loc
 #file has this format (white space characters are TAB characters):
 #
-#<build>	<file_path>
+#<unique_build_id>   <display_name>   <file_path>
 #
 #So, for example, if your lastz_seqs.loc began like this:
 #
-#hg18	/depot/data2/galaxy/twobit/hg18.2bit
-#hg19	/depot/data2/galaxy/twobit/hg19.2bit
-#mm9	/depot/data2/galaxy/twobit/mm9.2bit
+#hg18   Human (Homo sapiens): hg18   /depot/data2/galaxy/twobit/hg18.2bit
+#hg19   Human (Homo sapiens): hg19   /depot/data2/galaxy/twobit/hg19.2bit
+#mm9    Mouse (Mus musculus): mm9    /depot/data2/galaxy/twobit/mm9.2bit
 #
 #then your /depot/data2/galaxy/twobit/ directory
 #would need to contain the following 2bit files:
@@ -22,4 +22,9 @@
 #
 #Your lastz_seqs.loc file should include an entry per line for 
 #each file you have stored that you want to be available. Note that 
-#your files should all have the extension '2bit'. 
\ No newline at end of file
+#your files should all have the extension '2bit'.
+#
+#Note that for backwards compatibility with workflows, the unique ID of
+#an entry must be the path that was in the original loc file, because that
+#is the value stored in the workflow for that parameter. 
+#
diff --git a/tool-data/perm_base_index.loc.sample b/tool-data/perm_base_index.loc.sample
index 94b228b5e34..fddaa86de8c 100644
--- a/tool-data/perm_base_index.loc.sample
+++ b/tool-data/perm_base_index.loc.sample
@@ -3,9 +3,9 @@
 #to create these data files and then create a perm_base_index.loc file 
 #similar to this one (store it in this directory) that points to 
 #the directories in which those files are stored. The perm_base_index.loc 
-#file has this format (white space characters are TAB characters):
+#file has this format (longer white space characters are TAB characters):
 #
-#<build_seed_readlength>	<file_base>
+#<build_seed_readlength>    <display_name>    <file_base>
 #
 #Because each PerM index is built with a specific seed and a specific read
 #length, this needs to be specified so the user can choose the appropriate
@@ -13,7 +13,7 @@
 #50, and stored in /depot/data/galaxy/phiX/perm_index/,
 #then the perm_base_index.loc entry would look something like this:
 #
-#phiX_F3_50	/depot/data/galaxy/phiX/perm_index/phiX_base_F3_50.index
+#phiX_F3_50    phiX: seed=F3, read length=50    /depot/data/galaxy/phiX/perm_index/phiX_base_F3_50.index
 #
 #and your /depot/data/galaxy/phiX/perm_index/ directory
 #would contain the file phiX_base_F3_50.index:
@@ -21,7 +21,8 @@
 #Your perm_base_index.loc file should include an entry per line for each
 #index set you have stored. For example:
 #
-#phiX_F3_50	/depot/data/galaxy/phiX/perm_index/phiX_base_F3_50.index
-#phiX_F4_50	/depot/data/galaxy/phiX/perm_index/phiX_base_F3_50.index
-#hg19_F3_50	/depot/data/galaxy/hg19/perm_index/hg19_base_F3_50.index
-#hg19_F4_50	/depot/data/galaxy/hg19/perm_index/hg19_base_F3_50.index
+#phiX_F3_50    /depot/data/galaxy/phiX/perm_index/phiX_base_F3_50.index
+#phiX_F4_50    /depot/data/galaxy/phiX/perm_index/phiX_base_F3_50.index
+#hg19_F3_50    /depot/data/galaxy/hg19/perm_index/hg19_base_F3_50.index
+#hg19_F4_50    /depot/data/galaxy/hg19/perm_index/hg19_base_F3_50.index
+#
diff --git a/tool-data/perm_color_index.loc.sample b/tool-data/perm_color_index.loc.sample
index 2f45b4bca77..1ef6c14d890 100644
--- a/tool-data/perm_color_index.loc.sample
+++ b/tool-data/perm_color_index.loc.sample
@@ -5,7 +5,7 @@
 #the directories in which those files are stored. The perm_color_index.loc 
 #file has this format (white space characters are TAB characters):
 #
-#<build_seed_readlength>	<file_base>
+#<build_seed_readlength>    <display_name>    <file_base>
 #
 #Because each PerM index is built with a specific seed and a specific read
 #length, this needs to be specified so the user can choose the appropriate
@@ -13,7 +13,7 @@
 #50, and stored in /depot/data/galaxy/phiX/perm_index/,
 #then the perm_color_index.loc entry would look something like this:
 #
-#phiX_F3_50	/depot/data/galaxy/phiX/perm_index/phiX_color_F3_50.index
+#phiX_F3_50    phiX: seed=F3, read length=50    /depot/data/galaxy/phiX/perm_index/phiX_color_F3_50.index
 #
 #and your /depot/data/galaxy/phiX/perm_index/ directory
 #would contain the file phiX_color_F3_50.index:
@@ -21,7 +21,8 @@
 #Your perm_color_index.loc file should include an entry per line for each
 #index set you have stored. For example:
 #
-#phiX_F3_50	/depot/data/galaxy/phiX/perm_index/phiX_color_F3_50.index
-#phiX_F4_50	/depot/data/galaxy/phiX/perm_index/phiX_color_F3_50.index
-#hg19_F3_50	/depot/data/galaxy/hg19/perm_index/hg19_color_F3_50.index
-#hg19_F4_50	/depot/data/galaxy/hg19/perm_index/hg19_color_F3_50.index
+#phiX_F3_50    /depot/data/galaxy/phiX/perm_index/phiX_color_F3_50.index
+#phiX_F4_50    /depot/data/galaxy/phiX/perm_index/phiX_color_F3_50.index
+#hg19_F3_50    /depot/data/galaxy/hg19/perm_index/hg19_color_F3_50.index
+#hg19_F4_50    /depot/data/galaxy/hg19/perm_index/hg19_color_F3_50.index
+#
diff --git a/tool-data/srma_index.loc.sample b/tool-data/srma_index.loc.sample
index 9c6bcca6d3e..ad8c0938462 100644
--- a/tool-data/srma_index.loc.sample
+++ b/tool-data/srma_index.loc.sample
@@ -3,15 +3,15 @@
 #to create these data files and then create a srma_index.loc file 
 #similar to this one (store it in this directory) that points to 
 #the directories in which those files are stored. The srma_index.loc 
-#file has this format (white space is the TAB character):
+#file has this format (longer white space is the TAB character):
 #
-#<build>	<fasta_file>
+#<unique_build_id>   <dbkey>   <display_name>   <fasta_file_path>
 #
 #So, for example, if you had hg18 indexed and stored in 
 #/depot/data2/galaxy/srma/hg18/, 
 #then the srma_index.loc entry would look like this:
 #
-#hg18	/depot/data2/galaxy/srma/hg18/hg18.fa
+#hg18   hg18   hg18 Pretty   /depot/data2/galaxy/srma/hg18/hg18.fa
 #
 #and your /depot/data2/galaxy/srma/hg18/ directory
 #would contain the following three files:
@@ -23,3 +23,4 @@
 #created via Picard (http://picard.sourceforge.net). Note that
 #the dict file does not have the .fa extension although the
 #path list in the loc file does include it.
+#
diff --git a/tool_data_table_conf.xml.sample b/tool_data_table_conf.xml.sample
index a08299bb45a..ad0e387926b 100644
--- a/tool_data_table_conf.xml.sample
+++ b/tool_data_table_conf.xml.sample
@@ -1,17 +1,37 @@
 <tables>
+    <!-- Locations of all fasta files under genome directory -->
+    <table name="all_fasta" comment_char="#">
+        <columns>value, dbkey, name, path</columns>
+        <file path="tool-data/all_fasta.loc" />
+    </table>
     <!-- Locations of indexes in the BFAST mapper format -->
     <table name="bfast_indexes" comment_char="#">
         <columns>value, dbkey, formats, name, path</columns>
         <file path="tool-data/bfast_indexes.loc" />
     </table>
+    <!-- Locations of nucleotide (mega)blast databases -->
+    <table name="blastdb" comment_char="#">
+        <columns>value, name, path</columns>
+        <file path="tool-data/blastdb.loc" />
+    </table>
+    <!-- Locations of protein (mega)blast databases -->
+    <table name="blastdb_p" comment_char="#">
+        <columns>value, name, path</columns>
+        <file path="tool-data/blastdb_p.loc" />
+    </table>
     <!-- Locations of indexes in the Bowtie mapper format -->
-    <table name="bowtie_indexes">
-        <columns>name, value</columns>
+    <table name="bowtie_indexes" comment_char="#">
+        <columns>value, dbkey, name, path</columns>
         <file path="tool-data/bowtie_indices.loc" />
     </table>
+    <!-- Locations of indexes in the Bowtie color mapper format -->
+    <table name="bowtie_indexes_color" comment_char="#">
+        <columns>value, dbkey, name, path</columns>
+        <file path="tool-data/bowtie_indices_color.loc" />
+    </table>
     <!-- Locations of indexes in the BWA mapper format -->
-    <table name="bwa_indexes">
-        <columns>name, value</columns>
+    <table name="bwa_indexes" comment_char="#">
+        <columns>value, dbkey, name, path</columns>
         <file path="tool-data/bwa_index.loc" />
     </table>
     <!-- Locations of MAF files that have been indexed with bx-python -->    
@@ -24,4 +44,30 @@
         <columns>value, dbkey, name, path</columns>
         <file path="tool-data/ngs_sim_fasta.loc" />
     </table>
+    <!-- Locations of 2bit sequence files for use in Lastz -->
+    <table name="lastz_seqs" comment_char="#">
+        <columns>value, name, path</columns>
+        <file path="tool-data/lastz_seqs.loc" />
+    </table>
+    <!-- Locations of PerM base index files -->
+    <table name="perm_base_indexes" comment_char="#">
+        <columns>value, name, path</columns>
+        <file path="tool-data/perm_base_index.loc" />
+    </table>
+    <!-- Locations of PerM color index files -->
+    <table name="perm_color_indexes" comment_char="#">
+        <columns>value, name, path</columns>
+        <file path="tool-data/perm_color_index.loc" />
+    </table>
+    <!-- Location of SRMA dict file and other files -->
+    <table name="srma_indexes" comment_char="#">
+        <columns>value, dbkey, name, path</columns>
+        <file path="tool-data/srma_index.loc" />
+    </table>
+    <!-- Locations of indexes in the Bowtie mapper format for TopHat to use -->
+<!--    <table name="tophat_indexes" comment_char="#">
+        <columns>value, dbkey, name, path</columns>
+        <file path="tool-data/bowtie_indices.loc" />
+    </table>
+-->
 </tables>
diff --git a/tools/metag_tools/megablast_wrapper.py b/tools/metag_tools/megablast_wrapper.py
index 34a57894c8a..68060a87c59 100644
--- a/tools/metag_tools/megablast_wrapper.py
+++ b/tools/metag_tools/megablast_wrapper.py
@@ -29,15 +29,12 @@ def stop_err( msg ):
 def __main__():
     #Parse Command Line
     options, args = doc_optparse.parse( __doc__ )
-
-    db_build = options.db_build
     query_filename = options.input.strip()
     output_filename = options.output.strip()
     mega_word_size = options.word_size        # -W
     mega_iden_cutoff = options.identity_cutoff      # -p
     mega_evalue_cutoff = options.eval_cutoff      # -e
     mega_temp_output = tempfile.NamedTemporaryFile().name
-    mega_filter = options.filter_query           # -F
     GALAXY_DATA_INDEX_DIR = options.index_dir
     DB_LOC = "%s/blastdb.loc" % GALAXY_DATA_INDEX_DIR
 
@@ -47,30 +44,20 @@ def __main__():
     except:
         stop_err( 'Invalid value for word size' )
     try:
-        float(mega_iden_cutoff)
+        float( mega_iden_cutoff )
     except:
         stop_err( 'Invalid value for identity cut-off' )
     try:
-        float(mega_evalue_cutoff)
+        float( mega_evalue_cutoff )
     except:
         stop_err( 'Invalid value for Expectation value' )
 
-    # prepare the database
-    db = {}
-    for i, line in enumerate( file( DB_LOC ) ):
-        line = line.rstrip( '\r\n' )
-        if not line or line.startswith( '#' ):
-            continue
-        fields = line.split( '\t' )
-        db[ fields[0] ] = fields[1]
+    if not os.path.exists( os.path.split( options.db_build )[0] ):
+        stop_err( 'Cannot locate the target database directory. Please check your location file.' )
 
-    if not db.has_key( db_build ):
-        stop_err( 'Cannot locate the target database. Please check your location file.' )
-
-    # arguments for megablast    
-    chunk = db[ ( db_build ) ]
-    megablast_command = "megablast -d %s -i %s -o %s -m 8 -a 8 -W %s -p %s -e %s -F %s > /dev/null " \
-        % ( chunk, query_filename, mega_temp_output, mega_word_size, mega_iden_cutoff, mega_evalue_cutoff, mega_filter ) 
+    # arguments for megablast
+    megablast_command = "megablast -d %s -i %s -o %s -m 8 -a 8 -W %s -p %s -e %s -F %s > /dev/null" \
+        % ( options.db_build, query_filename, mega_temp_output, mega_word_size, mega_iden_cutoff, mega_evalue_cutoff, options.filter_query ) 
 
     print megablast_command
 
diff --git a/tools/metag_tools/megablast_wrapper.xml b/tools/metag_tools/megablast_wrapper.xml
index ec2a654b60c..92092e8d0a6 100644
--- a/tools/metag_tools/megablast_wrapper.xml
+++ b/tools/metag_tools/megablast_wrapper.xml
@@ -1,31 +1,28 @@
-<tool id="megablast_wrapper" name="Megablast" version="1.0.5">
+<tool id="megablast_wrapper" name="Megablast" version="1.1.0">
     <description> compare short reads against htgs, nt, and wgs databases</description>
     <command interpreter="python">
-      megablast_wrapper.py 
-       --db_build="$source_select"
-       --input=$input_query
-       --word_size=$word_size
-       --identity_cutoff=$iden_cutoff
-       --eval_cutoff=$evalue_cutoff 
-       --filter_query=$filter_query
-       --index_dir=${GALAXY_DATA_INDEX_DIR}
-       --output=$output1
+      megablast_wrapper.py
+        --db_build="${ filter( lambda x: str( x[0] ) == str( $source_select ), $__app__.tool_data_tables[ 'blastdb' ].get_fields() )[0][-1] }"
+        --input=$input_query
+        --word_size=$word_size
+        --identity_cutoff=$iden_cutoff
+        --eval_cutoff=$evalue_cutoff 
+        --filter_query=$filter_query
+        --index_dir=${GALAXY_DATA_INDEX_DIR}
+        --output=$output1
     </command>
     <inputs>
         <param name="input_query" type="data" format="fasta" label="Compare these sequences"/> 
         <param name="source_select" type="select" display="radio" label="against target database">
-            <options from_file="blastdb.loc">
-              <column name="name" index="0"/>
-              <column name="value" index="0"/>
-            </options>
+            <options from_data_table="blastdb" />
         </param>
-        <param name="word_size" type="select" label="using word size" help="Size of best perfect match">
+        <param name="word_size" type="select" label="using word size" help="Size of best perfect match (-W)">
             <option value="28">28</option>
             <option value="16">16</option>
         </param>
-        <param name="iden_cutoff" type="float" size="15" value="90.0" label="report hits above this identity" help="no cutoff if 0" />
-        <param name="evalue_cutoff" type="float" size="15" value="0.001" label="set expectation value cutoff" />
-        <param name="filter_query" type="select" label="Filter out low complexity regions?">
+        <param name="iden_cutoff" type="float" size="15" value="90.0" label="report hits above this identity (-p)" help="no cutoff if 0" />
+        <param name="evalue_cutoff" type="float" size="15" value="0.001" label="set expectation value cutoff (-e)" />
+        <param name="filter_query" type="select" label="Filter out low complexity regions? (-F)">
             <option value="T">Yes</option>
             <option value="F">No</option>
         </param>
@@ -40,7 +37,7 @@
         <test>
             <param name="input_query" value="megablast_wrapper_test1.fa" ftype="fasta"/>
             <!-- source_select needs to match the entry in the blastdb.loc file, which includes the last update date if appropriate --> 
-            <param name="source_select" value="phiX" />
+            <param name="source_select" value="/galaxy/data/blastdb/phiX/phiX" />
             <param name="word_size" value="28" />
             <param name="iden_cutoff" value="99.0" />
             <param name="evalue_cutoff" value="10.0" />
diff --git a/tools/ncbi_blast_plus/ncbi_blastn_wrapper.xml b/tools/ncbi_blast_plus/ncbi_blastn_wrapper.xml
index 33141688f3a..6e71809176b 100644
--- a/tools/ncbi_blast_plus/ncbi_blastn_wrapper.xml
+++ b/tools/ncbi_blast_plus/ncbi_blastn_wrapper.xml
@@ -1,4 +1,4 @@
-<tool id="ncbi_blastn_wrapper" name="NCBI BLAST+ blastn" version="0.0.1">
+<tool id="ncbi_blastn_wrapper" name="NCBI BLAST+ blastn" version="0.0.5">
     <description>Search nucleotide database with nucleotide query sequence(s)</description>
     <command>
 ## The command is a Cheetah template which allows some Python based syntax.
@@ -36,9 +36,10 @@ $adv_opts.ungapped
             </param>
             <when value="db">
                 <param name="database" type="select" label="Nucleotide BLAST database">
+                    <!-- <options from_data_table="blastdb" /> -->
                     <options from_file="blastdb.loc">
-                      <column name="name" index="0"/>
-                      <column name="value" index="1"/>
+                      <column name="name" index="2"/>
+                      <column name="value" index="0"/>
                     </options>
                 </param>
                 <param name="subject" type="hidden" value="" /> 
diff --git a/tools/ncbi_blast_plus/ncbi_blastp_wrapper.xml b/tools/ncbi_blast_plus/ncbi_blastp_wrapper.xml
index f73ee45e1ac..6861edb6edd 100644
--- a/tools/ncbi_blast_plus/ncbi_blastp_wrapper.xml
+++ b/tools/ncbi_blast_plus/ncbi_blastp_wrapper.xml
@@ -1,4 +1,4 @@
-<tool id="ncbi_blastp_wrapper" name="NCBI BLAST+ blastp" version="0.0.1">
+<tool id="ncbi_blastp_wrapper" name="NCBI BLAST+ blastp" version="0.0.5">
     <description>Search protein database with protein query sequence(s)</description>
     <command>
 ## The command is a Cheetah template which allows some Python based syntax.
@@ -37,9 +37,10 @@ $out_format
             </param>
             <when value="db">
                 <param name="database" type="select" label="Protein BLAST database">
+                    <!-- <options from_data_table="blastdb_p" /> -->
                     <options from_file="blastdb_p.loc">
-                      <column name="name" index="0"/>
-                      <column name="value" index="1"/>
+                      <column name="name" index="2"/>
+                      <column name="value" index="0"/>
                     </options>
                 </param>
                 <param name="subject" type="hidden" value="" /> 
diff --git a/tools/ncbi_blast_plus/ncbi_blastx_wrapper.xml b/tools/ncbi_blast_plus/ncbi_blastx_wrapper.xml
index 0e2c93afa27..81bdaaf2970 100644
--- a/tools/ncbi_blast_plus/ncbi_blastx_wrapper.xml
+++ b/tools/ncbi_blast_plus/ncbi_blastx_wrapper.xml
@@ -1,4 +1,4 @@
-<tool id="ncbi_blastx_wrapper" name="NCBI BLAST+ blastx" version="0.0.1">
+<tool id="ncbi_blastx_wrapper" name="NCBI BLAST+ blastx" version="0.0.5">
     <description>Search protein database with translated nucleotide query sequence(s)</description>
     <command>
 ## The command is a Cheetah template which allows some Python based syntax.
@@ -36,9 +36,10 @@ $adv_opts.ungapped
             </param>
             <when value="db">
                 <param name="database" type="select" label="Protein BLAST database">
+                    <!-- <options from_data_table="blastdb_p" /> -->
                     <options from_file="blastdb_p.loc">
-                      <column name="name" index="0"/>
-                      <column name="value" index="1"/>
+                      <column name="name" index="2"/>
+                      <column name="value" index="0"/>
                     </options>
                 </param>
                 <param name="subject" type="hidden" value="" /> 
diff --git a/tools/ncbi_blast_plus/ncbi_tblastn_wrapper.xml b/tools/ncbi_blast_plus/ncbi_tblastn_wrapper.xml
index 17d6ebbae0c..1ddbd7c2d3f 100644
--- a/tools/ncbi_blast_plus/ncbi_tblastn_wrapper.xml
+++ b/tools/ncbi_blast_plus/ncbi_tblastn_wrapper.xml
@@ -1,4 +1,4 @@
-<tool id="ncbi_tblastn_wrapper" name="NCBI BLAST+ tblastn" version="0.0.1">
+<tool id="ncbi_tblastn_wrapper" name="NCBI BLAST+ tblastn" version="0.0.5">
     <description>Search translated nucleotide database with protein query sequence(s)</description>
     <command>
 ## The command is a Cheetah template which allows some Python based syntax.
@@ -36,9 +36,10 @@ $out_format
             </param>
             <when value="db">
                 <param name="database" type="select" label="Nucleotide BLAST database">
+                    <!-- <options from_data_table="blastdb" /> -->
                     <options from_file="blastdb.loc">
-                      <column name="name" index="0"/>
-                      <column name="value" index="1"/>
+                      <column name="name" index="2"/>
+                      <column name="value" index="0"/>
                     </options>
                 </param>
                 <param name="subject" type="hidden" value="" /> 
diff --git a/tools/ncbi_blast_plus/ncbi_tblastx_wrapper.xml b/tools/ncbi_blast_plus/ncbi_tblastx_wrapper.xml
index 6b20733e65c..66f2ff3a499 100644
--- a/tools/ncbi_blast_plus/ncbi_tblastx_wrapper.xml
+++ b/tools/ncbi_blast_plus/ncbi_tblastx_wrapper.xml
@@ -1,4 +1,4 @@
-<tool id="ncbi_tblastx_wrapper" name="NCBI BLAST+ tblastx" version="0.0.1">
+<tool id="ncbi_tblastx_wrapper" name="NCBI BLAST+ tblastx" version="0.0.5">
     <description>Search translated nucleotide database with translated nucleotide query sequence(s)</description>
     <command>
 ## The command is a Cheetah template which allows some Python based syntax.
@@ -35,9 +35,10 @@ $out_format
             </param>
             <when value="db">
                 <param name="database" type="select" label="Nucleotide BLAST database">
+                    <!-- <options from_data_table="blastdb" /> -->
                     <options from_file="blastdb.loc">
-                      <column name="name" index="0"/>
-                      <column name="value" index="1"/>
+                      <column name="name" index="2"/>
+                      <column name="value" index="0"/>
                     </options>
                 </param>
                 <param name="subject" type="hidden" value="" /> 
diff --git a/tools/sr_mapping/PerM.xml b/tools/sr_mapping/PerM.xml
index 7e6e0da4e38..601bda39a06 100644
--- a/tools/sr_mapping/PerM.xml
+++ b/tools/sr_mapping/PerM.xml
@@ -1,49 +1,55 @@
-<tool id="PerM" name="Map with PerM" version="1.0.0">
+<tool id="PerM" name="Map with PerM" version="1.1.0">
   <description>for SOLiD and Illumina</description>
   <!-- works with PerM version 0.2.6 -->
   <requirements>
       <requirement type="package">perm</requirement>
   </requirements>
   <command>
-PerM
-#if $s.sourceOfRef.refSource == "history":
-    $s.sourceOfRef.ref
-#else:
-    $s.sourceOfRef.index
-#end if
-#if $s.mate.singleOrPairs == "single":
-    $s.mate.reads
-#else:
-    -1 $s.mate.reads1 -2 $s.mate.reads2
-    -U $s.mate.upperbound
-    -L $s.mate.lowerbound
-    $s.mate.excludeAmbiguousPairs
-#end if
-#if $s.space == "color":
-    --readFormat "csfastq"
-#else:
-    --readFormat "fastq"
-#end if
-#if $int($str($valAlign)) &gt;= 0:
-    -v $valAlign
-#end if
-#if $align.options == "full":
-    --seed $align.seed
-    -$align.alignments
-    #if $str($align.delimiter) != "None":
-        --delimiter $align.delimiter
-    #end if
-    -T $align.sTrimL
-    $align.includeReadsWN
-    $align.statsOnly
-    $align.ignoreQS
-#end if
-#if $str($bUnmappedRead) == "true" and $s.space == "color":
-  -u $unmappedReadOutCS
-#elif $str($bUnmappedRead) == "true" and $s.space == "base":
-  -u $unmappedReadOut
-#end if
--o $output --outputFormat sam --noSamHeader | tr '\r' '\n' | tr -cd "[:print:]\t\n " | grep "Reads\|Sub0\|Pairs\|single" | sed 's/.*Reads:,//' | sed 's/\/.*dat,_ Sub0/Sub0/'
+    PerM
+      #if $s.sourceOfRef.refSource == "history"
+        $s.sourceOfRef.ref
+      #else
+        #if $s.space == "color"
+          "${ filter( lambda x: str( x[0] ) == str( $s.sourceOfRef.index ), $__app__.tool_data_tables[ 'perm_color_indexes' ].get_fields() )[0][-1] }"
+        #elif $s.space == "base"
+          "${ filter( lambda x: str( x[0] ) == str( $s.sourceOfRef.index ), $__app__.tool_data_tables[ 'perm_base_indexes' ].get_fields() )[0][-1] }"
+        #end if
+      #end if
+      #if $s.mate.singleOrPairs == "single":
+        $s.mate.reads
+      #else:
+        -1 $s.mate.reads1 -2 $s.mate.reads2
+        -U $s.mate.upperbound
+        -L $s.mate.lowerbound
+        $s.mate.excludeAmbiguousPairs
+      #end if
+      #if $s.space == "color":
+        --readFormat "csfastq"
+      #else:
+        --readFormat "fastq"
+      #end if
+      #if $int($str($valAlign)) &gt;= 0
+        -v $valAlign
+      #end if
+      #if $align.options == "full":
+        --seed $align.seed
+        -$align.alignments
+        #if $str($align.delimiter) != "None"
+          --delimiter $align.delimiter
+        #end if
+        -T $align.sTrimL
+        $align.includeReadsWN
+        $align.statsOnly
+        $align.ignoreQS
+      #end if
+      #if $str($bUnmappedRead) == "true" and $s.space == "color"
+        -u $unmappedReadOutCS
+      #elif $str($bUnmappedRead) == "true" and $s.space == "base"
+        -u $unmappedReadOut
+      #end if
+      -o $output
+      --outputFormat sam
+      --noSamHeader | tr '\r' '\n' | tr -cd "[:print:]\t\n " | grep "Reads\|Sub0\|Pairs\|single" | sed 's/.*Reads:,//' | sed 's/\/.*dat,_ Sub0/Sub0/'
   </command>
   <inputs>
     <conditional name="s">
@@ -59,10 +65,7 @@ PerM
           </param>
           <when value="indexed">
             <param name="index" type="select" label="Select a reference genome (with seed and read length)" help="if your genome of interest is not listed - contact Galaxy team">
-              <options from_file="perm_color_index.loc">
-                <column name="value" index="1" />
-                <column name="name" index="0" />
-              </options>
+              <options from_data_table="perm_color_indexes"/>
             </param>
           </when>
           <when value="history">
@@ -94,10 +97,7 @@ PerM
           </param>
           <when value="indexed">
             <param name="index" type="select" label="Select a reference genome with seed and read length" help="if your genome of interest is not listed - contact Galaxy team">
-              <options from_file="perm_base_index.loc">
-                <column name="value" index="1" />
-                <column name="name" index="0" />
-              </options>
+              <options from_data_table="perm_base_indexes"/>
             </param>
           </when>
           <when value="history">
@@ -148,7 +148,7 @@ PerM
         </param>
         <param label="Use the first n bases of each read for alignment (-T)" name="sTrimL" type="integer" size="5" value="50" />
         <param name="includeReadsWN" type="boolean" checked="true" truevalue="--includeReadsWN" falsevalue="" label="Include reads with 'N' or '.' by encoding '.' as 3, 'N' as 'A' (--includeReadsWN)" /> 
-        <param name="statsOnly" type="boolean" checked="false" truevalue="--statsOnly" falsevalue="" label="output mapping stats only. Don't output alignments (--statsOnly)" />
+        <param name="statsOnly" type="boolean" checked="false" truevalue="--statsOnly" falsevalue="" label="Output mapping stats only. Don't output alignments (--statsOnly)" />
         <param name="ignoreQS" type="boolean" checked="false" truevalue="--ignoreQS" falsevalue="" label="Ignore quality scores (--ignoreQS)" />
       </when>
     </conditional> <!-- options -->
@@ -170,8 +170,7 @@ PerM
     <test>
       <!--
       PerM command:
-      PerM test-data/phiX.fasta 50 +seed F3 -m -s phiX_F3_50.index +readFormat .fastq
-      PerM phiX_F3_50.index -1 test-data/perm_in1.fastqsanger -2 test-data/perm_in2.fastqsanger -U 100000 -L 0 -e +readFormat .fastq -v 0 +seed F2 -A -T 50 +includeReadsWN -o perm_out1.sam +outputFormat sam +noSamHeader | tr '\r' '\n' | tr -cd "[:print:]\t\n " | grep "Reads\|Sub0\|Pairs\|single" | sed 's/.*Reads:,//' | sed 's/\/.*dat,_ Sub0/Sub0/'
+      PerM /afs/bx.psu.edu/depot/data/genome/phiX/perm_index/phiX_base_F3_50.index -1 test-data/perm_in1.fastqsanger -2 test-data/perm_in2.fastqsanger -U 100000 -L 0 -e +readFormat fastq -v 0 +seed F3 -A -T 50 +includeReadsWN -o perm_out1.sam +outputFormat sam +noSamHeader | tr '\r' '\n' | tr -cd "[:print:]\t\n " | grep "Reads\|Sub0\|Pairs\|single" | sed 's/.*Reads:,//' | sed 's/\/.*dat,_ Sub0/Sub0/'
       You need to replace the + with 2 dashes.
       -->
       <param name="space" value="base" />
@@ -186,7 +185,7 @@ PerM
       <param name="valAlign" value="0" />
       <param name="options" value="full" />
       <param name="alignments" value="A" />
-      <param name="seed" value="F2" />
+      <param name="seed" value="F3" />
       <param name="delimiter" value="None" />
       <param name="sTrimL" value="50" />
       <param name="includeReadsWN" value="true" />
@@ -198,7 +197,7 @@ PerM
     <test>
       <!--
       PerM command:
-      PerM test-data/chr_m.fasta test-data/perm_in3.fastqsanger +readFormat .fastq -v 2 -u perm_out3.fastqsanger -o perm_out2.sam +outputFormat sam +noSamHeader | tr '\r' '\n' | tr -cd "[:print:]\t\n " | grep "Reads\|Sub0\|Pairs\|single" | sed 's/.*Reads:,//' | sed 's/\/.*dat,_ Sub0/Sub0/'
+      PerM test-data/chr_m.fasta test-data/perm_in3.fastqsanger +readFormat fastq -v 2 -u perm_out3.fastqsanger -o perm_out2.sam +outputFormat sam +noSamHeader | tr '\r' '\n' | tr -cd "[:print:]\t\n " | grep "Reads\|Sub0\|Pairs\|single" | sed 's/.*Reads:,//' | sed 's/\/.*dat,_ Sub0/Sub0/'
       You need to replace the + with 2 dashes.
       -->
       <param name="space" value="base" />
@@ -215,7 +214,7 @@ PerM
     <test>
       <!--
       PerM command:
-      PerM test-data/phiX.fasta test-data/perm_in4.fastqcssanger +readFormat .csfastq -v 1 -o perm_out4.sam +outputFormat sam +noSamHeader | tr '\r' '\n' | tr -cd "[:print:]\t\n " | grep "Reads\|Sub0\|Pairs\|single" | sed 's/.*Reads:,//' | sed 's/\/.*dat,_ Sub0/Sub0/'
+      PerM test-data/phiX.fasta test-data/perm_in4.fastqcssanger +readFormat csfastq -v 1 -o perm_out4.sam +outputFormat sam +noSamHeader | tr '\r' '\n' | tr -cd "[:print:]\t\n " | grep "Reads\|Sub0\|Pairs\|single" | sed 's/.*Reads:,//' | sed 's/\/.*dat,_ Sub0/Sub0/'
       You need to replace the + with 2 dashes.
       -->
       <param name="space" value="color" />
@@ -231,14 +230,12 @@ PerM
     <test>
       <!--
       PerM command:
-      PerM equCab2.fasta 50 +seed F4 -m -s equCab2_F3_50.index +readFormat .csfastq
-      PerM equCab2_F3_50.index -1 test-data/perm_in5.fastqcssanger -2 test-data/perm_in6.fastqcssanger -U 90000 -L 10000 +readFormat .csfastq -v 3 -o perm_out5.sam +outputFormat sam +noSamHeader | tr '\r' '\n' | tr -cd "[:print:]\t\n " | grep "Reads\|Sub0\|Pairs\|single" | sed 's/.*Reads:,//' | sed 's/\/.*dat,_ Sub0/Sub0/'
+      PerM /afs/bx.psu.edu/depot/data/genome/equCab2/perm_index/equCab2_chrM_color_F2_50.index -1 test-data/perm_in5.fastqcssanger -2 test-data/perm_in6.fastqcssanger -U 90000 -L 10000 +readFormat csfastq -v 3 +seed F2-o perm_out5.sam +outputFormat sam +noSamHeader | tr '\r' '\n' | tr -cd "[:print:]\t\n " | grep "Reads\|Sub0\|Pairs\|single" | sed 's/.*Reads:,//' | sed 's/\/.*dat,_ Sub0/Sub0/'
       You need to replace the + with 2 dashes.
-      hg19.fasta needs to be supplied.
       -->
       <param name="space" value="color" />
       <param name="refSource" value="indexed" />
-      <param name="index" value="equCab2_chrM_F3_50" />
+      <param name="index" value="equCab2_chrM_F2_50" />
       <param name="singleOrPairs" value="paired" />
       <param name="reads1" value="perm_in5.fastqcssanger" ftype="fastqcssanger" />
       <param name="reads2" value="perm_in6.fastqcssanger" ftype="fastqcssanger" />
diff --git a/tools/sr_mapping/bowtie_color_wrapper.xml b/tools/sr_mapping/bowtie_color_wrapper.xml
index 71ceb52749f..2a7c73d0afa 100644
--- a/tools/sr_mapping/bowtie_color_wrapper.xml
+++ b/tools/sr_mapping/bowtie_color_wrapper.xml
@@ -1,4 +1,4 @@
-<tool id="bowtie_color_wrapper" name="Map with Bowtie for SOLiD" version="1.0.0">
+<tool id="bowtie_color_wrapper" name="Map with Bowtie for SOLiD" version="1.1.0">
   <requirements><requirement type='package'>bowtie</requirement></requirements>
   <description></description>
   <command interpreter="python">
@@ -9,191 +9,105 @@
     --suppressHeader=$suppressHeader 
     --genomeSource=$refGenomeSource.genomeSource
     #if $refGenomeSource.genomeSource == "history":
-       #if $refGenomeSource.ownFile.extension.startswith( 'bowtie_' ):
-       --ref="${refGenomeSource.ownFile.extra_files_path}/${refGenomeSource.ownFile.metadata.base_name}"
-       --do_not_build_index
-       #else:
-     --ref=$refGenomeSource.ownFile
-     --indexSettings=$refGenomeSource.indexParams.indexSettings
-     #if $refGenomeSource.indexParams.indexSettings == "indexFull":
-      --iautoB=$refGenomeSource.indexParams.autoBehavior.autoB
-      #if $refGenomeSource.indexParams.autoBehavior.autoB == "set":
-       --ipacked=$refGenomeSource.indexParams.autoBehavior.packed
-       --ibmax=$refGenomeSource.indexParams.autoBehavior.bmax
-       --ibmaxdivn=$refGenomeSource.indexParams.autoBehavior.bmaxdivn
-       --idcv=$refGenomeSource.indexParams.autoBehavior.dcv
+      ##index already exists
+      #if $refGenomeSource.ownFile.extension.startswith( 'bowtie_' ):
+        ##user previously built
+        --ref="${refGenomeSource.ownFile.extra_files_path}/${refGenomeSource.ownFile.metadata.base_name}"
+        --do_not_build_index
       #else:
-       --ipacked="None"
-       --ibmax="None"
-       --ibmaxdivn="None"
-       --idcv="None"
+        ##build index on the fly
+        --ref=$refGenomeSource.ownFile
+        --indexSettings=$refGenomeSource.indexParams.indexSettings
+        #if $refGenomeSource.indexParams.indexSettings == "indexFull":
+          --iautoB=$refGenomeSource.indexParams.autoBehavior.autoB
+          #if $refGenomeSource.indexParams.autoBehavior.autoB == "set":
+            --ipacked=$refGenomeSource.indexParams.autoBehavior.packed
+            --ibmax=$refGenomeSource.indexParams.autoBehavior.bmax
+            --ibmaxdivn=$refGenomeSource.indexParams.autoBehavior.bmaxdivn
+            --idcv=$refGenomeSource.indexParams.autoBehavior.dcv
+          #end if
+          --inodc=$refGenomeSource.indexParams.nodc
+          --inoref=$refGenomeSource.indexParams.noref
+          --ioffrate=$refGenomeSource.indexParams.offrate
+          --iftab=$refGenomeSource.indexParams.ftab
+          --intoa=$refGenomeSource.indexParams.ntoa
+          --iendian=$refGenomeSource.indexParams.endian
+          --iseed=$refGenomeSource.indexParams.seed
+          --icutoff=$refGenomeSource.indexParams.cutoff
+        #end if
       #end if
-      --inodc=$refGenomeSource.indexParams.nodc
-      --inoref=$refGenomeSource.indexParams.noref
-      --ioffrate=$refGenomeSource.indexParams.offrate
-      --iftab=$refGenomeSource.indexParams.ftab
-      --intoa=$refGenomeSource.indexParams.ntoa
-      --iendian=$refGenomeSource.indexParams.endian
-      --iseed=$refGenomeSource.indexParams.seed
-      --icutoff=$refGenomeSource.indexParams.cutoff
-     #else:
-      --iautoB="None"
-      --ipacked="None"
-      --ibmax="None"
-      --ibmaxdivn="None"
-      --idcv="None"
-      --inodc="None"
-      --inoref="None"
-      --ioffrate="None"
-      --iftab="None"
-      --intoa="None"
-      --iendian="None"
-      --iseed="None"
-      --icutoff="None"
-     #end if
-     #end if
-    #else:
-     --ref=$refGenomeSource.index
-     --indexSettings="None"
-     --iautoB="None"
-     --ipacked="None"
-     --ibmax="None"
-     --ibmaxdivn="None"
-     --idcv="None"
-     --inodc="None"
-     --inoref="None"
-     --ioffrate="None"
-     --iftab="None"
-     --intoa="None"
-     --iendian="None"
-     --iseed="None"
-     --icutoff="None"
+    #else
+      ##use pre-built index
+      --ref="${ filter( lambda x: str( x[0] ) == str( $refGenomeSource.index ), $__app__.tool_data_tables[ 'bowtie_indexes_color' ].get_fields() )[0][-1] }"
     #end if
     --paired=$singlePaired.sPaired
     #if $singlePaired.sPaired == "single":
-     --input1=$singlePaired.sInput1
-     --input2="None"
-     --params=$singlePaired.sParams.sSettingsType
-     #if $singlePaired.sParams.sSettingsType == "full":
-      --skip=$singlePaired.sParams.sSkip
-      --alignLimit=$singlePaired.sParams.sAlignLimit
-      --trimH=$singlePaired.sParams.sTrimH
-      --trimL=$singlePaired.sParams.sTrimL
-      --mismatchSeed=$singlePaired.sParams.sMismatchSeed
-      --mismatchQual=$singlePaired.sParams.sMismatchQual
-      --seedLen=$singlePaired.sParams.sSeedLen
-      --rounding=$singlePaired.sParams.sRounding
-      --maqSoapAlign=$singlePaired.sParams.sMaqSoapAlign
-      --tryHard=$singlePaired.sParams.sTryHard
-      --valAlign=$singlePaired.sParams.sValAlign
-      --allValAligns=$singlePaired.sParams.sAllValAligns
-      --suppressAlign=$singlePaired.sParams.sSuppressAlign
-      --best=$singlePaired.sParams.sBestOption.sBest
-      #if $singlePaired.sParams.sBestOption.sBest == "doBest":
-       --maxBacktracks=$singlePaired.sParams.sBestOption.sdMaxBacktracks
-       --strata=$singlePaired.sParams.sBestOption.sdStrata
-      #else:
-       --maxBacktracks=$singlePaired.sParams.sBestOption.snMaxBacktracks
-       --strata="None"
+      --input1=$singlePaired.sInput1
+      --params=$singlePaired.sParams.sSettingsType
+      #if $singlePaired.sParams.sSettingsType == "full":
+        --skip=$singlePaired.sParams.sSkip
+        --alignLimit=$singlePaired.sParams.sAlignLimit
+        --trimH=$singlePaired.sParams.sTrimH
+        --trimL=$singlePaired.sParams.sTrimL
+        --mismatchSeed=$singlePaired.sParams.sMismatchSeed
+        --mismatchQual=$singlePaired.sParams.sMismatchQual
+        --seedLen=$singlePaired.sParams.sSeedLen
+        --rounding=$singlePaired.sParams.sRounding
+        --maqSoapAlign=$singlePaired.sParams.sMaqSoapAlign
+        --tryHard=$singlePaired.sParams.sTryHard
+        --valAlign=$singlePaired.sParams.sValAlign
+        --allValAligns=$singlePaired.sParams.sAllValAligns
+        --suppressAlign=$singlePaired.sParams.sSuppressAlign
+        --best=$singlePaired.sParams.sBestOption.sBest
+        #if $singlePaired.sParams.sBestOption.sBest == "doBest":
+          --maxBacktracks=$singlePaired.sParams.sBestOption.sdMaxBacktracks
+          --strata=$singlePaired.sParams.sBestOption.sdStrata
+        #else:
+          --maxBacktracks=$singlePaired.sParams.sBestOption.snMaxBacktracks
+        #end if
+        --offrate=$singlePaired.sParams.sOffrate
+        --seed=$singlePaired.sParams.sSeed
+        --snpphred=$singlePaired.sParams.sSnpphred
+        --snpfrac=$singlePaired.sParams.sSnpfrac
+        --keepends=$singlePaired.sParams.sKeepends
       #end if
-      --offrate=$singlePaired.sParams.sOffrate
-      --seed=$singlePaired.sParams.sSeed
-      --snpphred=$singlePaired.sParams.sSnpphred
-      --snpfrac=$singlePaired.sParams.sSnpfrac
-      --keepends=$singlePaired.sParams.sKeepends
-     #else:
-      --skip="None"
-      --alignLimit="None"
-      --trimH="None"
-      --trimL="None"
-      --mismatchSeed="None"
-      --mismatchQual="None"
-      --seedLen="None"
-      --rounding="None"
-      --maqSoapAlign="None"
-      --tryHard="None"
-      --valAlign="None"
-      --allValAligns="None"
-      --suppressAlign="None"
-      --best="None"
-      --maxBacktracks="None"
-      --strata="None"
-      --offrate="None"
-      --seed="None"
-      --snpphred="None"
-      --snpfrac="None"
-      --keepends="None"
-     #end if
-     --minInsert="None"
-     --maxInsert="None"
-     --mateOrient="None"
-     --maxAlignAttempt="None"
-     --forwardAlign="None"
-     --reverseAlign="None"
     #else:
-     --input1=$singlePaired.pInput1
-     --input2=$singlePaired.pInput2
-     --maxInsert=$singlePaired.pMaxInsert
-     --mateOrient=$singlePaired.pMateOrient
-     --params=$singlePaired.pParams.pSettingsType
-     #if $singlePaired.pParams.pSettingsType == "full":
-      --skip=$singlePaired.pParams.pSkip
-      --alignLimit=$singlePaired.pParams.pAlignLimit
-      --trimH=$singlePaired.pParams.pTrimH
-      --trimL=$singlePaired.pParams.pTrimL
-      --mismatchSeed=$singlePaired.pParams.pMismatchSeed
-      --mismatchQual=$singlePaired.pParams.pMismatchQual
-      --seedLen=$singlePaired.pParams.pSeedLen
-      --rounding=$singlePaired.pParams.pRounding
-      --maqSoapAlign=$singlePaired.pParams.pMaqSoapAlign
-      --minInsert=$singlePaired.pParams.pMinInsert
-      --maxAlignAttempt=$singlePaired.pParams.pMaxAlignAttempt
-      --forwardAlign=$singlePaired.pParams.pForwardAlign
-      --reverseAlign=$singlePaired.pParams.pReverseAlign
-      --tryHard=$singlePaired.pParams.pTryHard
-      --valAlign=$singlePaired.pParams.pValAlign
-      --allValAligns=$singlePaired.pParams.pAllValAligns
-      --suppressAlign=$singlePaired.pParams.pSuppressAlign
-      --best=$singlePaired.pParams.pBestOption.pBest
-      #if $singlePaired.pParams.pBestOption.pBest == "doBest":
-       --maxBacktracks=$singlePaired.pParams.pBestOption.pdMaxBacktracks
-       --strata=$singlePaired.pParams.pBestOption.pdStrata
-      #else:
-       --maxBacktracks=$singlePaired.pParams.pBestOption.pnMaxBacktracks
-       --strata="None"
+      --input1=$singlePaired.pInput1
+      --input2=$singlePaired.pInput2
+      --maxInsert=$singlePaired.pMaxInsert
+      --mateOrient=$singlePaired.pMateOrient
+      --params=$singlePaired.pParams.pSettingsType
+      #if $singlePaired.pParams.pSettingsType == "full":
+        --skip=$singlePaired.pParams.pSkip
+        --alignLimit=$singlePaired.pParams.pAlignLimit
+        --trimH=$singlePaired.pParams.pTrimH
+        --trimL=$singlePaired.pParams.pTrimL
+        --mismatchSeed=$singlePaired.pParams.pMismatchSeed
+        --mismatchQual=$singlePaired.pParams.pMismatchQual
+        --seedLen=$singlePaired.pParams.pSeedLen
+        --rounding=$singlePaired.pParams.pRounding
+        --maqSoapAlign=$singlePaired.pParams.pMaqSoapAlign
+        --minInsert=$singlePaired.pParams.pMinInsert
+        --maxAlignAttempt=$singlePaired.pParams.pMaxAlignAttempt
+        --forwardAlign=$singlePaired.pParams.pForwardAlign
+        --reverseAlign=$singlePaired.pParams.pReverseAlign
+        --tryHard=$singlePaired.pParams.pTryHard
+        --valAlign=$singlePaired.pParams.pValAlign
+        --allValAligns=$singlePaired.pParams.pAllValAligns
+        --suppressAlign=$singlePaired.pParams.pSuppressAlign
+        --best=$singlePaired.pParams.pBestOption.pBest
+        #if $singlePaired.pParams.pBestOption.pBest == "doBest":
+          --maxBacktracks=$singlePaired.pParams.pBestOption.pdMaxBacktracks
+          --strata=$singlePaired.pParams.pBestOption.pdStrata
+        #else:
+          --maxBacktracks=$singlePaired.pParams.pBestOption.pnMaxBacktracks
+        #end if
+        --offrate=$singlePaired.pParams.pOffrate
+        --seed=$singlePaired.pParams.pSeed
+        --snpphred=$singlePaired.pParams.pSnpphred
+        --snpfrac=$singlePaired.pParams.pSnpfrac
+        --keepends=$singlePaired.pParams.pKeepends
       #end if
-      --offrate=$singlePaired.pParams.pOffrate
-      --seed=$singlePaired.pParams.pSeed
-      --snpphred=$singlePaired.pParams.pSnpphred
-      --snpfrac=$singlePaired.pParams.pSnpfrac
-      --keepends=$singlePaired.pParams.pKeepends
-     #else:
-      --skip="None"
-      --alignLimit="None"
-      --trimH="None"
-      --trimL="None"
-      --mismatchSeed="None"
-      --mismatchQual="None"
-      --seedLen="None"
-      --rounding="None"
-      --maqSoapAlign="None"
-      --minInsert="None"
-      --maxAlignAttempt="None"
-      --forwardAlign="None"
-      --reverseAlign="None"
-      --tryHard="None"
-      --valAlign="None"
-      --allValAligns="None"
-      --suppressAlign="None"
-      --best="None"
-      --maxBacktracks="None"
-      --strata="None"
-      --offrate="None"
-      --seed="None"
-      --snpphred="None"
-      --snpfrac="None"
-      --keepends="None"
-     #end if
     #end if
   </command>
   <inputs>
@@ -204,10 +118,7 @@
       </param>
       <when value="indexed">
         <param name="index" type="select" label="Select the reference genome" help="if your genome of interest is not listed - contact Galaxy team">
-          <options from_file="bowtie_indices_color.loc">
-            <column name="value" index="1" />
-            <column name="name" index="0" />
-          </options>
+          <options from_data_table="bowtie_indexes_color"/>
         </param>
       </when>
       <when value="history">
@@ -433,7 +344,8 @@
       chrM_color needs to be the base location/name of the index files.
       -->
       <param name="genomeSource" value="indexed" />
-      <param name="index" value="equCab2chrM" />
+      <!-- this is the backwards-compatible "unique value" for this index, not an actual path -->
+      <param name="index" value="/galaxy/data/equCab2_chrM/bowtie_index/cs/chrM" />
       <param name="sPaired" value="single" />
       <param name="sInput1" ftype="fastqcssanger" value="bowtie_in1.fastqcssanger" />
       <param name="sSettingsType" value="preSet" />
@@ -492,7 +404,8 @@
       chrM_base is the index files' location/base name. 
       -->
       <param name="genomeSource" value="indexed" />
-      <param name="index" value="equCab2chrM" />
+      <!-- this is the backwards-compatible "unique value" for this index, not an actual path -->
+      <param name="index" value="/galaxy/data/equCab2_chrM/bowtie_index/cs/chrM" />
       <param name="sPaired" value="single" />
       <param name="sInput1" ftype="fastqcssanger" value="bowtie_in1.fastqcssanger" />
       <param name="sSettingsType" value="full" />
diff --git a/tools/sr_mapping/bowtie_wrapper.py b/tools/sr_mapping/bowtie_wrapper.py
index a1d19271d97..5e02fbf686e 100644
--- a/tools/sr_mapping/bowtie_wrapper.py
+++ b/tools/sr_mapping/bowtie_wrapper.py
@@ -137,51 +137,51 @@ def __main__():
             indexing_cmds = '%s' % colorspace
         else:
             try:
-                if options.iautoB != 'None' and options.iautoB == 'set':
+                if options.iautoB and options.iautoB == 'set':
                     iautoB = '--noauto'
                 else:
                     iautoB = ''
-                if options. ipacked != 'None' and options.ipacked == 'packed':
+                if options. ipacked and options.ipacked == 'packed':
                     ipacked = '--packed'
                 else:
                     ipacked = ''
-                if options.ibmax != 'None' and int( options.ibmax ) >= 1:
+                if options.ibmax and int( options.ibmax ) >= 1:
                     ibmax = '--bmax %s' % options.ibmax 
                 else:
                     ibmax = ''
-                if options.ibmaxdivn != 'None' and int( options.ibmaxdivn ) >= 0:
+                if options.ibmaxdivn and int( options.ibmaxdivn ) >= 0:
                     ibmaxdivn = '--bmaxdivn %s' % options.ibmaxdivn
                 else:
                     ibmaxdivn = ''
-                if options.idcv != 'None' and int( options.idcv ) > 0:
+                if options.idcv and int( options.idcv ) > 0:
                     idcv = '--dcv %s' % options.idcv
                 else:
                     idcv = ''
-                if options.inodc != 'None' and options.inodc == 'nodc':
+                if options.inodc and options.inodc == 'nodc':
                     inodc = '--nodc'
                 else:
                     inodc = ''
-                if options.inoref != 'None' and options.inoref == 'noref':
+                if options.inoref and options.inoref == 'noref':
                     inoref = '--noref'
                 else:
                     inoref = ''
-                if options.iftab != 'None' and int( options.iftab ) >= 0:
+                if options.iftab and int( options.iftab ) >= 0:
                     iftab = '--ftabchars %s' % options.iftab
                 else:
                     iftab = ''
-                if options.intoa != 'None' and options.intoa == 'yes':
+                if options.intoa and options.intoa == 'yes':
                     intoa = '--ntoa'
                 else:
                     intoa = ''
-                if options.iendian != 'None' and options.iendian == 'big':
+                if options.iendian and options.iendian == 'big':
                     iendian = '--big'
                 else:
                     iendian = '--little'
-                if options.iseed != 'None' and int( options.iseed ) > 0:
+                if options.iseed and int( options.iseed ) > 0:
                     iseed = '--seed %s' % options.iseed
                 else:
                     iseed = ''
-                if options.icutoff != 'None' and int( options.icutoff ) > 0:
+                if options.icutoff and int( options.icutoff ) > 0:
                     icutoff = '--cutoff %s' % options.icutoff
                 else:
                     icutoff = ''
@@ -233,11 +233,11 @@ def __main__():
         suppressHeader = '--sam-nohead'
     else:
         suppressHeader = ''
-    if options.maxInsert != 'None' and int( options.maxInsert ) > 0:
+    if options.maxInsert and int( options.maxInsert ) > 0:
         maxInsert = '-X %s' % options.maxInsert
     else:
         maxInsert = ''
-    if options.mateOrient != 'None':
+    if options.mateOrient:
         mateOrient = '--%s' % options.mateOrient
     else:
         mateOrient = ''
@@ -246,32 +246,32 @@ def __main__():
                 ( maxInsert, mateOrient, options.threads, suppressHeader, colorspace )
     else:
         try:
-            if options.skip != 'None' and int( options.skip ) > 0:
+            if options.skip and int( options.skip ) > 0:
                 skip = '-s %s' % options.skip
             else:
                 skip = ''
-            if options.alignLimit != 'None' and int( options.alignLimit ) >= 0:
+            if options.alignLimit and int( options.alignLimit ) >= 0:
                 alignLimit = '-u %s' % options.alignLimit
             else:
                 alignLimit = ''
-            if options.trimH != 'None' and int( options.trimH ) > 0:
+            if options.trimH and int( options.trimH ) > 0:
                 trimH = '-5 %s' % options.trimH
             else:
                 trimH = ''
-            if options.trimL != 'None' and int( options.trimL ) > 0:
+            if options.trimL and int( options.trimL ) > 0:
                 trimL = '-3 %s' % options.trimL
             else:
                 trimL = ''
-            if options.mismatchSeed != 'None' and (options.mismatchSeed == '0' or options.mismatchSeed == '1' \
+            if options.mismatchSeed and (options.mismatchSeed == '0' or options.mismatchSeed == '1' \
                         or options.mismatchSeed == '2' or options.mismatchSeed == '3'):
                 mismatchSeed = '-n %s' % options.mismatchSeed
             else:
                 mismatchSeed = ''
-            if options.mismatchQual != 'None' and int( options.mismatchQual ) >= 0:
+            if options.mismatchQual and int( options.mismatchQual ) >= 0:
                 mismatchQual = '-e %s' % options.mismatchQual
             else:
                 mismatchQual = ''
-            if options.seedLen != 'None' and int( options.seedLen ) >= 5:
+            if options.seedLen and int( options.seedLen ) >= 5:
                 seedLen = '-l %s' % options.seedLen
             else:
                 seedLen = ''
@@ -283,11 +283,11 @@ def __main__():
                 maqSoapAlign = '-v %s' % options.maqSoapAlign
             else:
                 maqSoapAlign = ''
-            if options.minInsert != 'None' and int( options.minInsert ) > 0:
+            if options.minInsert and int( options.minInsert ) > 0:
                 minInsert = '-I %s' % options.minInsert
             else:
                 minInsert = ''
-            if options.maxAlignAttempt != 'None' and int( options.maxAlignAttempt ) >= 0:
+            if options.maxAlignAttempt and int( options.maxAlignAttempt ) >= 0:
                 maxAlignAttempt = '--pairtries %s' % options.maxAlignAttempt
             else:
                 maxAlignAttempt = ''
@@ -299,7 +299,7 @@ def __main__():
                 reverseAlign = '--norc'
             else:
                 reverseAlign = ''
-            if options.maxBacktracks != 'None' and int( options.maxBacktracks ) > 0 and \
+            if options.maxBacktracks and int( options.maxBacktracks ) > 0 and \
                     ( options.mismatchSeed == '2' or options.mismatchSeed == '3' ):
                 maxBacktracks = '--maxbts %s' % options.maxBacktracks
             else:
@@ -308,7 +308,7 @@ def __main__():
                 tryHard = '-y'
             else:
                 tryHard = ''
-            if options.valAlign != 'None' and int( options.valAlign ) >= 0:
+            if options.valAlign and int( options.valAlign ) >= 0:
                 valAlign = '-k %s' % options.valAlign
             else:
                 valAlign = ''
@@ -316,7 +316,7 @@ def __main__():
                 allValAligns = '-a'
             else:
                 allValAligns = ''
-            if options.suppressAlign != 'None' and int( options.suppressAlign ) >= 0:
+            if options.suppressAlign and int( options.suppressAlign ) >= 0:
                 suppressAlign = '-m %s' % options.suppressAlign
             else:
                 suppressAlign = ''
@@ -328,23 +328,23 @@ def __main__():
                 strata = '--strata'
             else:
                 strata = ''
-            if options.offrate != 'None' and int( options.offrate ) >= 0:
+            if options.offrate and int( options.offrate ) >= 0:
                 offrate = '-o %s' % options.offrate
             else:
                 offrate = ''
-            if options.seed != 'None' and int( options.seed ) >= 0:
+            if options.seed and int( options.seed ) >= 0:
                 seed = '--seed %s' % options.seed
             else:
                 seed = ''
-            if options.snpphred != 'None' and int( options.snpphred ) >= 0:
+            if options.snpphred and int( options.snpphred ) >= 0:
                 snpphred = '--snpphred %s' % options.snpphred
             else:
                 snpphred = ''
-                if options.snpfrac != 'None' and float( options.snpfrac ) >= 0:
+                if options.snpfrac and float( options.snpfrac ) >= 0:
                     snpfrac = '--snpfrac %s' % options.snpfrac
                 else:
                     snpfrac = ''
-            if options.keepends != 'None' and options.keepends == 'doKeepends':
+            if options.keepends and options.keepends == 'doKeepends':
                 keepends = '--col-keepends'
             else:
                 keepends = ''
diff --git a/tools/sr_mapping/bowtie_wrapper.xml b/tools/sr_mapping/bowtie_wrapper.xml
index a38ba0e802e..74d2ba82ef0 100644
--- a/tools/sr_mapping/bowtie_wrapper.xml
+++ b/tools/sr_mapping/bowtie_wrapper.xml
@@ -1,4 +1,4 @@
-<tool id="bowtie_wrapper" name="Map with Bowtie for Illumina" version="1.0.6">
+<tool id="bowtie_wrapper" name="Map with Bowtie for Illumina" version="1.1.0">
   <requirements><requirement type='package'>bowtie</requirement></requirements>
   <description></description>
   <command interpreter="python">
@@ -8,186 +8,100 @@
     --output=$output
     --suppressHeader=$suppressHeader
     --genomeSource=$refGenomeSource.genomeSource
-    --snpphred="None"
-    --snpfrac="None"
-    --keepends="None"
     #if $refGenomeSource.genomeSource == "history":
-       #if $refGenomeSource.ownFile.extension.startswith( 'bowtie_' ):
-       --ref="${refGenomeSource.ownFile.extra_files_path}/${refGenomeSource.ownFile.metadata.base_name}"
-       --do_not_build_index
-       #else:
-     --ref=$refGenomeSource.ownFile
-     --indexSettings=$refGenomeSource.indexParams.indexSettings
-     #if $refGenomeSource.indexParams.indexSettings == "indexFull":
-      --iautoB=$refGenomeSource.indexParams.autoBehavior.autoB
-      #if $refGenomeSource.indexParams.autoBehavior.autoB == "set":
-       --ipacked=$refGenomeSource.indexParams.autoBehavior.packed
-       --ibmax=$refGenomeSource.indexParams.autoBehavior.bmax
-       --ibmaxdivn=$refGenomeSource.indexParams.autoBehavior.bmaxdivn
-       --idcv=$refGenomeSource.indexParams.autoBehavior.dcv
+      ##index already exists
+      #if $refGenomeSource.ownFile.extension.startswith( 'bowtie_' ):
+        ##user previously built
+        --ref="${refGenomeSource.ownFile.extra_files_path}/${refGenomeSource.ownFile.metadata.base_name}"
+        --do_not_build_index
       #else:
-       --ipacked="None"
-       --ibmax="None"
-       --ibmaxdivn="None"
-       --idcv="None"
+        ##build index on the fly
+        --ref=$refGenomeSource.ownFile
+        --indexSettings=$refGenomeSource.indexParams.indexSettings
+        #if $refGenomeSource.indexParams.indexSettings == "indexFull":
+          --iautoB=$refGenomeSource.indexParams.autoBehavior.autoB
+          #if $refGenomeSource.indexParams.autoBehavior.autoB == "set":
+            --ipacked=$refGenomeSource.indexParams.autoBehavior.packed
+            --ibmax=$refGenomeSource.indexParams.autoBehavior.bmax
+            --ibmaxdivn=$refGenomeSource.indexParams.autoBehavior.bmaxdivn
+            --idcv=$refGenomeSource.indexParams.autoBehavior.dcv
+          #end if
+          --inodc=$refGenomeSource.indexParams.nodc
+          --inoref=$refGenomeSource.indexParams.noref
+          --ioffrate=$refGenomeSource.indexParams.offrate
+          --iftab=$refGenomeSource.indexParams.ftab
+          --intoa=$refGenomeSource.indexParams.ntoa
+          --iendian=$refGenomeSource.indexParams.endian
+          --iseed=$refGenomeSource.indexParams.seed
+          --icutoff=$refGenomeSource.indexParams.cutoff 
+        #end if
       #end if
-      --inodc=$refGenomeSource.indexParams.nodc
-      --inoref=$refGenomeSource.indexParams.noref
-      --ioffrate=$refGenomeSource.indexParams.offrate
-      --iftab=$refGenomeSource.indexParams.ftab
-      --intoa=$refGenomeSource.indexParams.ntoa
-      --iendian=$refGenomeSource.indexParams.endian
-      --iseed=$refGenomeSource.indexParams.seed
-      --icutoff=$refGenomeSource.indexParams.cutoff 
-     #else:
-      --iautoB="None"
-      --ipacked="None"
-      --ibmax="None"
-      --ibmaxdivn="None"
-      --idcv="None"
-      --inodc="None"
-      --inoref="None"
-      --ioffrate="None"
-      --iftab="None"
-      --intoa="None"
-      --iendian="None"
-      --iseed="None"
-      --icutoff="None"
-     #end if
-     #end if
-    #else:
-     --ref=$refGenomeSource.index
-     --indexSettings="None"
-     --iautoB="None"
-     --ipacked="None"
-     --ibmax="None"
-     --ibmaxdivn="None"
-     --idcv="None"
-     --inodc="None"
-     --inoref="None"
-     --ioffrate="None"
-     --iftab="None"
-     --intoa="None"
-     --iendian="None"
-     --iseed="None"
-     --icutoff="None"
+    #else
+      ##use pre-built index
+      --ref="${ filter( lambda x: str( x[0] ) == str( $refGenomeSource.index ), $__app__.tool_data_tables[ 'bowtie_indexes' ].get_fields() )[0][-1] }"
     #end if
     --paired=$singlePaired.sPaired
     #if $singlePaired.sPaired == "single":
-     --input1=$singlePaired.sInput1
-     --input2="None"
-     --params=$singlePaired.sParams.sSettingsType
-     #if $singlePaired.sParams.sSettingsType == "full":
-      --skip=$singlePaired.sParams.sSkip
-      --alignLimit=$singlePaired.sParams.sAlignLimit
-      --trimH=$singlePaired.sParams.sTrimH
-      --trimL=$singlePaired.sParams.sTrimL
-      --mismatchSeed=$singlePaired.sParams.sMismatchSeed
-      --mismatchQual=$singlePaired.sParams.sMismatchQual
-      --seedLen=$singlePaired.sParams.sSeedLen
-      --rounding=$singlePaired.sParams.sRounding
-      --maqSoapAlign=$singlePaired.sParams.sMaqSoapAlign
-      --tryHard=$singlePaired.sParams.sTryHard
-      --valAlign=$singlePaired.sParams.sValAlign
-      --allValAligns=$singlePaired.sParams.sAllValAligns
-      --suppressAlign=$singlePaired.sParams.sSuppressAlign
-      --best=$singlePaired.sParams.sBestOption.sBest
-      #if $singlePaired.sParams.sBestOption.sBest == "doBest":
-       --maxBacktracks=$singlePaired.sParams.sBestOption.sdMaxBacktracks
-       --strata=$singlePaired.sParams.sBestOption.sdStrata
-      #else:
-       --maxBacktracks=$singlePaired.sParams.sBestOption.snMaxBacktracks
-       --strata="None"
+      --input1=$singlePaired.sInput1
+      --params=$singlePaired.sParams.sSettingsType
+      #if $singlePaired.sParams.sSettingsType == "full":
+        --skip=$singlePaired.sParams.sSkip
+        --alignLimit=$singlePaired.sParams.sAlignLimit
+        --trimH=$singlePaired.sParams.sTrimH
+        --trimL=$singlePaired.sParams.sTrimL
+        --mismatchSeed=$singlePaired.sParams.sMismatchSeed
+        --mismatchQual=$singlePaired.sParams.sMismatchQual
+        --seedLen=$singlePaired.sParams.sSeedLen
+        --rounding=$singlePaired.sParams.sRounding
+        --maqSoapAlign=$singlePaired.sParams.sMaqSoapAlign
+        --tryHard=$singlePaired.sParams.sTryHard
+        --valAlign=$singlePaired.sParams.sValAlign
+        --allValAligns=$singlePaired.sParams.sAllValAligns
+        --suppressAlign=$singlePaired.sParams.sSuppressAlign
+        --best=$singlePaired.sParams.sBestOption.sBest
+        #if $singlePaired.sParams.sBestOption.sBest == "doBest":
+          --maxBacktracks=$singlePaired.sParams.sBestOption.sdMaxBacktracks
+          --strata=$singlePaired.sParams.sBestOption.sdStrata
+        #else:
+          --maxBacktracks=$singlePaired.sParams.sBestOption.snMaxBacktracks
+        #end if
+        --offrate=$singlePaired.sParams.sOffrate
+        --seed=$singlePaired.sParams.sSeed
       #end if
-      --offrate=$singlePaired.sParams.sOffrate
-      --seed=$singlePaired.sParams.sSeed
-     #else:
-      --skip="None"
-      --alignLimit="None"
-      --trimH="None"
-      --trimL="None"
-      --mismatchSeed="None"
-      --mismatchQual="None"
-      --seedLen="None"
-      --rounding="None"
-      --maqSoapAlign="None"
-      --tryHard="None"
-      --valAlign="None"
-      --allValAligns="None"
-      --suppressAlign="None"
-      --best="None"
-      --maxBacktracks="None"
-      --strata="None"
-      --offrate="None"
-      --seed="None"
-      --snpphred="None"
-      --snpfrac="None"
-      --keepends="None"
-     #end if
-     --minInsert="None"
-     --maxInsert="None"
-     --mateOrient="None"
-     --maxAlignAttempt="None"
-     --forwardAlign="None"
-     --reverseAlign="None"
     #else:
-     --input1=$singlePaired.pInput1
-     --input2=$singlePaired.pInput2
-     --maxInsert=$singlePaired.pMaxInsert
-     --mateOrient=$singlePaired.pMateOrient
-     --params=$singlePaired.pParams.pSettingsType
-     #if $singlePaired.pParams.pSettingsType == "full":
-      --skip=$singlePaired.pParams.pSkip
-      --alignLimit=$singlePaired.pParams.pAlignLimit
-      --trimH=$singlePaired.pParams.pTrimH
-      --trimL=$singlePaired.pParams.pTrimL
-      --mismatchSeed=$singlePaired.pParams.pMismatchSeed
-      --mismatchQual=$singlePaired.pParams.pMismatchQual
-      --seedLen=$singlePaired.pParams.pSeedLen
-      --rounding=$singlePaired.pParams.pRounding
-      --maqSoapAlign=$singlePaired.pParams.pMaqSoapAlign
-      --minInsert=$singlePaired.pParams.pMinInsert
-      --maxAlignAttempt=$singlePaired.pParams.pMaxAlignAttempt
-      --forwardAlign=$singlePaired.pParams.pForwardAlign
-      --reverseAlign=$singlePaired.pParams.pReverseAlign
-      --tryHard=$singlePaired.pParams.pTryHard
-      --valAlign=$singlePaired.pParams.pValAlign
-      --allValAligns=$singlePaired.pParams.pAllValAligns
-      --suppressAlign=$singlePaired.pParams.pSuppressAlign
-      --best=$singlePaired.pParams.pBestOption.pBest
-      #if $singlePaired.pParams.pBestOption.pBest == "doBest":
-       --maxBacktracks=$singlePaired.pParams.pBestOption.pdMaxBacktracks
-       --strata=$singlePaired.pParams.pBestOption.pdStrata
-      #else:
-       --maxBacktracks=$singlePaired.pParams.pBestOption.pnMaxBacktracks
-       --strata="None"
+      --input1=$singlePaired.pInput1
+      --input2=$singlePaired.pInput2
+      --maxInsert=$singlePaired.pMaxInsert
+      --mateOrient=$singlePaired.pMateOrient
+      --params=$singlePaired.pParams.pSettingsType
+      #if $singlePaired.pParams.pSettingsType == "full":
+        --skip=$singlePaired.pParams.pSkip
+        --alignLimit=$singlePaired.pParams.pAlignLimit
+        --trimH=$singlePaired.pParams.pTrimH
+        --trimL=$singlePaired.pParams.pTrimL
+        --mismatchSeed=$singlePaired.pParams.pMismatchSeed
+        --mismatchQual=$singlePaired.pParams.pMismatchQual
+        --seedLen=$singlePaired.pParams.pSeedLen
+        --rounding=$singlePaired.pParams.pRounding
+        --maqSoapAlign=$singlePaired.pParams.pMaqSoapAlign
+        --minInsert=$singlePaired.pParams.pMinInsert
+        --maxAlignAttempt=$singlePaired.pParams.pMaxAlignAttempt
+        --forwardAlign=$singlePaired.pParams.pForwardAlign
+        --reverseAlign=$singlePaired.pParams.pReverseAlign
+        --tryHard=$singlePaired.pParams.pTryHard
+        --valAlign=$singlePaired.pParams.pValAlign
+        --allValAligns=$singlePaired.pParams.pAllValAligns
+        --suppressAlign=$singlePaired.pParams.pSuppressAlign
+        --best=$singlePaired.pParams.pBestOption.pBest
+        #if $singlePaired.pParams.pBestOption.pBest == "doBest":
+          --maxBacktracks=$singlePaired.pParams.pBestOption.pdMaxBacktracks
+          --strata=$singlePaired.pParams.pBestOption.pdStrata
+        #else:
+          --maxBacktracks=$singlePaired.pParams.pBestOption.pnMaxBacktracks
+        #end if
+        --offrate=$singlePaired.pParams.pOffrate
+        --seed=$singlePaired.pParams.pSeed
       #end if
-      --offrate=$singlePaired.pParams.pOffrate
-      --seed=$singlePaired.pParams.pSeed
-     #else:
-      --skip="None"
-      --alignLimit="None"
-      --trimH="None"
-      --trimL="None"
-      --mismatchSeed="None"
-      --mismatchQual="None"
-      --seedLen="None"
-      --rounding="None"
-      --maqSoapAlign="None"
-      --tryHard="None"
-      --valAlign="None"
-      --allValAligns="None"
-      --suppressAlign="None"
-      --best="None"
-      --maxBacktracks="None"
-      --strata="None"
-      --offrate="None"
-      --seed="None"
-      --minInsert="None"
-      --maxAlignAttempt="None"
-      --forwardAlign="None"
-      --reverseAlign="None"
-     #end if
     #end if
   </command>
   <inputs>
@@ -199,12 +113,6 @@
       <when value="indexed">
         <param name="index" type="select" label="Select a reference genome" help="if your genome of interest is not listed - contact Galaxy team">
           <options from_data_table="bowtie_indexes"/>
-          <!--
-          <options from_file="bowtie_indices.loc">
-            <column name="value" index="1" />
-            <column name="name" index="0" />
-          </options>
-          -->
         </param>
       </when>
       <when value="history">
@@ -418,7 +326,8 @@
       chrM_base needs to be the base location/name of the index files.
       -->
       <param name="genomeSource" value="indexed" />
-      <param name="index" value="equCab2chrM" />
+      <!-- this is the backwards-compatible "unique value" for this index, not an actual path -->
+      <param name="index" value="/galaxy/data/equCab2_chrM/bowtie_index/chrM" />
       <param name="sPaired" value="single" />
       <param name="sInput1" ftype="fastqsanger" value="bowtie_in2.fastqsanger" />
       <param name="sSettingsType" value="preSet" />
@@ -475,7 +384,8 @@
       chrM_base is the index files' location/base name. 
       -->
       <param name="genomeSource" value="indexed" />
-      <param name="index" value="equCab2chrM" />
+      <!-- this is the backwards-compatible "unique value" for this index, not an actual path -->
+      <param name="index" value="/galaxy/data/equCab2_chrM/bowtie_index/chrM" />
       <param name="sPaired" value="single" />
       <param name="sInput1" ftype="fastqsanger" value="bowtie_in2.fastqsanger" />
       <param name="sSettingsType" value="full" />
diff --git a/tools/sr_mapping/bwa_wrapper.py b/tools/sr_mapping/bwa_wrapper.py
index 89acfeb2984..246ba8705c4 100644
--- a/tools/sr_mapping/bwa_wrapper.py
+++ b/tools/sr_mapping/bwa_wrapper.py
@@ -30,8 +30,9 @@ usage: bwa_wrapper.py [options]
     -T, --outputTopN=T: Output top specified hits
     -S, --maxInsertSize=S: Maximum insert size for a read pair to be considered mapped good
     -P, --maxOccurPairing=P: Maximum occurrences of a read for pairings
-    -D, --dbkey=D: Dbkey for reference genome
     -H, --suppressHeader=h: Suppress header
+    -D, --dbkey=D: Dbkey for reference genome
+    -X, --do_not_build_index: Flag to specify that provided file is already indexed and to just use 'as is'
 """
 
 import optparse, os, shutil, subprocess, sys, tempfile
@@ -68,13 +69,14 @@ def __main__():
     parser.add_option( '-S', '--maxInsertSize', dest='maxInsertSize', help='Maximum insert size for a read pair to be considered mapped good' )
     parser.add_option( '-P', '--maxOccurPairing', dest='maxOccurPairing', help='Maximum occurrences of a read for pairings' )
     parser.add_option( '-D', '--dbkey', dest='dbkey', help='Dbkey for reference genome' )
+    parser.add_option( '-X', '--do_not_build_index', dest='do_not_build_index', help="Don't build index" )
     parser.add_option( '-H', '--suppressHeader', dest='suppressHeader', help='Suppress header' )
     (options, args) = parser.parse_args()
     # make temp directory for placement of indices
     tmp_index_dir = tempfile.mkdtemp()
     tmp_dir = tempfile.mkdtemp()
     # index if necessary
-    if options.fileSource == 'history':
+    if options.fileSource == 'history' and not options.do_not_build_index:
         ref_file = tempfile.NamedTemporaryFile( dir=tmp_index_dir )
         ref_file_name = ref_file.name
         ref_file.close()
diff --git a/tools/sr_mapping/bwa_wrapper.xml b/tools/sr_mapping/bwa_wrapper.xml
index 60aec4de023..31666d555fd 100644
--- a/tools/sr_mapping/bwa_wrapper.xml
+++ b/tools/sr_mapping/bwa_wrapper.xml
@@ -1,30 +1,44 @@
-<tool id="bwa_wrapper" name="Map with BWA" version="1.0.3">
+<tool id="bwa_wrapper" name="Map with BWA" version="1.1.0">
   <description></description>
-  <command interpreter="python">bwa_wrapper.py 
---threads="4"
-#if $genomeSource.refGenomeSource == "history":
---ref=$genomeSource.ownFile
-#else:
---ref=$genomeSource.indices
-#end if
---fastq=$paired.input1
-#if $paired.sPaired == "paired":
---rfastq=$paired.input2 
-#else:
---rfastq="None"
-#end if
---output=$output --genAlignType=$paired.sPaired --params=$params.source_select --fileSource=$genomeSource.refGenomeSource
-#if $params.source_select == "pre_set":
---maxEditDist="None" --fracMissingAligns="None" --maxGapOpens="None" --maxGapExtens="None" --disallowLongDel="None" --disallowIndel="None" --seed="None" --maxEditDistSeed="None" --mismatchPenalty="None" --gapOpenPenalty="None" --gapExtensPenalty="None" --suboptAlign="None" --noIterSearch="None" --outputTopN="None" --maxInsertSize="None" --maxOccurPairing="None"
-#else:
---maxEditDist=$params.maxEditDist --fracMissingAligns=$params.fracMissingAligns --maxGapOpens=$params.maxGapOpens --maxGapExtens=$params.maxGapExtens --disallowLongDel=$params.disallowLongDel --disallowIndel=$params.disallowIndel --seed=$params.seed --maxEditDistSeed=$params.maxEditDistSeed --mismatchPenalty=$params.mismatchPenalty --gapOpenPenalty=$params.gapOpenPenalty --gapExtensPenalty=$params.gapExtensPenalty --suboptAlign=$params.suboptAlign --noIterSearch=$params.noIterSearch --outputTopN=$params.outputTopN --maxInsertSize=$params.maxInsertSize --maxOccurPairing=$params.maxOccurPairing
-#end if
-#if $genomeSource.refGenomeSource == "history":
---dbkey=$dbkey
-#else:
---dbkey="None"
-#end if
---suppressHeader=$suppressHeader
+  <command interpreter="python">
+    bwa_wrapper.py 
+      --threads="4"
+      #if $genomeSource.refGenomeSource == "history":
+        ##build index on the fly
+        --ref="${genomeSource.ownFile}"
+        --dbkey=$dbkey
+      #else:
+        ##use precomputed indexes
+        --ref="${ filter( lambda x: str( x[0] ) == str( $genomeSource.indices ), $__app__.tool_data_tables[ 'bwa_indexes' ].get_fields() )[0][-1] }"
+        --do_not_build_index=True
+      #end if
+      --fastq=$paired.input1
+      #if $paired.sPaired == "paired":
+        --rfastq=$paired.input2
+      #end if
+      --output=$output
+      --genAlignType=$paired.sPaired
+      --params=$params.source_select
+      --fileSource=$genomeSource.refGenomeSource
+      #if $params.source_select != "pre_set":
+        --maxEditDist=$params.maxEditDist
+        --fracMissingAligns=$params.fracMissingAligns
+        --maxGapOpens=$params.maxGapOpens
+        --maxGapExtens=$params.maxGapExtens
+        --disallowLongDel=$params.disallowLongDel
+        --disallowIndel=$params.disallowIndel
+        --seed=$params.seed
+        --maxEditDistSeed=$params.maxEditDistSeed
+        --mismatchPenalty=$params.mismatchPenalty
+        --gapOpenPenalty=$params.gapOpenPenalty
+        --gapExtensPenalty=$params.gapExtensPenalty
+        --suboptAlign=$params.suboptAlign
+        --noIterSearch=$params.noIterSearch
+        --outputTopN=$params.outputTopN
+        --maxInsertSize=$params.maxInsertSize
+        --maxOccurPairing=$params.maxOccurPairing
+      #end if
+      --suppressHeader=$suppressHeader
   </command>
   <requirements>
     <requirement type='package'>bwa</requirement>
@@ -38,12 +52,6 @@
       <when value="indexed">
         <param name="indices" type="select" label="Select a reference genome">
           <options from_data_table="bwa_indexes"/>
-          <!--
-          <options from_file="bwa_index.loc">
-            <column name="value" index="1" />
-            <column name="name" index="0" />
-          </options>
-          -->
         </param>
       </when>
       <when value="history">
@@ -62,7 +70,7 @@
         <param name="input1" type="data" format="fastqsanger" label="Forward FASTQ file" help="Must have Sanger-scaled quality values with ASCII offset 33"/>
         <param name="input2" type="data" format="fastqsanger" label="Reverse FASTQ file" help="Must have Sanger-scaled quality values with ASCII offset 33"/>
       </when>
-    </conditional>	
+    </conditional>
     <conditional name="params">
       <param name="source_select" type="select" label="BWA settings to use" help="For most mapping needs use Commonly Used settings. If you want full control use Full Parameter List">
         <option value="pre_set">Commonly Used</option>
@@ -110,12 +118,13 @@
       <!--
       BWA commands:
       bwa aln -t 4 phiX test-data/bwa_wrapper_in1.fastq > bwa_wrapper_out1.sai
-      bwa samse phiX bwa_wrapper_out1.sai test-data/bwa_wrapper_in1.fastq >> bwa_wrapper_out1.sam
+      bwa samse phiX bwa_wrapper_out1.sai test-data/bwa_wrapper_in1.fastq > bwa_wrapper_out1.sam
       phiX.fa is the prefix for the reference files (phiX.fa.amb, phiX.fa.ann, phiX.fa.bwt, ...)
       remove the comment lines (beginning with '@') from the resulting sam file
       -->
       <param name="refGenomeSource" value="indexed" />
-      <param name="indices" value="phiX" />
+      <!-- this is the backwards-compatible "unique value" for this index, not an actual path -->
+      <param name="indices" value="/galaxy/data/phiX/bwa_index/phiX.fa" />
       <param name="sPaired" value="single" />
       <param name="input1" value="bwa_wrapper_in1.fastq" ftype="fastqsanger" />
       <param name="source_select" value="pre_set" />
@@ -155,18 +164,19 @@
       <param name="maxOccurPairing" value="100000" />
       <param name="suppressHeader" value="true" />
       <output name="output" file="bwa_wrapper_out2.sam" ftype="sam" sort="True" />
-    </test> 
+    </test>
     <test>
       <!--
       BWA commands:
       bwa aln -n 0.04 -o 1 -e -1 -d 16 -i 5 -k 2 -t 4 -M 3 -O 11 -E 4 -R -N phiX.fa test-data/bwa_wrapper_in2.fastq > bwa_wrapper_out3a.sai
       bwa aln -n 0.04 -o 1 -e -1 -d 16 -i 5 -k 2 -t 4 -M 3 -O 11 -E 4 -R -N phiX.fa test-data/bwa_wrapper_in3.fastq > bwa_wrapper_out3b.sai
-      bwa sampe -a 500 -o 100000 phiX.fasta bwa_wrapper_out3a.sai bwa_wrapper_out3b.sai test-data/bwa_wrapper_in2.fastq test-data/bwa_wrapper_in3.fastq > bwa_wrapper_out3.sam
+      bwa sampe -a 500 -o 100000 phiX.fa bwa_wrapper_out3a.sai bwa_wrapper_out3b.sai test-data/bwa_wrapper_in2.fastq test-data/bwa_wrapper_in3.fastq > bwa_wrapper_out3.sam
       phiX.fa is the prefix for the reference
       remove the comment lines (beginning with '@') from the resulting sam file
       -->
       <param name="refGenomeSource" value="indexed" />
-      <param name="indices" value="phiX" />
+      <!-- this is the backwards-compatible "unique value" for this index, not an actual path -->
+      <param name="indices" value="/galaxy/data/phiX/bwa_index/phiX.fa" />
       <param name="sPaired" value="paired" />
       <param name="input1" value="bwa_wrapper_in2.fastq" ftype="fastqsanger" />
       <param name="input2" value="bwa_wrapper_in3.fastq" ftype="fastqsanger" />
diff --git a/tools/sr_mapping/lastz_paired_reads_wrapper.py b/tools/sr_mapping/lastz_paired_reads_wrapper.py
index f7a54dac3ba..e9ea4835a96 100644
--- a/tools/sr_mapping/lastz_paired_reads_wrapper.py
+++ b/tools/sr_mapping/lastz_paired_reads_wrapper.py
@@ -758,7 +758,7 @@ def __main__():
     parser.add_option( '', '--lastz_seqs_file_dir', dest='lastz_seqs_file_dir', help='Directory of local lastz_seqs.loc file' )
 
     ( options, args ) = parser.parse_args()
-    if options.ref_name != 'None':
+    if options.ref_name:
         ref_name = '[nickname=%s]' % options.ref_name
     else:
         ref_name = ''
diff --git a/tools/sr_mapping/lastz_paired_reads_wrapper.xml b/tools/sr_mapping/lastz_paired_reads_wrapper.xml
index fa28ee84a1e..0d6a431e385 100644
--- a/tools/sr_mapping/lastz_paired_reads_wrapper.xml
+++ b/tools/sr_mapping/lastz_paired_reads_wrapper.xml
@@ -1,20 +1,21 @@
-<tool id="lastz_paired_reads_wrapper" name="Lastz paired reads" version="1.0.0">
+<tool id="lastz_paired_reads_wrapper" name="Lastz paired reads" version="1.1.0">
     <description> map short paired reads against reference sequence</description>
     <command interpreter="python">lastz_paired_reads_wrapper.py
-#if $seq_name.how_to_name=="yes":
---ref_name=$seq_name.ref_name 
-#else:
---ref_name="None" 
-#end if
---ref_source=$source.ref_source --input2=$input2 --input3=$input3 --input4=$input4
-#if $source.ref_source=="history":
---input1=$source.input1
---ref_sequences=$input1.metadata.sequences 
-#else:
---input1=$source.input1_2bit
---ref_sequences="None" 
-#end if
---output=$output1 --lastz_seqs_file_dir=${GALAXY_DATA_INDEX_DIR}
+      #if $seq_name.how_to_name=="yes":
+        --ref_name=$seq_name.ref_name 
+      #end if
+      --ref_source=$source.ref_source
+      --input2=$input2
+      --input3=$input3
+      --input4=$input4
+      #if $source.ref_source=="history":
+        --input1=$source.input1
+        --ref_sequences=$input1.metadata.sequences 
+      #else:
+        --input1="${ filter( lambda x: str( x[0] ) == str( $source.input1_2bit ), $__app__.tool_data_tables[ 'lastz_seqs' ].get_fields() )[0][-1] }"
+      #end if
+      --output=$output1
+      --lastz_seqs_file_dir=${GALAXY_DATA_INDEX_DIR}
     </command>
     <inputs>
         <param name="input2" format="fasta" type="data" label="Align sequencing reads in" />
@@ -25,10 +26,7 @@
             </param>
             <when value="cached">
                 <param name="input1_2bit" type="select" label="Using reference genome" help="If your genome of interest is not listed, contact the Galaxy team">
-                    <options from_file="lastz_seqs.loc">
-                        <column name="value" index="1" />
-                        <column name="name" index="0" />
-                    </options>
+                    <options from_data_table="lastz_seqs" />
                 </param>
             </when>
             <when value="history">
@@ -64,7 +62,7 @@
             -->
             <param name="input2" value="lastz_paired_input2.fasta" ftype="fasta" />
             <param name="ref_source" value="cached" />
-            <param name="input1_2bit" value="hg18Chr21" />
+            <param name="input1_2bit" value="/galaxy/data/hg18/seq/chr21.2bit" />
             <param name="input3" value="lastz_paired_input3.fasta" ftype="fasta" />
             <param name="input4" value="lastz_paired_input4.qual454" ftype="qual454" />
             <param name="how_to_name" value="no" />
diff --git a/tools/sr_mapping/lastz_wrapper.py b/tools/sr_mapping/lastz_wrapper.py
index 8ada5e4392e..33f20b8c25b 100644
--- a/tools/sr_mapping/lastz_wrapper.py
+++ b/tools/sr_mapping/lastz_wrapper.py
@@ -156,7 +156,7 @@ def __main__():
         unmask = '[unmask]'
     else:
         unmask = ''
-    if options.ref_name != 'None':
+    if options.ref_name:
         ref_name = '[nickname=%s]' % options.ref_name
     else:
         ref_name = ''
diff --git a/tools/sr_mapping/lastz_wrapper.xml b/tools/sr_mapping/lastz_wrapper.xml
index 7dd5424d6aa..8909acfe6e7 100644
--- a/tools/sr_mapping/lastz_wrapper.xml
+++ b/tools/sr_mapping/lastz_wrapper.xml
@@ -1,25 +1,42 @@
-<tool id="lastz_wrapper_2" name="Lastz" version="1.1.1">
+<tool id="lastz_wrapper_2" name="Lastz" version="1.2.0">
     <description> map short reads against reference sequence</description>
     <command interpreter="python">lastz_wrapper.py
-#if $seq_name.how_to_name=="yes":
---ref_name=$seq_name.ref_name 
-#else:
---ref_name="None" 
-#end if
---ref_source=$source.ref_source --source_select=$params.source_select --out_format=$out_format --input2=$input2 
-#if $source.ref_source=="history":
---input1=$source.input1
---ref_sequences=$input1.metadata.sequences 
-#else:
---input1=$source.input1_2bit
---ref_sequences="None" 
-#end if
-#if $params.source_select=="pre_set":
---pre_set_options=${params.pre_set_options} --strand="None" --seed="None" --gfextend="None" --chain="None" --transition="None" --O="None" --E="None" --X="None" --Y="None" --K="None" --L="None" --entropy="None" 
-#else:
---pre_set_options="None" --strand=$params.strand --seed=$params.seed --gfextend=$params.gfextend --chain=$params.chain --transition="$params.transition" --O=$params.O --E=$params.E --X=$params.X --Y=$params.Y --K=$params.K --L=$params.L --entropy=$params.entropy 
-#end if
---identity_min=$min_ident --identity_max=$max_ident --coverage=$min_cvrg --output=$output1 --unmask=$unmask --lastzSeqsFileDir=${GALAXY_DATA_INDEX_DIR}
+      #if $seq_name.how_to_name=="yes":
+        --ref_name=$seq_name.ref_name 
+      #end if
+      --ref_source=$source.ref_source
+      --source_select=$params.source_select
+      --out_format=$out_format
+      --input2=$input2 
+      #if $source.ref_source=="history":
+        --input1=$source.input1
+        --ref_sequences=$input1.metadata.sequences 
+      #else:
+        --input1="${ filter( lambda x: str( x[0] ) == str( $source.input1_2bit ), $__app__.tool_data_tables[ 'lastz_seqs' ].get_fields() )[0][-1] }"
+        --ref_sequences="None" 
+      #end if
+      #if $params.source_select=="pre_set":
+        --pre_set_options=${params.pre_set_options}
+      #else:
+        --strand=$params.strand
+        --seed=$params.seed
+        --gfextend=$params.gfextend
+        --chain=$params.chain
+        --transition="$params.transition"
+        --O=$params.O
+        --E=$params.E
+        --X=$params.X
+        --Y=$params.Y
+        --K=$params.K
+        --L=$params.L
+        --entropy=$params.entropy 
+      #end if
+      --identity_min=$min_ident
+      --identity_max=$max_ident
+      --coverage=$min_cvrg
+      --output=$output1
+      --unmask=$unmask
+      --lastzSeqsFileDir=${GALAXY_DATA_INDEX_DIR}
     </command>
     <inputs>
         <param name="input2" format="fasta" type="data" label="Align sequencing reads in" />
@@ -30,10 +47,7 @@
             </param>
             <when value="cached">
                 <param name="input1_2bit" type="select" label="Using reference genome" help="If your genome of interest is not listed, contact the Galaxy team">
-                    <options from_file="lastz_seqs.loc">
-                        <column name="value" index="1" />
-                        <column name="name" index="0" />
-                    </options>
+                    <options from_data_table="lastz_seqs" />
                 </param>
             </when>
             <when value="history">
@@ -127,14 +141,15 @@
     <tests>
         <test>
             <!--
-                Lastz command:
-                lastz phiX.2bit/PHIX174[nickname=Ref] test-data/b1.fasta +nogfextend +nochain +gapped +strand=both +seed=12of19 +transition O=400 E=30 X=910 Y=9370 K=3000 L=3000 +noentropy +ambiguousn +nolaj +identity=0..100 +coverage=0 +format=sam- > lastz_wrapper_out2.sam 
-                You need to point to phiX.2bit somewhere on your system. b1.fasta is located in galaxy's test-data.  You will have to replace all the pluses before the
-                commands with 2 dashes, as double-dash can't appear in an XML comment.
+            Lastz command:
+            lastz phiX.2bit/phiX174[nickname=Ref] test-data/b1.fasta +nogfextend +nochain +gapped +strand=both +seed=12of19 +transition O=400 E=30 X=910 Y=9370 K=3000 L=3000 +noentropy +ambiguousn +nolaj +identity=0..100 +coverage=0 +format=sam- > lastz_wrapper_out2.sam 
+            You need to point to phiX.2bit somewhere on your system. b1.fasta is located in galaxy's test-data.  You will have to replace all the pluses before the
+            commands with 2 dashes, as double-dash can't appear in an XML comment.
             -->
-            <param name="input2" value="b1.fasta" ftype="fasta" />
+            <param name="input2" value="b1.fasta" ftype="fasta" dbkey="phiX" />
             <param name="ref_source" value="cached" />
-            <param name="input1_2bit" value="phiX" />
+            <!-- this is the backwards-compatible "unique value" for this file, not an actual path -->
+            <param name="input1_2bit" value="/galaxy/data/phiX/seq/phiX.2bit" />
             <param name="out_format" value="sam" />
             <param name="source_select" value="full" />
             <param name="strand" value="both" />
@@ -150,8 +165,8 @@
             <param name="L" value="3000" />
             <param name="entropy" value="noentropy" />
             <!--
-                 how_to_name is not the default. It is changed to modify 
-                input1_2bit by adding the ref_name as a nickname
+            how_to_name is not the default. It is changed to modify 
+            input1_2bit by adding the ref_name as a nickname
             -->
             <param name="how_to_name" value="yes" />
             <param name="ref_name" value="Ref" />
@@ -163,10 +178,10 @@
         </test>
         <test>
             <!--
-                Lastz command:
-                lastz test-data/phiX.fasta test-data/b1.fasta[fullnames] +yasra95short +ambiguousn +nolaj +identity=0..100 +coverage=0 +format=diffs > lastz_wrapper_out3.tabular 
-                phiX.fasta and b1.fasta are located in galaxy's test-data.  You will have to replace all the pluses before the commands with 2 dashes, 
-                as double-dash can't appear in an XML comment.
+            Lastz command:
+            lastz test-data/phiX.fasta test-data/b1.fasta[fullnames] +yasra95short +ambiguousn +nolaj +identity=0..100 +coverage=0 +format=diffs > lastz_wrapper_out3.tabular 
+            phiX.fasta and b1.fasta are located in galaxy's test-data.  You will have to replace all the pluses before the commands with 2 dashes, 
+            as double-dash can't appear in an XML comment.
             -->
             <param name="input2" value="b1.fasta" ftype="fasta" />
             <param name="ref_source" value="history" />
@@ -183,17 +198,17 @@
         </test>
         <test>
             <!--
-                Lastz command: first you will need to split the file phiX_split.fasta into two files, 
-                phiX1.fasta and phiX2.fasta, each with 1 sequence (phiX1 and phiX2, respectively). Then:
-                lastz phiX1.fasta test-data/b1.fasta *yasra95short *ambiguousn *nolaj *identity=0..100 *coverage=0 *format=general-:score,name1,strand1,size1,start1,zstart1,end1,length1,text1,name2,strand2,size2,start2,zstart2,end2,start2+,zstart2+,end2+,length2,text2,diff,cigar,identity,coverage,gaprate,diagonal,shingle > lastz_wrapper_out4.tabular 
-                lastz phiX2.fasta test-data/b1.fasta *yasra95short *ambiguousn *nolaj *identity=0..100 *coverage=0 *format=general-:score,name1,strand1,size1,start1,zstart1,end1,length1,text1,name2,strand2,size2,start2,zstart2,end2,start2+,zstart2+,end2+,length2,text2,diff,cigar,identity,coverage,gaprate,diagonal,shingle >> lastz_wrapper_out4.tabular 
-                You need to point to phiX1.fasta and phiX2.fasta somewhere on your system. 
-                phiX_split.fasta and b1.fasta are located in galaxy's test-data 
-                You will have to replace all the asterisks before the commands with 2 dashes, 
-                as double-dash can't appear in an XML comment 
-                
-                NOTE: since the input file include more than 1 sequence, the output must be sorted in 
-                order for functional test to pass.  This is done using the sort="True" attribute on the output.
+            Lastz command: first you will need to split the file phiX_split.fasta into two files, 
+            phiX1.fasta and phiX2.fasta, each with 1 sequence (phiX1 and phiX2, respectively). Then:
+            lastz phiX1.fasta test-data/b1.fasta *yasra95short *ambiguousn *nolaj *identity=0..100 *coverage=0 *format=general-:score,name1,strand1,size1,start1,zstart1,end1,length1,text1,name2,strand2,size2,start2,zstart2,end2,start2+,zstart2+,end2+,length2,text2,diff,cigar,identity,coverage,gaprate,diagonal,shingle > lastz_wrapper_out4.tabular 
+            lastz phiX2.fasta test-data/b1.fasta *yasra95short *ambiguousn *nolaj *identity=0..100 *coverage=0 *format=general-:score,name1,strand1,size1,start1,zstart1,end1,length1,text1,name2,strand2,size2,start2,zstart2,end2,start2+,zstart2+,end2+,length2,text2,diff,cigar,identity,coverage,gaprate,diagonal,shingle >> lastz_wrapper_out4.tabular 
+            You need to point to phiX1.fasta and phiX2.fasta somewhere on your system. 
+            phiX_split.fasta and b1.fasta are located in galaxy's test-data 
+            You will have to replace all the asterisks before the commands with 2 dashes, 
+            as double-dash can't appear in an XML comment 
+
+            NOTE: since the input file include more than 1 sequence, the output must be sorted in 
+            order for functional test to pass.  This is done using the sort="True" attribute on the output.
             -->
             <param name="input2" value="b1.fasta" ftype="fasta" />
             <param name="ref_source" value="history" />
diff --git a/tools/sr_mapping/srma_wrapper.py b/tools/sr_mapping/srma_wrapper.py
index 90eb7553bf3..c819f9d54fe 100644
--- a/tools/sr_mapping/srma_wrapper.py
+++ b/tools/sr_mapping/srma_wrapper.py
@@ -28,6 +28,15 @@ def stop_err( msg ):
     sys.stderr.write( '%s\n' % msg )
     sys.exit()
 
+def parseRefLoc( refLoc, refUID ):
+    for line in open( refLoc ):
+        if not line.startswith( '#' ):
+            fields = line.strip().split( '\t' )
+            if len( fields ) >= 3:
+                if fields[0] == refUID:
+                    return fields[1]
+    return None
+
 def __main__():
     #Parse Command Line
     parser = optparse.OptionParser()
@@ -125,13 +134,10 @@ def __main__():
             stop_err( 'Problem handling SRMA index (dict file) for custom genome file: %s\n' % str( e ) )
     # using built-in dict/index files
     else:
-        for line in open( options.refLocations ):
-            if not line.startswith( '#' ):
-                fields = line.strip().split( '\t' )
-                if len( fields ) >= 2:
-                    if fields[0] == options.refUID:
-                        reference_filepath_name = fields[1]
-                        break
+        if options.ref:
+            reference_filepath_name = options.ref
+        else:
+            reference_filepath_name = parseRefLoc( options.refLocation, options.refUID )
     if reference_filepath_name is None:
         raise ValueError( 'A valid genome reference was not provided.' )
 
diff --git a/tools/sr_mapping/srma_wrapper.xml b/tools/sr_mapping/srma_wrapper.xml
index 1bf94f9e37e..2738b3fca7c 100644
--- a/tools/sr_mapping/srma_wrapper.xml
+++ b/tools/sr_mapping/srma_wrapper.xml
@@ -1,17 +1,28 @@
-<tool id="srma_wrapper" name="Re-align with SRMA" version="0.1.5">
+<tool id="srma_wrapper" name="Re-align with SRMA" version="0.2.0">
   <description></description>
   <command interpreter="python">srma_wrapper.py 
     #if $refGenomeSource.refGenomeSource_type == "history":
-        --ref=$refGenomeSource.ownFile
+      --ref=$refGenomeSource.ownFile
     #else:
-        --refUID=$refGenomeSource.ref
-        --refLocations=${GALAXY_DATA_INDEX_DIR}/srma_index.loc
+      --ref="${ filter( lambda x: str( x[0] ) == str( $refGenomeSource.ref ), $__app__.tool_data_tables[ 'srma_indexes' ].get_fields() )[0][-1] }"
+      --refUID=$refGenomeSource.ref
+      --refLocations=${GALAXY_DATA_INDEX_DIR}/srma_index.loc
     #end if
-    --input=$input --inputIndex=${input.metadata.bam_index} --output=$output
-    --params=$params.source_select --fileSource=$refGenomeSource.refGenomeSource_type
+    --input=$input
+    --inputIndex=${input.metadata.bam_index}
+    --output=$output
+    --params=$params.source_select
+    --fileSource=$refGenomeSource.refGenomeSource_type
     --jarBin="${GALAXY_DATA_INDEX_DIR}/shared/jars"
     #if $params.source_select == "full":
-        --offset=$params.offset --minMappingQuality=$params.minMappingQuality --minAlleleProbability=$params.minAlleleProbability --minAlleleCoverage=$params.minAlleleCoverage --range=$params.range --correctBases=$params.correctBases --useSequenceQualities=$params.useSequenceQualities --maxHeapSize=$params.maxHeapSize
+      --offset=$params.offset
+      --minMappingQuality=$params.minMappingQuality
+      --minAlleleProbability=$params.minAlleleProbability
+      --minAlleleCoverage=$params.minAlleleCoverage
+      --range=$params.range
+      --correctBases=$params.correctBases
+      --useSequenceQualities=$params.useSequenceQualities
+      --maxHeapSize=$params.maxHeapSize
     #end if
     --jarFile="srma.jar"
   </command>
@@ -23,10 +34,7 @@
       </param>
       <when value="built-in">
         <param name="ref" type="select" label="Select a reference genome">
-          <options from_file="srma_index.loc">
-            <column name="value" index="0" />
-            <column name="name" index="0" />
-          </options>
+          <options from_data_table="srma_indexes" />
         </param>
       </when>
       <when value="history">
@@ -71,13 +79,13 @@
   <tests>
       <test>
           <!-- Commands to run to prepare test files (uses built-in index)
-            Prepare bam index file:
-            samtools index srma_in1.bam
-            Run SRMA:
-            java -jar "srma.jar" I=srma_in1.bam O=srma_out1.bam R=/afs/bx.psu.edu/depot/data/genome/hg18/srma_index/chr21.fa
-            To create the bam file first, start with a sam file (srma_in1.sam) generated with a run using the chr21 fasta file and which contains the header. Run before samtools index:
-            samtools view -bt /afs/bx.psu.edu/depot/data/genome/hg18/sam_index/chr21.fa -o srma_in1.u.bam srma_in1.sam
-            samtools sort srma_in1.u.bam srma_in1
+          Prepare bam index file:
+          samtools index srma_in1.bam
+          Run SRMA:
+          java -jar "srma.jar" I=srma_in1.bam O=srma_out1.bam R=/afs/bx.psu.edu/depot/data/genome/hg18/srma_index/chr21.fa
+          To create the bam file first, start with a sam file (srma_in1.sam) generated with a run using the chr21 fasta file and which contains the header. Run before samtools index:
+          samtools view -bt /afs/bx.psu.edu/depot/data/genome/hg18/sam_index/chr21.fa -o srma_in1.u.bam srma_in1.sam
+          samtools sort srma_in1.u.bam srma_in1
           -->
           <param name="refGenomeSource_type" value="built-in" />
           <param name="ref" value="hg18chr21" />
@@ -87,16 +95,16 @@
       </test>
       <test>
           <!-- Commands to run to prepare test files (uses custom genome):
-            Prepare custom dict/index files:
-            samtools faidx srma_in2.fa
-            java -cp "srma.jar" net.sf.picard.sam.CreateSequenceDictionary R=srma_in2.fa O=srma_in2.dict
-            Prepare bam index file:
-            samtools index srma_in3.bam
-            Run SRMA:
-            java -jar "srma.jar" I=srma_in3.bam O=srma_out2.bam R=srma_in2.fa OFFSET=20 MIN_MAPQ=0 MINIMUM_ALLELE_PROBABILITY=0.1 MINIMUM_ALLELE_COVERAGE=2 RANGES=null RANGE=null CORRECT_BASES=true USE_SEQUENCE_QUALITIES=true MAX_HEAP_SIZE=8192
-            To create the bam file first, the sam file needs to have been run with the same reference file (srma_in2.fa) and have the header present. Run these commands before samtools index:
-            samtools view -bt srma_in2.fa -o srma_in3.u.bam srma_in1.sam
-            samtools sort srma_in3.u.bam srma_in3
+          Prepare custom dict/index files:
+          samtools faidx srma_in2.fa
+          java -cp "srma.jar" net.sf.picard.sam.CreateSequenceDictionary R=srma_in2.fa O=srma_in2.dict
+          Prepare bam index file:
+          samtools index srma_in3.bam
+          Run SRMA:
+          java -jar "srma.jar" I=srma_in3.bam O=srma_out2.bam R=srma_in2.fa OFFSET=20 MIN_MAPQ=0 MINIMUM_ALLELE_PROBABILITY=0.1 MINIMUM_ALLELE_COVERAGE=2 RANGES=null RANGE=null CORRECT_BASES=true USE_SEQUENCE_QUALITIES=true MAX_HEAP_SIZE=8192
+          To create the bam file first, the sam file needs to have been run with the same reference file (srma_in2.fa) and have the header present. Run these commands before samtools index:
+          samtools view -bt srma_in2.fa -o srma_in3.u.bam srma_in1.sam
+          samtools sort srma_in3.u.bam srma_in3
           -->
           <param name="refGenomeSource_type" value="history" />
           <param name="ownFile" value="srma_in2.fa" />