diff --git a/tools/emboss_5/emboss_fuzztran.xml b/tools/emboss_5/emboss_fuzztran.xml new file mode 100644 index 00000000000..fe1aff02bfd --- /dev/null +++ b/tools/emboss_5/emboss_fuzztran.xml @@ -0,0 +1,94 @@ + + Protein pattern search after translation + fuzztran -sequence $input1 -outfile $out_file1 -pattern "$pattern" -pmismatch $mismatch -frame $frame -table $table -rformat2 $out_format1 -auto + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +.. class:: warningmark + +The input dataset needs to be sequences. + +----- + + You can view the original documentation here_. + + .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/fuzztran.html + + diff --git a/tools/emboss_5/emboss_getorf.xml b/tools/emboss_5/emboss_getorf.xml new file mode 100644 index 00000000000..d79ae936cac --- /dev/null +++ b/tools/emboss_5/emboss_getorf.xml @@ -0,0 +1,128 @@ + + Finds and extracts open reading frames (ORFs) + getorf -sequence $input1 -outseq $out_file1 -table $table -minsize $minsize -maxsize $maxsize -find $find -methionine $methionine -circular $circular -reverse $reverse -flanking $flanking + -osformat2 $out_format1 -auto + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +.. class:: warningmark + +The input dataset needs to be sequences. + +----- + + You can view the original documentation here_. + + .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/getorf.html + + diff --git a/tools/emboss_5/emboss_isochore.xml b/tools/emboss_5/emboss_isochore.xml new file mode 100644 index 00000000000..8a12aa6b3e2 --- /dev/null +++ b/tools/emboss_5/emboss_isochore.xml @@ -0,0 +1,81 @@ + + Plots isochores in large DNA sequences + emboss_single_outputfile_wrapper.pl isochore -sequence $input1 -outfile $ofile2 -goutfile $ofile1 -graph png -window $window -shift $shift -auto + + + + + + + + + + + + + + + + + + + +.. class:: warningmark + +The input dataset needs to be sequences. + +----- + +**Syntax** + +This application plots GC content over a sequence. It is intended for large sequences such as complete chromosomes or large genomic contigs, although interesting results can also be obtained from shorter sequences. You can view the original documentation here_. + + .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/isochore.html + +- Both **Window size** and **Shift increment** are intergers. + +----- + +**Example** + +- Input sequences:: + + >hg18_dna range=chrX:151073054-151073376 5'pad=0 3'pad=0 revComp=FALSE strand=? repeatMasking=none + TTTATGTCTATAATCCTTACCAAAAGTTACCTTGGAATAAGAAGAAGTCA + GTAAAAAGAAGGCTGTTGTTCCGTGAAATACTGTCTTTATGCCTCAGATT + TGGAGTGCTCAGAGCCTCTGCAGCAAAGATTTGGCATGTGTCCTAGGCCT + GCTCAGAGCAGCAAATCCCACCCTCTTGGAGAATGAGACTCATAGAGGGA + CAGCTCCCTCCTCAGAGGCTTCTCTAATGGGACTCCAAAGAGCAAACACT + CAGCCCCATGAGGACTGGCCAGGCCAAGTGGTGTGTGGGAACAGGGAGCA + GCGGTTTCCAAGAGGATACAGTA + +- Output data file:: + + Position Percent G+C 1 .. 323 + 80 0.422 + 112 0.460 + 144 0.509 + 176 0.534 + 208 0.553 + 240 0.553 + +- Output graphics file: + +.. image:: ../static/emboss_icons/isochore.png + + +