From 646a2ca7ac1db87e07ab022254c8209f9146f598 Mon Sep 17 00:00:00 2001 From: Daniel Blankenberg Date: Tue, 31 Jul 2007 18:35:48 +0000 Subject: [PATCH] MAF tools are no longer duplicated for different sources, i.e. locally cached and user histories. Tests will not pass until testing framework is updated to be compatible with new tool options. Several files can be removed, but have been left for the time being: tools/filters/maf/maf_to_fasta_multiple_sets.xml tools/filters/maf/maf_to_fasta_concat.xml tools/extract/user_interval2maf.xml tools/extract/interval_maf_to_merged_fasta_user.xml tools/extract/interval_maf_to_merged_fasta_user_code.py tools/extract/genebed_maf_to_fasta_user.xml tools/extract/genebed_maf_to_fasta_user_code.py --- tool_conf.xml.main | 5 +- tool_conf.xml.sample | 6 +- tools/extract/genebed_maf_to_fasta.xml | 48 ++++- tools/extract/genebed_maf_to_fasta_code.py | 60 +++++- tools/extract/interval2maf.xml | 41 ++-- tools/extract/interval2maf_code.py | 7 +- tools/extract/interval2maf_pairwise.xml | 38 +--- .../extract/interval_maf_to_merged_fasta.xml | 55 ++--- .../interval_maf_to_merged_fasta_code.py | 60 +++++- tools/filters/maf/maf_by_block_number.xml | 3 + tools/filters/maf/maf_limit_size.xml | 3 + tools/filters/maf/maf_stats.xml | 3 + tools/filters/maf/maf_thread_for_species.xml | 4 +- tools/filters/maf/maf_to_fasta.xml | 188 ++++++++++++++++++ 14 files changed, 405 insertions(+), 116 deletions(-) create mode 100644 tools/filters/maf/maf_to_fasta.xml diff --git a/tool_conf.xml.main b/tool_conf.xml.main index dd925f2bb46..b14eb0ed669 100644 --- a/tool_conf.xml.main +++ b/tool_conf.xml.main @@ -52,8 +52,7 @@
- - + @@ -76,9 +75,7 @@
- - diff --git a/tool_conf.xml.sample b/tool_conf.xml.sample index 92f46426188..de4b596ffd5 100644 --- a/tool_conf.xml.sample +++ b/tool_conf.xml.sample @@ -52,8 +52,7 @@
- - + @@ -76,11 +75,8 @@
- - - diff --git a/tools/extract/genebed_maf_to_fasta.xml b/tools/extract/genebed_maf_to_fasta.xml index 617307b32df..d5716ba3ed4 100644 --- a/tools/extract/genebed_maf_to_fasta.xml +++ b/tools/extract/genebed_maf_to_fasta.xml @@ -1,9 +1,12 @@ - - from locally cached alignments - genebed_maf_to_fasta.py $dbkey $species $mafSource $input1 $out_file1 - + + given a set of coding exon intervals + #if $maf_source_type.maf_source == "user":#genebed_maf_to_fasta_user.py $dbkey $species $maf_source_type.input2 $input1 $out_file1 - +#else:#genebed_maf_to_fasta.py $dbkey $species $maf_source_type.maf_uid $input1 $out_file1 - +#end if + - + - + + + + + + + + + + + + - + @@ -23,13 +37,31 @@ -This tool takes a Gene BED file and creates a FASTA file which contains alignments of user specified species which correspond to the coding exons of the supplied Gene using locally cached alignments. + +**What it does** + +The coding sequence of genes are usually composed of several coding exons. Each of these coding exons is an individual genomic region, which when concatenated with each other constitutes the coding sequence. A single genomic region can be covered by multiple alignment blocks. In many cases it is desirable to stitch these alignment blocks together. This tool accepts a list of gene-based intervals, in the Gene BED format. For every interval it performs the following: + + * finds all MAF blocks that overlap the coding regions; + * sorts MAF blocks by alignment score; + * stitches blocks together and resolves overlaps based on alignment score; + * outputs alignments in FASTA format. + + diff --git a/tools/extract/genebed_maf_to_fasta_code.py b/tools/extract/genebed_maf_to_fasta_code.py index c45ccb12bd9..575f7e16e58 100644 --- a/tools/extract/genebed_maf_to_fasta_code.py +++ b/tools/extract/genebed_maf_to_fasta_code.py @@ -1,5 +1,7 @@ #build list of available data import os, sys +import pkg_resources; pkg_resources.require( "bx-python" ) +import bx.align.maf maf_sets = {} try: @@ -37,14 +39,52 @@ def get_available_data( build ): available_sets.append(('No data available for this build','None',True)) return available_sets -def get_available_species( maf_uid ): - available_sets = [] - for key in maf_sets[maf_uid]['builds']: - available_sets.append((key,key,True)) - if len(available_sets) < 1: - available_sets.append(('No data available for this configuration','None',True)) - return available_sets +def get_available_species( maf_source_type ): + if maf_source_type['maf_source'] == 'cached': + maf_uid = maf_source_type['maf_uid'] + available_sets = [] + for key in maf_sets[maf_uid]['builds']: + available_sets.append((key,key,True)) + if len(available_sets) < 1: + available_sets.append(('No data available for this configuration','None',True)) + return available_sets + else: + try: + rval = [] + species={} + input_filename = maf_source_type['input2'].file_name + try: + file_in = open(input_filename, 'r') + maf_reader = bx.align.maf.Reader( file_in ) + + for i, m in enumerate( maf_reader ): + l = m.components + for c in l: + spec,chrom = bx.align.maf.src_split( c.src ) + if not spec or not chrom: + spec = chrom = c.src + if spec not in species: + species[spec]={"bases":0,"nongaps":0} + species[spec]["bases"] = species[spec]["bases"] + c.size + c.text.count("-") + species[spec]["nongaps"] = species[spec]["nongaps"] + c.size + + file_in.close() + except Exception: + return [("There is a problem with your MAF file",'None',True)] + species_names = species.keys() + species_names.sort() + + for spec in species_names: + #species_sequence[spec] = "".join(species_sequence[spec]) + + display = "%s: %i nongap, %i total bases" % (spec, species[spec]["nongaps"], species[spec]["bases"] ) + rval.append( ( display,spec,True) ) + + return rval + except: + return [("You must wait for the MAF file to be created before you can use this tool.",'None',True)] -def exec_before_job(app,inp_data, out_data, param_dict, tool): - for name, data in out_data.items(): - data.name = data.name + " [" + maf_sets[param_dict['mafSource']]['description'] + "]" +def exec_before_job(app, inp_data, out_data, param_dict, tool): + if param_dict['maf_source_type']['maf_source'] == "cached": + for name, data in out_data.items(): + data.name = data.name + " [" + maf_sets[str(param_dict['maf_source_type']['maf_uid'])]['description'] + "]" diff --git a/tools/extract/interval2maf.xml b/tools/extract/interval2maf.xml index a37025e1319..b91ae98f81a 100644 --- a/tools/extract/interval2maf.xml +++ b/tools/extract/interval2maf.xml @@ -1,38 +1,49 @@ - from locally cached alignments - interval2maf.py --dbkey=$dbkey --chromCol=$input1_chromCol --startCol=$input1_startCol --endCol=$input1_endCol --strandCol=$input1_strandCol --mafType=$mafType --interval_file=$input1 --output_file=$out_file1 + given a set of genomic intervals + #if $maf_source_type.maf_source == "user":#user_interval2maf.py --dbkey=$input1_dbkey --chromCol=$input1_chromCol --startCol=$input1_startCol --endCol=$input1_endCol --strandCol=$input1_strandCol --mafFile=$maf_source_type.mafFile --interval_file=$input1 --output_file=$out_file1 +#else:#interval2maf.py --dbkey=$input1_dbkey --chromCol=$input1_chromCol --startCol=$input1_startCol --endCol=$input1_endCol --strandCol=$input1_strandCol --mafType=$maf_source_type.mafType --interval_file=$input1 --output_file=$out_file1 +#end if + - + + + + + + + + + + + + - + + + + + + + + - -.. class:: infomark - -What is the differences between these two tools: **Extract MAF blocks from locally cached alignments** and **Extract MAF blocks from user supplied alignments**? - - * **Extract MAF blocks from locally cached alignments** uses alignments stored at Galaxy installation at Penn State and is appropriate for most situations. It takes only one dataset as the input - a list of genomic intervals. - * **Extract MAF blocks from user supplied alignments** allows the user to work with his/her own alignments instead of those cached at Galaxy site. This tool takes two datasets as inputs - (1) genomic intervals and (2) alignments. - ------ - **What it does** -This tool takes genomic coordinates, superimposes them on multiple alignments (in MAF format) stored on Galaxy site, and excises alignment blocks corresponding to each set of coordinates. Alignment blocks that extend past START and/or END positions of an interval are trimmed. Note that a single genomic interval may correspond to two or more alignment blocks. +This tool takes genomic coordinates, superimposes them on multiple alignments (in MAF format) stored on the Galaxy site or from your history, and excises alignment blocks corresponding to each set of coordinates. Alignment blocks that extend past START and/or END positions of an interval are trimmed. Note that a single genomic interval may correspond to two or more alignment blocks. ----- diff --git a/tools/extract/interval2maf_code.py b/tools/extract/interval2maf_code.py index 745e0dc84a7..870566f4d69 100644 --- a/tools/extract/interval2maf_code.py +++ b/tools/extract/interval2maf_code.py @@ -38,6 +38,7 @@ def get_available_data( build ): return available_sets -def exec_before_job(app,inp_data, out_data, param_dict, tool): - for name, data in out_data.items(): - data.name = data.name + " [" + maf_sets[param_dict['mafType']]['description'] + "]" +def exec_before_job(app, inp_data, out_data, param_dict, tool): + if param_dict['maf_source_type']['maf_source'] == "cached": + for name, data in out_data.items(): + data.name = data.name + " [" + maf_sets[str(param_dict['maf_source_type']['mafType'])]['description'] + "]" diff --git a/tools/extract/interval2maf_pairwise.xml b/tools/extract/interval2maf_pairwise.xml index 72fdd0bb92c..38ca12c326f 100644 --- a/tools/extract/interval2maf_pairwise.xml +++ b/tools/extract/interval2maf_pairwise.xml @@ -13,47 +13,17 @@ +**What it does** -.. class:: infomark - -**TIP:** If your query does not work, you need to ensure that you have specified a database build for your data. Alignments may also not be available for your build or intervals at this time. - ------ - -**Syntax** - -This tool uses coordinate and strand information to fetch sequence in MAF format. - -- **MAF format** multiple alignment format file. This format stores multiple alignments at the DNA level between entire genomes. - - - The .maf format is line-oriented. Each multiple alignment ends with a blank line. - - Each sequence in an alignment is on a single line. - - Lines starting with # are considered to be comments. - - Each multiple alignment is in a separate paragraph that begins with an "a" line and contains an "s" line for each sequence in the multiple alignment. - - Some MAF files may contain two optional line types: - - - An "i" line containing information about what is in the aligned species DNA before and after the immediately preceding "s" line; - - An "e" line containing information about the size of the gap between the alignments that span the current block. +This tool takes genomic coordinates, superimposes them on pairwise alignments (in MAF format) stored on the Galaxy site, and excises alignment blocks corresponding to each set of coordinates. Alignment blocks that extend past START and/or END positions of an interval are trimmed. Note that a single genomic interval may correspond to two or more alignment blocks. ----- **Example** -- Input file:: +Here a single interval is superimposed on three MAF blocks. Blocks 1 and 3 are trimmed because they extend beyond boundaries of the interval: - chr7 127475281 127475310 NM_000230 0 + - chr7 127486011 127486166 D49487 0 + - -- Extract 8-way multiZ alignments in MAF format from above file:: - - ##maf version=1 - a score=301244.0 - s hg17.chr7 127475281 29 + 158628139 GTAGGAATCGCAGCGCCAGCGGTTGCAAG - s panTro1.chr6 129889135 29 + 161576975 GTAGGAATCGCAGCGCCAGCGGTTGCAAG - - a score=407957.0 - s hg17.chr7 127486011 155 + 158628139 TGGGAAGGAAAATGCATTGGGGAACCCTGTGCGGATTCTTGTGGCTTTGGCCCTATCTTTTCTATGTCCAAGCTGTGCCCATCCAAAAAGTCCAAGATGACACCAAAACCCTCATCAAGACAATTGTCACCAGGATCAATGACATTTCACACACG - s panTro1.chr6 129900247 155 + 161576975 TGGGAAGGAAAATGCATTGGGGAACCCTGTGCGGATTCTTGTGGCTTTGGCCCTATCTTTTCTATGTCCAAGCTGTGCCCATCCAAAAAGTCCAAGATGACACCAAAACCCTCATCAAGACAATTGTCACCAGGATCAATGACATTTCACACACG +.. image:: ../static/images/maf_icons/interval2maf.png diff --git a/tools/extract/interval_maf_to_merged_fasta.xml b/tools/extract/interval_maf_to_merged_fasta.xml index 73831336331..770067b9f8e 100644 --- a/tools/extract/interval_maf_to_merged_fasta.xml +++ b/tools/extract/interval_maf_to_merged_fasta.xml @@ -1,20 +1,29 @@ - - using locally cached alignments - interval_maf_to_merged_fasta.py $dbkey $species $mafSource $input1 $out_file1 $input1_chromCol $input1_startCol $input1_endCol $input1_strandCol - + + given a set of genomic intervals + #if $maf_source_type.maf_source == "user":#interval_maf_to_merged_fasta_user.py $dbkey $species $maf_source_type.input2 $input1 $out_file1 $input1_chromCol $input1_startCol $input1_endCol $input1_strandCol - +#else:#interval_maf_to_merged_fasta.py $dbkey $species $maf_source_type.maf_uid $input1 $out_file1 $input1_chromCol $input1_startCol $input1_endCol $input1_strandCol - +#end if + - - + + + + + + + + + + + + - + @@ -23,25 +32,21 @@ - + + - + + + + + + + + - -.. class:: infomark - -What is the differences between these two tools: **Stitch MAF blocks for intervals using locally cached alignments** and **Stitch MAF blocks for intervals from user supplied alignments**? - - * **Stitch MAF blocks for intervals using locally cached alignments** uses alignments stored at Galaxy installation at Penn State and is appropriate for most situations. It takes only one dataset as the input - a list of genomic intervals. - * **Stitch MAF blocks for intervals from user supplied alignments** allows the user to work with his/her own alignments instead of those cached at Galaxy site. This tool takes two datasets as inputs - (1) genomic intervals and (2) alignments. - -In the future these two tools will be merged. - ------- - -**What It Does** +**What it does** A single genomic region can be covered by multiple alignment blocks. In many cases it is desirable to stitch these alignment blocks together. This tool accepts a list of genomic intervals. For every interval it performs the following: diff --git a/tools/extract/interval_maf_to_merged_fasta_code.py b/tools/extract/interval_maf_to_merged_fasta_code.py index b7e3070b342..be05466fd52 100644 --- a/tools/extract/interval_maf_to_merged_fasta_code.py +++ b/tools/extract/interval_maf_to_merged_fasta_code.py @@ -1,5 +1,6 @@ #build list of available data import os, sys +import bx.align.maf maf_sets = {} try: @@ -37,14 +38,53 @@ def get_available_data( build ): available_sets.append(('No data available for this build','None',True)) return available_sets -def get_available_species( maf_uid ): - available_sets = [] - for key in maf_sets[maf_uid]['builds']: - available_sets.append((key,key,True)) - if len(available_sets) < 1: - available_sets.append(('No data available for this configuration','None',True)) - return available_sets +def get_available_species( maf_source_type ): + if maf_source_type['maf_source'] == 'cached': + maf_uid = maf_source_type['maf_uid'] + available_sets = [] + for key in maf_sets[maf_uid]['builds']: + available_sets.append((key,key,True)) + if len(available_sets) < 1: + available_sets.append(('No data available for this configuration','None',True)) + return available_sets + else: + try: + rval = [] + species={} + input_filename = maf_source_type['input2'].file_name + try: + file_in = open(input_filename, 'r') + maf_reader = bx.align.maf.Reader( file_in ) + + for i, m in enumerate( maf_reader ): + l = m.components + for c in l: + spec,chrom = bx.align.maf.src_split( c.src ) + if not spec or not chrom: + spec = chrom = c.src + if spec not in species: + species[spec]={"bases":0,"nongaps":0} + species[spec]["bases"] = species[spec]["bases"] + c.size + c.text.count("-") + species[spec]["nongaps"] = species[spec]["nongaps"] + c.size + + file_in.close() + except Exception: + return [("There is a problem with your MAF file",'None',True)] + species_names = species.keys() + species_names.sort() + + for spec in species_names: + #species_sequence[spec] = "".join(species_sequence[spec]) + + display = "%s: %i nongap, %i total bases" % (spec, species[spec]["nongaps"], species[spec]["bases"] ) + rval.append( ( display,spec,True) ) + + return rval + except: + return [("You must wait for the MAF file to be created before you can use this tool.",'None',True)] -def exec_before_job(app,inp_data, out_data, param_dict, tool): - for name, data in out_data.items(): - data.name = data.name + " [" + maf_sets[param_dict['mafSource']]['description'] + "]" + +def exec_before_job(app, inp_data, out_data, param_dict, tool): + if param_dict['maf_source_type']['maf_source'] == "cached": + for name, data in out_data.items(): + data.name = data.name + " [" + maf_sets[str(param_dict['maf_source_type']['maf_uid'])]['description'] + "]" diff --git a/tools/filters/maf/maf_by_block_number.xml b/tools/filters/maf/maf_by_block_number.xml index d0537758f9d..b702f16731b 100644 --- a/tools/filters/maf/maf_by_block_number.xml +++ b/tools/filters/maf/maf_by_block_number.xml @@ -20,6 +20,9 @@ + +**What it does** + This tool takes a list of block numbers, one per line, and extracts the corresponding MAF blocks from the provided file. Block numbers start at 0. diff --git a/tools/filters/maf/maf_limit_size.xml b/tools/filters/maf/maf_limit_size.xml index da3d582e7ce..9f526f5d2c7 100644 --- a/tools/filters/maf/maf_limit_size.xml +++ b/tools/filters/maf/maf_limit_size.xml @@ -20,6 +20,9 @@ + +**What it does** + This tool takes a MAF file and a size range and extracts the MAF blocks which fall within the specified range. diff --git a/tools/filters/maf/maf_stats.xml b/tools/filters/maf/maf_stats.xml index f6cfb48b503..514c01ab727 100644 --- a/tools/filters/maf/maf_stats.xml +++ b/tools/filters/maf/maf_stats.xml @@ -39,6 +39,9 @@ $maf_source_type.maf_source $maf_source_type.mafType $input1 $out_file1 $dbkey $ + +**What it does** + This tool takes a MAF file and an interval file and relates coverage information by interval for each species. If a column does not exist in the reference genome, it is not included in the output. diff --git a/tools/filters/maf/maf_thread_for_species.xml b/tools/filters/maf/maf_thread_for_species.xml index c4e3e8bcb74..bb43d2eed33 100644 --- a/tools/filters/maf/maf_thread_for_species.xml +++ b/tools/filters/maf/maf_thread_for_species.xml @@ -1,4 +1,4 @@ - + by Species maf_thread_for_species.py $input1 $out_file1 $species @@ -21,7 +21,7 @@ -**What It Does** +**What it does** This tool allows the user to merge MAF blocks which are adjoining in each specified species from a MAF file. Columns which contain only gaps are removed. Species which are not desired are removed from the output. diff --git a/tools/filters/maf/maf_to_fasta.xml b/tools/filters/maf/maf_to_fasta.xml new file mode 100644 index 00000000000..167056b803b --- /dev/null +++ b/tools/filters/maf/maf_to_fasta.xml @@ -0,0 +1,188 @@ + + Converts a MAF formated file to FASTA format + #if $fasta_target_type.fasta_type == "multiple":#maf_to_fasta_multiple_sets.py $input1 $out_file1 $fasta_target_type.species $fasta_target_type.complete_blocks +#else:#maf_to_fasta_concat.py $fasta_target_type.species $input1 $out_file1 +#end if + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +**Types of MAF to FASTA conversion** + + * **Multiple Blocks** converts a single MAF block to a single FASTA block. For example, if you have 6 MAF blocks, they will be converted to 6 FASTA blocks. + * **One Sequence per Species** converts MAF blocks to a single aggregated FASTA block. For example, if you have 6 MAF blocks, they will be converted and concatenated into a single FASTA block. + +------- + +**What it does** + +This tool converts MAF blocks to FASTA format and concatenates them into a single FASTA block or outputs multiple FASTA blocks separated by empty lines. + +The interface for this tool contains two pages (steps): + + * **Step 1 of 2**. Choose multiple alignments from history to be converted to FASTA format. + * **Step 2 of 2**. Choose the type of output as well as the species from the alignment to be included in the output. + + Multiple Block output has additional options: + + * **Choose species** - the tool reads the alignment provided during Step 1 and generates a list of species contained within that alignment. Using checkboxes you can specify taxa to be included in the output (all species are selected by default). + * **Choose to include/exclude blocks with missing species** - if an alignment block does not contain any one of the species you selected within **Choose species** menu and this option is set to **exclude blocks with missing species**, then such a block **will not** be included in the output (see **Example 2** below). For example, if you want to extact human, mouse, and rat from a series of alignments and one of the blocks does not contain mouse sequence, then this block will not be converted to FASTA and will not be returned. + + +----- + +**Example 1**: + +In the concatenated approach, the following alignment:: + + ##maf version=1 + a score=68686.000000 + s hg18.chr20 56827368 75 + 62435964 GACAGGGTGCATCTGGGAGGG---CCTGCCGGGCCTTTA-TTCAACACTAGATACGCCCCATCTCCAATTCTAATGGAC- + s panTro2.chr20 56528685 75 + 62293572 GACAGGGTGCATCTGAGAGGG---CCTGCCAGGCCTTTA-TTCAACACTAGATACGCCCCATCTCCAATTCTAATGGAC- + s rheMac2.chr10 89144112 69 - 94855758 GACAGGGTGCATCTGAGAGGG---CCTGCTGGGCCTTTG-TTCAAAACTAGATATGCCCCAACTCCAATTCTA------- + s mm8.chr2 173910832 61 + 181976762 AGAAGGATCCACCT------------TGCTGGGCCTCTGCTCCAGCAAGACCCACCTCCCAACTCAAATGCCC------- + s canFam2.chr24 46551822 67 + 50763139 CG------GCGTCTGTAAGGGGCCACCGCCCGGCCTGTG-CTCAAAGCTACAAATGACTCAACTCCCAACCGA------C + + a score=10289.000000 + s hg18.chr20 56827443 37 + 62435964 ATGTGCAGAAAATGTGATACAGAAACCTGCAGAGCAG + s panTro2.chr20 56528760 37 + 62293572 ATGTGCAGAAAATGTGATACAGAAACCTGCAGAGCAG + s rheMac2.chr10 89144181 37 - 94855758 ATGTGCGGAAAATGTGATACAGAAACCTGCAGAGCAG + +will be converted to (**note** that because mm8 (mouse) and canFam2 (dog) are absent from the second block, they are replaced with gaps after concatenation):: + + >canFam2 + CG------GCGTCTGTAAGGGGCCACCGCCCGGCCTGTG-CTCAAAGCTACAAATGACTCAACTCCCAACCGA------C------------------------------------- + >hg18 + GACAGGGTGCATCTGGGAGGG---CCTGCCGGGCCTTTA-TTCAACACTAGATACGCCCCATCTCCAATTCTAATGGAC-ATGTGCAGAAAATGTGATACAGAAACCTGCAGAGCAG + >mm8 + AGAAGGATCCACCT------------TGCTGGGCCTCTGCTCCAGCAAGACCCACCTCCCAACTCAAATGCCC-------------------------------------------- + >panTro2 + GACAGGGTGCATCTGAGAGGG---CCTGCCAGGCCTTTA-TTCAACACTAGATACGCCCCATCTCCAATTCTAATGGAC-ATGTGCAGAAAATGTGATACAGAAACCTGCAGAGCAG + >rheMac2 + GACAGGGTGCATCTGAGAGGG---CCTGCTGGGCCTTTG-TTCAAAACTAGATATGCCCCAACTCCAATTCTA-------ATGTGCGGAAAATGTGATACAGAAACCTGCAGAGCAG + +------ + +**Example 2a**: Multiple Block Approach **Include all species** and **include blocks with missing species**: + +The following alignment:: + + ##maf version=1 + a score=68686.000000 + s hg18.chr20 56827368 75 + 62435964 GACAGGGTGCATCTGGGAGGG---CCTGCCGGGCCTTTA-TTCAACACTAGATACGCCCCATCTCCAATTCTAATGGAC- + s panTro2.chr20 56528685 75 + 62293572 GACAGGGTGCATCTGAGAGGG---CCTGCCAGGCCTTTA-TTCAACACTAGATACGCCCCATCTCCAATTCTAATGGAC- + s rheMac2.chr10 89144112 69 - 94855758 GACAGGGTGCATCTGAGAGGG---CCTGCTGGGCCTTTG-TTCAAAACTAGATATGCCCCAACTCCAATTCTA------- + s mm8.chr2 173910832 61 + 181976762 AGAAGGATCCACCT------------TGCTGGGCCTCTGCTCCAGCAAGACCCACCTCCCAACTCAAATGCCC------- + s canFam2.chr24 46551822 67 + 50763139 CG------GCGTCTGTAAGGGGCCACCGCCCGGCCTGTG-CTCAAAGCTACAAATGACTCAACTCCCAACCGA------C + + a score=10289.000000 + s hg18.chr20 56827443 37 + 62435964 ATGTGCAGAAAATGTGATACAGAAACCTGCAGAGCAG + s panTro2.chr20 56528760 37 + 62293572 ATGTGCAGAAAATGTGATACAGAAACCTGCAGAGCAG + s rheMac2.chr10 89144181 37 - 94855758 ATGTGCGGAAAATGTGATACAGAAACCTGCAGAGCAG + +will be converted to:: + + >hg18.chr20(+):56827368-56827443|hg18_0 + GACAGGGTGCATCTGGGAGGG---CCTGCCGGGCCTTTA-TTCAACACTAGATACGCCCCATCTCCAATTCTAATGGAC- + >panTro2.chr20(+):56528685-56528760|panTro2_0 + GACAGGGTGCATCTGAGAGGG---CCTGCCAGGCCTTTA-TTCAACACTAGATACGCCCCATCTCCAATTCTAATGGAC- + >rheMac2.chr10(-):89144112-89144181|rheMac2_0 + GACAGGGTGCATCTGAGAGGG---CCTGCTGGGCCTTTG-TTCAAAACTAGATATGCCCCAACTCCAATTCTA------- + >mm8.chr2(+):173910832-173910893|mm8_0 + AGAAGGATCCACCT------------TGCTGGGCCTCTGCTCCAGCAAGACCCACCTCCCAACTCAAATGCCC------- + >canFam2.chr24(+):46551822-46551889|canFam2_0 + CG------GCGTCTGTAAGGGGCCACCGCCCGGCCTGTG-CTCAAAGCTACAAATGACTCAACTCCCAACCGA------C + + >hg18.chr20(+):56827443-56827480|hg18_1 + ATGTGCAGAAAATGTGATACAGAAACCTGCAGAGCAG + >panTro2.chr20(+):56528760-56528797|panTro2_1 + ATGTGCAGAAAATGTGATACAGAAACCTGCAGAGCAG + >rheMac2.chr10(-):89144181-89144218|rheMac2_1 + ATGTGCGGAAAATGTGATACAGAAACCTGCAGAGCAG + +----- + +**Example 2b**: Multiple Block Approach **Include hg18 and mm8** and **exclude blocks with missing species**: + +The following alignment:: + + ##maf version=1 + a score=68686.000000 + s hg18.chr20 56827368 75 + 62435964 GACAGGGTGCATCTGGGAGGG---CCTGCCGGGCCTTTA-TTCAACACTAGATACGCCCCATCTCCAATTCTAATGGAC- + s panTro2.chr20 56528685 75 + 62293572 GACAGGGTGCATCTGAGAGGG---CCTGCCAGGCCTTTA-TTCAACACTAGATACGCCCCATCTCCAATTCTAATGGAC- + s rheMac2.chr10 89144112 69 - 94855758 GACAGGGTGCATCTGAGAGGG---CCTGCTGGGCCTTTG-TTCAAAACTAGATATGCCCCAACTCCAATTCTA------- + s mm8.chr2 173910832 61 + 181976762 AGAAGGATCCACCT------------TGCTGGGCCTCTGCTCCAGCAAGACCCACCTCCCAACTCAAATGCCC------- + s canFam2.chr24 46551822 67 + 50763139 CG------GCGTCTGTAAGGGGCCACCGCCCGGCCTGTG-CTCAAAGCTACAAATGACTCAACTCCCAACCGA------C + + a score=10289.000000 + s hg18.chr20 56827443 37 + 62435964 ATGTGCAGAAAATGTGATACAGAAACCTGCAGAGCAG + s panTro2.chr20 56528760 37 + 62293572 ATGTGCAGAAAATGTGATACAGAAACCTGCAGAGCAG + s rheMac2.chr10 89144181 37 - 94855758 ATGTGCGGAAAATGTGATACAGAAACCTGCAGAGCAG + +will be converted to (**note** that the second MAF block, which does not have mm8, is not included in the output):: + + >hg18.chr20(+):56827368-56827443|hg18_0 + GACAGGGTGCATCTGGGAGGGCCTGCCGGGCCTTTA-TTCAACACTAGATACGCCCCATCTCCAATTCTAATGGAC + >mm8.chr2(+):173910832-173910893|mm8_0 + AGAAGGATCCACCT---------TGCTGGGCCTCTGCTCCAGCAAGACCCACCTCCCAACTCAAATGCCC------ + +------ + +.. class:: infomark + +**About formats** + + **MAF format** multiple alignment format file. This format stores multiple alignments at the DNA level between entire genomes. + + - The .maf format is line-oriented. Each multiple alignment ends with a blank line. + - Each sequence in an alignment is on a single line. + - Lines starting with # are considered to be comments. + - Each multiple alignment is in a separate paragraph that begins with an "a" line and contains an "s" line for each sequence in the multiple alignment. + - Some MAF files may contain two optional line types: + + - An "i" line containing information about what is in the aligned species DNA before and after the immediately preceding "s" line; + - An "e" line containing information about the size of the gap between the alignments that span the current block. + + + + +