From 5bdef6884bc4a46c7969ede0d7ddec6dc05ef8f4 Mon Sep 17 00:00:00 2001 From: Ross Lazarus Date: Fri, 10 Aug 2012 20:53:00 +1000 Subject: [PATCH] Added sanitisation of the only user controllable parameter and removed use of shell in subprocess.popen to improve security and reduce breakage risk from ugly filenames pointed out by A Nonymous in https://bitbucket.org/galaxy/galaxy-central/issue/793/rgenetics-rgfastqcpy-tool-does-not-escape --- tools/rgenetics/rgFastQC.py | 20 +++++++++++++------- tools/rgenetics/rgFastQC.xml | 28 ++++++++++++++++++---------- 2 files changed, 31 insertions(+), 17 deletions(-) diff --git a/tools/rgenetics/rgFastQC.py b/tools/rgenetics/rgFastQC.py index 274c01e1679..3f828215cca 100644 --- a/tools/rgenetics/rgFastQC.py +++ b/tools/rgenetics/rgFastQC.py @@ -13,8 +13,13 @@ Author notified... """ - -import os,sys,subprocess,optparse,shutil,tempfile +import re +import os +import sys +import subprocess +import optparse +import shutil +import tempfile from rgutils import getFileString class FastQC(): @@ -38,25 +43,26 @@ class FastQC(): """ serr = '' - dummy,tlog = tempfile.mkstemp(prefix='rgFastQClog') + dummy,tlog = tempfile.mkstemp(prefix='rgFastQC',suffix=".log",dir=self.opts.outputdir) sout = open(tlog, 'w') fastq = os.path.basename(self.opts.input) - cl = [self.opts.executable,'-o %s' % self.opts.outputdir] + cl = [self.opts.executable,'--outdir=%s' % self.opts.outputdir] if self.opts.informat in ['sam','bam']: cl.append('-f %s' % self.opts.informat) if self.opts.contaminants <> None : cl.append('-c %s' % self.opts.contaminants) # patch suggested by bwlang https://bitbucket.org/galaxy/galaxy-central/pull-request/30 # use a symlink in a temporary directory so that the FastQC report reflects the history input file name - fastqinfilename = os.path.basename(self.opts.inputfilename).replace(' ','_') + fastqinfilename = re.sub('[^a-zA-Z0-9_]+', '', os.path.basename(self.opts.inputfilename)) link_name = os.path.join(self.opts.outputdir, fastqinfilename) os.symlink(self.opts.input, link_name) cl.append(link_name) - p = subprocess.Popen(' '.join(cl), shell=True, stderr=sout, stdout=sout, cwd=self.opts.outputdir) + sout.write('# FastQC cl = %s\n' % ' '.join(cl)) + sout.flush() + p = subprocess.Popen(cl, shell=False, stderr=sout, stdout=sout, cwd=self.opts.outputdir) retval = p.wait() sout.close() runlog = open(tlog,'r').readlines() - os.unlink(tlog) os.unlink(link_name) flist = os.listdir(self.opts.outputdir) # fastqc plays games with its output directory name. eesh odpath = None diff --git a/tools/rgenetics/rgFastQC.xml b/tools/rgenetics/rgFastQC.xml index de36f2cb8ab..74ba898d425 100644 --- a/tools/rgenetics/rgFastQC.xml +++ b/tools/rgenetics/rgFastQC.xml @@ -1,5 +1,5 @@ - - using FastQC from Babraham + + reports using FastQC rgFastQC.py -i "$input_file" -d "$html_file.files_path" -o "$html_file" -n "$out_prefix" -f "$input_file.ext" -j "$input_file.name" -e "${GALAXY_DATA_INDEX_DIR}/shared/jars/FastQC/fastqc" #if $contaminants.dataset and str($contaminants) > '' @@ -21,7 +21,7 @@ help="tab delimited file with 2 columns: name and sequence. For example: Illumina Small RNA RT Primer CAAGCAGAAGACGGCATACGA"/> - + @@ -51,15 +51,18 @@ The main functions of FastQC are: - Export of results to an HTML based permanent report - Offline operation to allow automated generation of reports without running the interactive application -**FastQC documentation** -This is a Galaxy interface to the external package FastQC_. -Specific documentation on FastQC can be found on that site. +----- + + +.. class:: infomark + +**FastQC** + +This is a Galaxy wrapper. It merely exposes the external package FastQC_ which is documented at FastQC_ +Kindly acknowledge it as well as this tool if you use it. FastQC incorporates the Picard-tools_ libraries for sam/bam processing. - .. _FastQC: http://www.bioinformatics.bbsrc.ac.uk/projects/fastqc/ - .. _Picard-tools: http://picard.sourceforge.net/index.shtml - The contaminants file parameter was borrowed from the independently developed fastqcwrapper contributed to the Galaxy Community Tool Shed by J. Johnson. @@ -69,7 +72,10 @@ fastqcwrapper contributed to the Galaxy Community Tool Shed by J. Johnson. **Inputs and outputs** -This wrapper will accept any fastq file as well as sam or bam as the primary file to check. +FastQC_ is the best place to look for documentation - it's very good. +A summary follows below for those in a tearing hurry. + +This wrapper will accept a Galaxy fastq, sam or bam as the input read file to check. It will also take an optional file containing a list of contaminants information, in the form of a tab-delimited file with 2 columns, name and sequence. @@ -88,6 +94,8 @@ The tool produces a single HTML output file that contains all of the results, in - Kmer Content All except Basic Statistics and Overrepresented sequences are plots. + .. _FastQC: http://www.bioinformatics.bbsrc.ac.uk/projects/fastqc/ + .. _Picard-tools: http://picard.sourceforge.net/index.shtml