opensource/galaxy
3
0
Fork 0
mirror of https://github.com/galaxyproject/galaxy.git synced 2026-10-28 02:58:18 +08:00
Code Issues Packages Projects Releases Wiki Activity

Rewrite of dynamic options for select lists. There are no more 'special cases' and new filters are much easier to incorporate, as neeeded.

Browse Source 
MAF tool interfaces now support the use of index species and all species existing in cached alignment sets.
Until main is updated and the old maf_location files can be overwritten, these symbolic links are required:
maf_index.loc -> /depot/data2/galaxy/maf_index_new.loc
maf_pairwise.loc -> /depot/data2/galaxy/maf_pairwise_new.loc
This commit is contained in:
Daniel Blankenberg
2008-05-29 17:38:46 +00:00
parent c0a5ecf2dd
commit 11a2c767c3
37 changed files with 626 additions and 741 deletions
Download Patch File Download Diff File Expand all files Collapse all files
tools/data_source/encode_import_all_latest_datasets.xml
+14 -4
View File
@@ -7,14 +7,24 @@
</display>
<param name="hg17" type="select" display="checkboxes" multiple="true">
<options from_file="encode_datasets.loc">
<filter type="param" name="encode_group" value="ALD" />
<filter type="param" name="dbkey" value="hg17" />
<column name="name" index="2"/>
<column name="value" index="3"/>
<column name="dbkey" index="1"/>
<column name="encode_group" index="0"/>
<column name="uid" index="3"/>
<filter type="static_value" name="encode_group" value="ALD" column="0"/>
<filter type="static_value" name="dbkey" value="hg17" column="1"/>
</options>
</param>
<param name="hg16" type="select" display="checkboxes" multiple="true">
<options from_file="encode_datasets.loc">
<filter type="param" name="encode_group" value="ALD" />
<filter type="param" name="dbkey" value="hg16" />
<column name="name" index="2"/>
<column name="value" index="3"/>
<column name="dbkey" index="1"/>
<column name="encode_group" index="0"/>
<column name="uid" index="3"/>
<filter type="static_value" name="encode_group" value="ALD" column="0"/>
<filter type="static_value" name="dbkey" value="hg16" column="1"/>
</options>
</param>
</inputs>
tools/data_source/encode_import_chromatin_and_chromosomes.xml
+14 -4
View File
@@ -7,14 +7,24 @@
</display>
<param name="hg17" type="select" display="checkboxes" multiple="true">
<options from_file="encode_datasets.loc">
<filter type="param" name="encode_group" value="CC" />
<filter type="param" name="dbkey" value="hg17" />
<column name="name" index="2"/>
<column name="value" index="3"/>
<column name="dbkey" index="1"/>
<column name="encode_group" index="0"/>
<column name="uid" index="3"/>
<filter type="static_value" name="encode_group" value="CC" column="0"/>
<filter type="static_value" name="dbkey" value="hg17" column="1"/>
</options>
</param>
<param name="hg16" type="select" display="checkboxes" multiple="true">
<options from_file="encode_datasets.loc">
<filter type="param" name="encode_group" value="CC" />
<filter type="param" name="dbkey" value="hg16" />
<column name="name" index="2"/>
<column name="value" index="3"/>
<column name="dbkey" index="1"/>
<column name="encode_group" index="0"/>
<column name="uid" index="3"/>
<filter type="static_value" name="encode_group" value="CC" column="0"/>
<filter type="static_value" name="dbkey" value="hg16" column="1"/>
</options>
</param>
</inputs>
tools/data_source/encode_import_gencode.xml
+14 -4
View File
@@ -7,14 +7,24 @@
</display>
<param name="hg17" type="select" display="checkboxes" multiple="true">
<options from_file="encode_datasets.loc">
<filter type="param" name="encode_group" value="GENCODE" />
<filter type="param" name="dbkey" value="hg17" />
<column name="name" index="2"/>
<column name="value" index="3"/>
<column name="dbkey" index="1"/>
<column name="encode_group" index="0"/>
<column name="uid" index="3"/>
<filter type="static_value" name="encode_group" value="GENCODE" column="0"/>
<filter type="static_value" name="dbkey" value="hg17" column="1"/>
</options>
</param>
<param name="hg16" type="select" display="checkboxes" multiple="true">
<options from_file="encode_datasets.loc">
<filter type="param" name="encode_group" value="GENCODE" />
<filter type="param" name="dbkey" value="hg16" />
<column name="name" index="2"/>
<column name="value" index="3"/>
<column name="dbkey" index="1"/>
<column name="encode_group" index="0"/>
<column name="uid" index="3"/>
<filter type="static_value" name="encode_group" value="GENCODE" column="0"/>
<filter type="static_value" name="dbkey" value="hg16" column="1"/>
</options>
</param>
</inputs>
tools/data_source/encode_import_genes_and_transcripts.xml
+14 -4
View File
@@ -7,14 +7,24 @@
</display>
<param name="hg17" type="select" display="checkboxes" multiple="true">
<options from_file="encode_datasets.loc">
<filter type="param" name="encode_group" value="GT" />
<filter type="param" name="dbkey" value="hg17" />
<column name="name" index="2"/>
<column name="value" index="3"/>
<column name="dbkey" index="1"/>
<column name="encode_group" index="0"/>
<column name="uid" index="3"/>
<filter type="static_value" name="encode_group" value="GT" column="0"/>
<filter type="static_value" name="dbkey" value="hg17" column="1"/>
</options>
</param>
<param name="hg16" type="select" display="checkboxes" multiple="true">
<options from_file="encode_datasets.loc">
<filter type="param" name="encode_group" value="GT" />
<filter type="param" name="dbkey" value="hg16" />
<column name="name" index="2"/>
<column name="value" index="3"/>
<column name="dbkey" index="1"/>
<column name="encode_group" index="0"/>
<column name="uid" index="3"/>
<filter type="static_value" name="encode_group" value="GT" column="0"/>
<filter type="static_value" name="dbkey" value="hg16" column="1"/>
</options>
</param>
</inputs>
tools/data_source/encode_import_multi-species_sequence_analysis.xml
+14 -4
View File
@@ -7,14 +7,24 @@
</display>
<param name="hg17" type="select" display="checkboxes" multiple="true">
<options from_file="encode_datasets.loc">
<filter type="param" name="encode_group" value="MSA" />
<filter type="param" name="dbkey" value="hg17" />
<column name="name" index="2"/>
<column name="value" index="3"/>
<column name="dbkey" index="1"/>
<column name="encode_group" index="0"/>
<column name="uid" index="3"/>
<filter type="static_value" name="encode_group" value="MSA" column="0"/>
<filter type="static_value" name="dbkey" value="hg17" column="1"/>
</options>
</param>
<param name="hg16" type="select" display="checkboxes" multiple="true">
<options from_file="encode_datasets.loc">
<filter type="param" name="encode_group" value="MSA" />
<filter type="param" name="dbkey" value="hg16" />
<column name="name" index="2"/>
<column name="value" index="3"/>
<column name="dbkey" index="1"/>
<column name="encode_group" index="0"/>
<column name="uid" index="3"/>
<filter type="static_value" name="encode_group" value="MSA" column="0"/>
<filter type="static_value" name="dbkey" value="hg16" column="1"/>
</options>
</param>
</inputs>
tools/data_source/encode_import_transcription_regulation.xml
+14 -4
View File
@@ -7,14 +7,24 @@
</display>
<param name="hg17" type="select" display="checkboxes" multiple="true">
<options from_file="encode_datasets.loc">
<filter type="param" name="encode_group" value="TR" />
<filter type="param" name="dbkey" value="hg17" />
<column name="name" index="2"/>
<column name="value" index="3"/>
<column name="dbkey" index="1"/>
<column name="encode_group" index="0"/>
<column name="uid" index="3"/>
<filter type="static_value" name="encode_group" value="TR" column="0"/>
<filter type="static_value" name="dbkey" value="hg17" column="1"/>
</options>
</param>
<param name="hg16" type="select" display="checkboxes" multiple="true">
<options from_file="encode_datasets.loc">
<filter type="param" name="encode_group" value="TR" />
<filter type="param" name="dbkey" value="hg16" />
<column name="name" index="2"/>
<column name="value" index="3"/>
<column name="dbkey" index="1"/>
<column name="encode_group" index="0"/>
<column name="uid" index="3"/>
<filter type="static_value" name="encode_group" value="TR" column="0"/>
<filter type="static_value" name="dbkey" value="hg16" column="1"/>
</options>
</param>
</inputs>
tools/data_source/microbial_import.xml
+62 -62
View File
@@ -1,84 +1,84 @@
<tool id="microbial_import1" name="Get Microbial Data">
<command interpreter="python">microbial_import.py $CDS,$tRNA,$rRNA,$sequence,$GeneMark,$GeneMarkHMM,$Glimmer3 $output ${GALAXY_DATA_INDEX_DIR}/microbial_data.loc</command>
<inputs>
<page>
<display>
<p><div class="toolFormTitle">Select the Desired Kingdom</div>$kingdom</p>
</display>
<param name="kingdom" type="select" display="radio">
<options from_file="microbial_data.loc" />
</param>
</page>
<page>
<display>
<p><div class="toolFormTitle">Select the Desired Organism</div>$org</p>
</display>
<param name="org" type="select" display="radio">
<options from_file="microbial_data.loc">
<filter type="param_value" name="kingdom" value="kingdom" />
<param name="kingdom" type="select" label="Select the Desired Kingdom">
<options from_file="microbial_data.loc" startswith="ORG">
<column name="name" index="3"/>
<column name="value" index="3"/>
<filter type="unique_value" name="unique" column="3"/>
</options>
</param>
</page>
<page>
<display>
<p><div class="toolFormTitle">Select Desired Coding Sequences</div>$CDS</p>
<p><div class="toolFormTitle">Select Desired tRNA</div>$tRNA</p>
<p><div class="toolFormTitle">Select Desired rRNA</div>$rRNA</p>
<p><div class="toolFormTitle">Select Desired DNA Sequences</div>$sequence</p>
<p><div class="toolFormTitle">Select Desired GeneMark Annotations</div>$GeneMark</p>
<p><div class="toolFormTitle">Select Desired GeneMarkHMM Annotations</div>$GeneMarkHMM</p>
<p><div class="toolFormTitle">Select Desired Glimmer3 Annotations</div>$Glimmer3</p>
</display>
<param name="CDS" type="select" display="checkboxes" multiple="True">
<options from_file="microbial_data.loc">
<filter type="param_value" name="kingdom" value="kingdom" />
<filter type="param_value" name="org" value="org" />
<filter type="param" name="feature" value="CDS" />
<param name="org" type="select" label="Select the Desired Organism">
<options from_file="microbial_data.loc" startswith="ORG">
<column name="name" index="2"/>
<column name="value" index="1"/>
<filter type="param_value" ref="kingdom" name="kingdom" column="3"/>
<filter type="sort_by" column="2"/>
</options>
</param>
<param name="tRNA" type="select" display="checkboxes" multiple="True">
<options from_file="microbial_data.loc">
<filter type="param_value" name="kingdom" value="kingdom" />
<filter type="param_value" name="org" value="org" />
<filter type="param" name="feature" value="tRNA" />
<param name="CDS" type="select" label="Select Desired Coding Sequences" display="checkboxes" multiple="True">
<options from_file="microbial_data.loc" startswith="DATA">
<column name="name" index="3"/>
<column name="value" index="1"/>
<column name="feature" index="4"/>
<filter type="param_value" ref="org" name="kingdom" column="2"/>
<filter type="static_value" name="feature" value="CDS" column="4"/>
</options>
</param>
<param name="rRNA" type="select" display="checkboxes" multiple="True">
<options from_file="microbial_data.loc">
<filter type="param_value" name="kingdom" value="kingdom" />
<filter type="param_value" name="org" value="org" />
<filter type="param" name="feature" value="rRNA" />
<param name="tRNA" type="select" label="Select Desired tRNA" display="checkboxes" multiple="True">
<options from_file="microbial_data.loc" startswith="DATA">
<column name="name" index="3"/>
<column name="value" index="1"/>
<column name="feature" index="4"/>
<filter type="param_value" ref="org" name="kingdom" column="2"/>
<filter type="static_value" name="feature" value="tRNA" column="4"/>
</options>
</param>
<param name="sequence" type="select" display="checkboxes" multiple="True">
<options from_file="microbial_data.loc">
<filter type="param_value" name="kingdom" value="kingdom" />
<filter type="param_value" name="org" value="org" />
<filter type="param" name="feature" value="sequence" />
<param name="rRNA" type="select" label="Select Desired rRNA" display="checkboxes" multiple="True">
<options from_file="microbial_data.loc" startswith="DATA">
<column name="name" index="3"/>
<column name="value" index="1"/>
<column name="feature" index="4"/>
<filter type="param_value" ref="org" name="kingdom" column="2"/>
<filter type="static_value" name="feature" value="rRNA" column="4"/>
</options>
</param>
<param name="GeneMark" type="select" display="checkboxes" multiple="True">
<options from_file="microbial_data.loc">
<filter type="param_value" name="kingdom" value="kingdom" />
<filter type="param_value" name="org" value="org" />
<filter type="param" name="feature" value="GeneMark" />
<param name="sequence" type="select" label="Select Desired DNA Sequences" display="checkboxes" multiple="True">
<options from_file="microbial_data.loc" startswith="DATA">
<column name="name" index="3"/>
<column name="value" index="1"/>
<column name="feature" index="4"/>
<filter type="param_value" ref="org" name="kingdom" column="2"/>
<filter type="static_value" name="feature" value="sequence" column="4"/>
</options>
</param>
<param name="GeneMarkHMM" type="select" display="checkboxes" multiple="True">
<options from_file="microbial_data.loc">
<filter type="param_value" name="kingdom" value="kingdom" />
<filter type="param_value" name="org" value="org" />
<filter type="param" name="feature" value="GeneMarkHMM" />
<param name="GeneMark" type="select" label="Select Desired GeneMark Annotations" display="checkboxes" multiple="True">
<options from_file="microbial_data.loc" startswith="DATA">
<column name="name" index="3"/>
<column name="value" index="1"/>
<column name="feature" index="4"/>
<filter type="param_value" ref="org" name="kingdom" column="2"/>
<filter type="static_value" name="feature" value="GeneMark" column="4"/>
</options>
</param>
<param name="Glimmer3" type="select" display="checkboxes" multiple="True">
<options from_file="microbial_data.loc">
<filter type="param_value" name="kingdom" value="kingdom" />
<filter type="param_value" name="org" value="org" />
<filter type="param" name="feature" value="Glimmer3" />
<param name="GeneMarkHMM" type="select" label="Select Desired GeneMarkHMM Annotations" display="checkboxes" multiple="True">
<options from_file="microbial_data.loc" startswith="DATA">
<column name="name" index="3"/>
<column name="value" index="1"/>
<column name="feature" index="4"/>
<filter type="param_value" ref="org" name="kingdom" column="2"/>
<filter type="static_value" name="feature" value="GeneMarkHMM" column="4"/>
</options>
</param>
<param name="Glimmer3" type="select" label="Select Desired Glimmer3 Annotations" display="checkboxes" multiple="True">
<options from_file="microbial_data.loc" startswith="DATA">
<column name="name" index="3"/>
<column name="value" index="1"/>
<column name="feature" index="4"/>
<filter type="param_value" ref="org" name="kingdom" column="2"/>
<filter type="static_value" name="feature" value="Glimmer3" column="4"/>
</options>
</param>
</page>
</inputs>
<outputs>
<data format="bed" name="output"/>
tools/data_source/upload.xml
+18 -53
View File
@@ -12,7 +12,12 @@
<option value="Yes">Yes</option>
</param>
<param name="file_type" type="select" label="File Format" help="Which format? See help below">
<options from_file="datatypes_registry" />
<options from_parameter="tool.app.datatypes_registry.upload_file_formats" transform_lines="[ &quot;%s%s%s&quot; % ( line, self.separator, line ) for line in obj ]">
<column name="value" index="1"/>
<column name="name" index="0"/>
<filter type="sort_by" column="0"/>
<filter type="add_value" name="Auto-detect" value="auto" index="0"/>
</options>
</param>
<param name="dbkey" type="genomebuild" label="Genome" />
</inputs>
@@ -20,7 +25,7 @@
**Auto-detect**
The system will attempt to detect AXT, BED, FASTA, Gff, Gff3, Interval (BED with headers), LAV, Maf, Tabular and Wiggle formats. If your file is not detected properly as one of the known formats, it most likely means that it has some format problems (e.g., different number of columns on different rows). You can still coerce the system to set your data to the format you think it should be (please send us a note if you see a case when a valid format is not detected). You can also upload valid files that are compressed (gzipped), which will automatically be decompressed upon upload.
The system will attempt to detect AXT, FASTA, Gff, HTML, LAV, Maf, Tabular, Wiggle, BED and Interval (BED with headers) formats. If your file is not detected properly as one of the known formats, it most likely means that it has some format problems (e.g., different number of columns on different rows). You can still coerce the system to set your data to the format you think it should be (please send us a note if you see a case when a valid format is not detected). You can also upload valid files that are compressed (gzipped), which will automatically be decompressed upon upload.
-----
@@ -36,6 +41,12 @@ blastz pairwise alignment format. Each alignment block in an axt file contains
-----
**Binseq.zip**
A zipped archive consisting of binary sequence files in either 'ab1' or 'scf' format. All files in this archive must have the same file extension which is one of '.ab1' or '.scf'. You must manually select this 'File Format' when uploading the file.
-----
**BED**
* Tab delimited format (tabular)
@@ -65,12 +76,6 @@ blastz pairwise alignment format. Each alignment block in an axt file contains
-----
**Binseq.zip**
A zipped archive consisting of binary sequence files in either 'ab1' or 'scf' format. All files in this archive must have the same file extension which is one of '.ab1' or '.scf'. You must manually select this 'File Format' when uploading the file.
-----
**FASTA**
A sequence in FASTA format consists of a single-line description, followed by lines of sequence data. The first character of the description line is a greater-than (">") symbol in the first column. All lines should be shorter than 80 charcters::
@@ -84,25 +89,6 @@ A sequence in FASTA format consists of a single-line description, followed by li
-----
**FASTQ**
FASTQ format stores sequences and Phred qualities in a single file. FASTQ is first widely used in the Sanger Institute and therefore we usually take the Sanger specification and the standard FASTQ format, or simply FASTQ format. You must manually select this 'File Format' when uploading the file::
@EAS54_6_R1_2_1_413_324
CCCTTCTTGTCTTCAGCGTTTCTCC
+
;;3;;;;;;;;;;;;7;;;;;;;88
@EAS54_6_R1_2_1_540_792
TTGGCAGGCCAAGGCCGATGGATCA
+
;;;;;;;;;;;7;;;;;-;;;3;83
@EAS54_6_R1_2_1_443_348
GTTGCTTCTGGCGTGGGTGGGGGGG
+EAS54_6_R1_2_1_443_348
;;;;;;;;;;;9;7;;.7;393333
-----
**Gff**
GFF lines have nine required fields that must be tab-separated.
@@ -147,20 +133,6 @@ TBA and multiz multiple alignment format. The first line of a .maf file begins
-----
**Qual**
The qual sequence format is a FASTA-like format which stores numerical quality values for each nucleotide or amino acid. It is used by CAP3 and Phrap. You must manually select this 'File Format' when uploading the file::
>HSMETOO 134bp
10 20 30 40 50 50 50 50 50 20 25 25 30 30 20 15 20 35 50 50 50 50 50 50
50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50
50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50
50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50
50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50
50 50 50 20 30 20 10 10
-----
**Scf**
A binary sequence file in 'scf' format with a '.scf' file extension. You must manually select this 'File Format' when uploading the file.
@@ -173,18 +145,6 @@ Any data in tab delimited format (tabular)
-----
**Taxonomy**
Tabular data containing at least 24 columns. You must manually select this 'File Format' when uploading the file.
-----
**Txt**
Any text file.
-----
**Txtseq.zip**
A zipped archive consisting of flat text sequence files. All files in this archive must have the same file extension of '.txt'. You must manually select this 'File Format' when uploading the file.
@@ -195,6 +155,11 @@ A zipped archive consisting of flat text sequence files. All files in this arch
The wiggle format is line-oriented. Wiggle data is preceeded by a track definition line, which adds a number of options for controlling the default display of this track.
-----
**Other text type**
Any text file
</help>
</tool>
tools/encode/random_intervals.xml
+5 -2
View File
@@ -16,8 +16,11 @@
<option value="none">None</option>
</param>
<param name="regions" type="select" label="Regions to use">
<options from_file="regions.loc" name_col="2" value_col="1">
<filter type="data_meta" data_ref="input1" meta_key="dbkey" meta_key_col="0" />
<options from_file="regions.loc">
<column name="name" index="2"/>
<column name="value" index="1"/>
<column name="dbkey" index="0"/>
<filter type="data_meta" ref="input1" key="dbkey" column="0" />
</options>
</param>
</inputs>
tools/extract/extract_GFF_Features.xml
+20 -10
View File
@@ -13,36 +13,46 @@
</param>
<when value="0">
<param name="feature" type="select" multiple="true" label="Extract features" help="Multi-select list - hold the appropriate key while clicking to select multiple columns">
<options from_file="data_ref" value_col="0">
<filter type="data_meta" data_ref="input1" />
<options from_dataset="input1">
<column name="name" index="0"/>
<column name="value" index="0"/>
<filter type="unique_value" name="unique" column="0"/>
</options>
</param>
</when>
<when value="1">
<param name="feature" type="select" multiple="true" label="Extract features" help="Multi-select list - hold the appropriate key while clicking to select multiple columns">
<options from_file="data_ref" value_col="1">
<filter type="data_meta" data_ref="input1" />
<options from_dataset="input1">
<column name="name" index="1"/>
<column name="value" index="1"/>
<filter type="unique_value" name="unique" column="1"/>
</options>
</param>
</when>
<when value="2">
<param name="feature" type="select" multiple="true" label="Extract features" help="Multi-select list - hold the appropriate key while clicking to select multiple columns">
<options from_file="data_ref" value_col="2">
<filter type="data_meta" data_ref="input1" />
<options from_dataset="input1">
<column name="name" index="2"/>
<column name="value" index="2"/>
<filter type="unique_value" name="unique" column="2"/>
</options>
</param>
</when>
<when value="6">
<param name="feature" type="select" multiple="true" label="Extract features" help="Multi-select list - hold the appropriate key while clicking to select multiple columns">
<options from_file="data_ref" value_col="6">
<filter type="data_meta" data_ref="input1" />
<options from_dataset="input1">
<column name="name" index="6"/>
<column name="value" index="6"/>
<filter type="unique_value" name="unique" column="6"/>
</options>
</param>
</when>
<when value="7">
<param name="feature" type="select" multiple="true" label="Extract features" help="Multi-select list - hold the appropriate key while clicking to select multiple columns">
<options from_file="data_ref" value_col="7">
<filter type="data_meta" data_ref="input1" />
<options from_dataset="input1">
<column name="name" index="7"/>
<column name="value" index="7"/>
<filter type="unique_value" name="unique" column="7"/>
</options>
</param>
</when>
tools/extract/liftOver_wrapper.xml
+5 -2
View File
@@ -6,8 +6,11 @@
<validator type="unspecified_build" />
</param>
<param name="to_dbkey" type="select" label="To">
<options from_file="liftOver.loc" name_col="1" value_col="2">
<filter type="data_meta" data_ref="input" meta_key="dbkey" meta_key_col="0"/>
<options from_file="liftOver.loc">
<column name="name" index="1"/>
<column name="value" index="2"/>
<column name="dbkey" index="0"/>
<filter type="data_meta" ref="input" key="dbkey" column="0" />
</options>
</param>
</inputs>
tools/extract/phastOdds/phastOdds_tool.xml
+6 -3
View File
@@ -6,10 +6,13 @@
<validator type="unspecified_build" message="Unspecified build, this tool works with data from genome builds hg17. Click the pencil icon in your history item to set the genome build."/>
</param>
<param name="score_file" type="select" label="Available datasets">
<options from_file="phastOdds.loc" name_col="1" value_col="2">
<filter type="data_meta" data_ref="input" meta_key="dbkey" meta_key_col="0"/>
<options from_file="phastOdds.loc">
<column name="name" index="1"/>
<column name="value" index="2"/>
<column name="dbkey" index="0"/>
<filter type="data_meta" ref="input" key="dbkey" column="0" />
</options>
</param>
</param>
<param name="per_col" type="boolean" label="Standardize" help="Standardizes the score to be per alignment column" checked="yes" truevalue="-p" falsevalue=""/>
</inputs>
<outputs>
tools/filters/axt_to_concat_fasta.xml
+8 -2
View File
@@ -4,10 +4,16 @@
<inputs>
<param format="axt" name="axt_input" type="data" label="AXT file"/>
<param name="dbkey_1" type="select" label="Genome">
<options from_file="static/ucsc/builds.txt" name_col="1" value_col="0" />
<options from_file="static/ucsc/builds.txt">
<column name="name" index="1"/>
<column name="value" index="0"/>
</options>
</param>
<param name="dbkey_2" type="select" label="Genome">
<options from_file="static/ucsc/builds.txt" name_col="1" value_col="0" />
<options from_file="static/ucsc/builds.txt">
<column name="name" index="1"/>
<column name="value" index="0"/>
</options>
</param>
</inputs>
<outputs>
tools/filters/axt_to_fasta.xml
+8 -2
View File
@@ -4,10 +4,16 @@
<inputs>
<param format="axt" name="axt_input" type="data" label="AXT file"/>
<param name="dbkey_1" type="select" label="Genome">
<options from_file="static/ucsc/builds.txt" name_col="1" value_col="0" />
<options from_file="static/ucsc/builds.txt">
<column name="name" index="1"/>
<column name="value" index="0"/>
</options>
</param>
<param name="dbkey_2" type="select" label="Genome">
<options from_file="static/ucsc/builds.txt" name_col="1" value_col="0" />
<options from_file="static/ucsc/builds.txt">
<column name="name" index="1"/>
<column name="value" index="0"/>
</options>
</param>
</inputs>
<outputs>
tools/filters/axt_to_lav.xml
+8 -2
View File
@@ -4,10 +4,16 @@
<inputs>
<param name="align_input" type="data" format="axt" label="Alignment File" optional="False"/>
<param name="dbkey_1" type="select" label="Genome">
<options from_file="static/ucsc/builds.txt" name_col="1" value_col="0" />
<options from_file="static/ucsc/builds.txt">
<column name="name" index="1"/>
<column name="value" index="0"/>
</options>
</param>
<param name="dbkey_2" type="select" label="Genome">
<options from_file="static/ucsc/builds.txt" name_col="1" value_col="0" />
<options from_file="static/ucsc/builds.txt">
<column name="name" index="1"/>
<column name="value" index="0"/>
</options>
</param>
</inputs>
<outputs>
tools/maf/genebed_maf_to_fasta.xml
+16 -7
View File
@@ -16,25 +16,34 @@
<when value="user">
<param name="maf_file" type="data" format="maf" label="MAF File">
<validator type="dataset_ok_validator" />
<options>
<filter type="data_meta" ref="input1" key="dbkey" />
</options>
</param>
<param name="species" type="select" display="checkboxes" multiple="true" label="Choose species" help="Select species to be included in the final alignment">
<options>
<filter type="data_meta" data_ref="maf_file" />
<filter type="param" name="maf_source" value="user" />
<filter type="data_meta" ref="maf_file" key="species" />
</options>
</param>
</when>
<when value="cached">
<param name="maf_identifier" type="select" label="MAF Type" >
<options from_file="maf_index.loc" name_col="0" value_col="1">
<validator type="no_options" message="No alignments are available for the build associated with the selected gene bed file"/>
<filter type="data_meta" data_ref="input1" meta_key="dbkey" meta_key_col="2"/>
<options from_file="maf_index.loc">
<column name="name" index="0"/>
<column name="value" index="1"/>
<column name="dbkey" index="2"/>
<column name="species" index="3"/>
<filter type="data_meta" ref="input1" key="dbkey" column="2" multiple="True" separator=","/>
<validator type="no_options" message="No alignments are available for the build associated with the selected interval file"/>
</options>
</param>
<param name="species" type="select" display="checkboxes" multiple="true" label="Choose species" help="Select species to be included in the final alignment">
<options from_file="maf_index.loc">
<filter type="param_meta" param_ref="maf_identifier" />
<filter type="param" name="maf_source" value="cached" />
<column name="uid" index="1"/>
<column name="value" index="3"/>
<column name="name" index="3"/>
<filter type="param_value" ref="maf_identifier" name="uid" column="1"/>
<filter type="multiple_splitter" column="3" separator=","/>
</options>
</param>
</when>
tools/maf/interval2maf.xml
+9 -2
View File
@@ -16,14 +16,21 @@
</param>
<when value="user">
<param format="maf" name="mafFile" label="Choose alignments" type="data">
<options>
<filter type="data_meta" ref="input1" key="dbkey" />
</options>
<validator type="dataset_ok_validator" />
</param>
</when>
<when value="cached">
<param name="mafType" type="select" label="Choose alignments">
<options from_file="maf_index.loc" name_col="0" value_col="1">
<options from_file="maf_index.loc">
<column name="name" index="0"/>
<column name="value" index="1"/>
<column name="dbkey" index="2"/>
<column name="species" index="3"/>
<filter type="data_meta" ref="input1" key="dbkey" column="2" multiple="True" separator=","/>
<validator type="no_options" message="No alignments are available for the build associated with the selected interval file"/>
<filter type="data_meta" data_ref="input1" meta_key="dbkey" meta_key_col="2"/>
</options>
</param>
</when>
tools/maf/interval2maf_pairwise.xml
+6 -2
View File
@@ -6,9 +6,13 @@
<validator type="unspecified_build" />
</param>
<param name="mafType" type="select" label="Choose MAF source">
<options from_file="maf_pairwise.loc" name_col="0" value_col="1">
<options from_file="maf_pairwise.loc">
<column name="name" index="0"/>
<column name="value" index="1"/>
<column name="dbkey" index="2"/>
<column name="species" index="3"/>
<filter type="data_meta" ref="input1" key="dbkey" column="2" multiple="True" separator=","/>
<validator type="no_options" message="No alignments are available for the build associated with the selected interval file"/>
<filter type="data_meta" data_ref="input1" meta_key="dbkey" meta_key_col="2"/>
</options>
</param>
</inputs>
tools/maf/interval_maf_to_merged_fasta.xml
+16 -7
View File
@@ -16,26 +16,35 @@
</param>
<when value="user">
<param name="maf_file" type="data" format="maf" label="MAF File">
<options>
<filter type="data_meta" ref="input1" key="dbkey" />
</options>
<validator type="dataset_ok_validator" />
</param>
<param name="species" type="select" display="checkboxes" multiple="true" label="Choose species" help="Select species to be included in the final alignment">
<options>
<filter type="data_meta" data_ref="maf_file" />
<filter type="param" name="maf_source" value="user" />
<filter type="data_meta" ref="maf_file" key="species" />
</options>
</param>
</when>
<when value="cached">
<param name="maf_identifier" type="select" label="MAF Type" >
<options from_file="maf_index.loc" name_col="0" value_col="1">
<validator type="no_options" message="No alignments are available for the build associated with the selected interval file"/>
<filter type="data_meta" data_ref="input1" meta_key="dbkey" meta_key_col="2"/>
<options from_file="maf_index.loc">
<column name="name" index="0"/>
<column name="value" index="1"/>
<column name="dbkey" index="2"/>
<column name="species" index="3"/>
<filter type="data_meta" ref="input1" key="dbkey" column="2" multiple="True" separator=","/>
<validator type="no_options" message="No alignments are available for the build associated with the selected interval file"/>
</options>
</param>
<param name="species" type="select" display="checkboxes" multiple="true" label="Choose species" help="Select species to be included in the final alignment">
<options from_file="maf_index.loc">
<filter type="param_meta" param_ref="maf_identifier" />
<filter type="param" name="maf_source" value="cached" />
<column name="uid" index="1"/>
<column name="value" index="3"/>
<column name="name" index="3"/>
<filter type="param_value" ref="maf_identifier" name="uid" column="1"/>
<filter type="multiple_splitter" column="3" separator=","/>
</options>
</param>
</when>
tools/maf/maf_filter.xml
+3 -3
View File
@@ -7,7 +7,7 @@
<repeat name="maf_filters" title="Filter">
<param name="species1" type="select" label="When Species" multiple="false">
<options>
<filter type="data_meta" data_ref="input1" meta_key="species" />
<filter type="data_meta" ref="input1" key="species" />
</options>
</param>
<conditional name="species1_attributes">
@@ -27,7 +27,7 @@
<repeat name="filter_condition" title="Filter Condition">
<param name="species2" type="select" label="Species" multiple="false">
<options>
<filter type="data_meta" data_ref="input1" meta_key="species" />
<filter type="data_meta" ref="input1" key="species" />
</options>
</param>
<conditional name="species2_attributes">
@@ -64,7 +64,7 @@
<repeat name="filter_condition" title="Filter Condition">
<param name="species2" type="select" label="Species" multiple="false">
<options>
<filter type="data_meta" data_ref="input1" meta_key="species" />
<filter type="data_meta" ref="input1" key="species" />
</options>
</param>
<conditional name="species2_attributes">
tools/maf/maf_limit_to_species.xml
+1 -1
View File
@@ -13,7 +13,7 @@
</param>
<param name="species" type="select" label="Species to keep" display="checkboxes" multiple="true">
<options>
<filter type="data_meta" data_ref="input1" meta_key="species" />
<filter type="data_meta" ref="input1" key="species" />
</options>
</param>
</inputs>
tools/maf/maf_stats.xml
+8 -2
View File
@@ -20,14 +20,20 @@
</param>
<when value="user">
<param format="maf" name="input2" label="MAF File" type="data">
<options>
<filter type="data_meta" ref="input1" key="dbkey" />
</options>
<validator type="dataset_ok_validator" />
</param>
</when>
<when value="cached">
<param name="mafType" type="select" label="MAF Type">
<options from_file="maf_index.loc" name_col="0" value_col="1">
<options from_file="maf_index.loc">
<column name="name" index="0"/>
<column name="value" index="1"/>
<column name="dbkey" index="2"/>
<filter type="data_meta" ref="input1" key="dbkey" column="2" multiple="True" separator=","/>
<validator type="no_options" message="No alignments are available for the build associated with the selected interval file"/>
<filter type="data_meta" data_ref="input1" meta_key="dbkey" meta_key_col="2"/>
</options>
</param>
</when>
tools/maf/maf_thread_for_species.xml
+1 -1
View File
@@ -5,7 +5,7 @@
<param format="maf" name="input1" type="data" label="MAF file"/>
<param name="species" type="select" label="Species to keep" display="checkboxes" multiple="true">
<options>
<filter type="data_meta" data_ref="input1" meta_key="species" />
<filter type="data_meta" ref="input1" key="species" />
</options>
</param>
</inputs>
tools/maf/maf_to_bed.xml
+1 -1
View File
@@ -5,7 +5,7 @@
<param format="maf" name="input1" type="data" label="MAF file to convert"/>
<param name="species" type="select" label="Select species" display="checkboxes" multiple="true" help="a separate history item will be created for each checked species">
<options>
<filter type="data_meta" data_ref="input1" meta_key="species" />
<filter type="data_meta" ref="input1" key="species" />
</options>
</param>
<param name="complete_blocks" type="select" label="Exclude blocks which have a requested species missing">
tools/maf/maf_to_fasta.xml
+2 -2
View File
@@ -15,7 +15,7 @@
<when value="multiple">
<param name="species" type="select" label="Select species" display="checkboxes" multiple="true" help="checked taxa will be included in the output">
<options>
<filter type="data_meta" data_ref="input1" meta_key="species" />
<filter type="data_meta" ref="input1" key="species" />
</options>
</param>
<param name="complete_blocks" type="select" label="Choose to">
@@ -26,7 +26,7 @@
<when value="concatenated">
<param name="species" type="select" label="Species to extract" display="checkboxes" multiple="true">
<options>
<filter type="data_meta" data_ref="input1" meta_key="species" />
<filter type="data_meta" ref="input1" key="species" />
</options>
</param>
</when>
tools/metag_tools/megablast_wrapper.xml
+4 -1
View File
@@ -3,7 +3,10 @@
<command interpreter="python">megablast_wrapper.py $source_select $input_query $output1 $word_size $iden_cutoff $evalue_cutoff $filter_query ${GALAXY_DATA_INDEX_DIR}</command>
<inputs>
<param name="source_select" type="select" display="radio" label="Choose target database">
<options from_file="blastdb.loc" name_col="0" value_col="0"/>
<options from_file="blastdb.loc">
<column name="name" index="0"/>
<column name="value" index="0"/>
</options>
</param>
<param name="input_query" type="data" format="fasta" label="Sequence file"/>
<param name="word_size" type="select" label="Word size (-W)" help="Size of best perfect match">
tools/metag_tools/rmap_wrapper.xml
+4 -1
View File
@@ -7,7 +7,10 @@
</command>
<inputs>
<param name="database" type="select" display="radio" label="Target database">
<options from_file="faseq.loc" name_col="0" value_col="1"/>
<options from_file="faseq.loc">
<column name="name" index="0"/>
<column name="value" index="0"/>
</options>
</param>
<param name="input_seq" type="data" format="fasta" label="Sequence file"/>
<param name="align_len" type="integer" size="15" value="11" label="Minimal length of a hit (-h)" help="seed" />
tools/metag_tools/rmapq_wrapper.xml
+4 -1
View File
@@ -7,7 +7,10 @@
</command>
<inputs>
<param name="database" type="select" display="radio" label="Target database">
<options from_file="faseq.loc" name_col="0" value_col="1"/>
<options from_file="faseq.loc">
<column name="name" index="0"/>
<column name="value" index="0"/>
</options>
</param>
<param name="input_seq" type="data" format="fasta" label="Sequence file"/>
<param name="input_score" type="data" format="qual" label="Quality score file"/>
tools/regVariation/getIndels_3way.xml
+1 -1
View File
@@ -8,7 +8,7 @@
<param format="maf" name="input1" type="data" label="Select data"/>
<param name="outgroup" type="select" label="Select outgroup species">
<options>
<filter type="data_meta" data_ref="input1" meta_key="species" />
<filter type="data_meta" ref="input1" key="species" />
</options>
</param>
</page>
tools/regVariation/quality_filter.xml
+2 -2
View File
@@ -22,12 +22,12 @@
<param format="maf" name="input" type="data" label="Select data"/>
<param name="primary_species" type="select" label="Use quality scores of" display="checkboxes" multiple="true">
<options>
<filter type="data_meta" data_ref="input" meta_key="species" />
<filter type="data_meta" ref="input" key="species" />
</options>
</param>
<param name="mask_species" type="select" label="Mask Species" display="checkboxes" multiple="true">
<options>
<filter type="data_meta" data_ref="input" meta_key="species" />
<filter type="data_meta" ref="input" key="species" />
</options>
</param>
<param name="score" size="10" type="integer" value="20" label="Quality score cut-off" help="Cut-off value of 20 means mask all nucleotides having quality score less than or equal to 20"/>
tools/stats/aggregate_binned_scores_in_intervals.xml
+6 -3
View File
@@ -16,15 +16,18 @@
</param>
<when value="cached">
<param name="datasets" type="select" label="Available datasets" display="radio">
<options from_file="binned_scores.loc" name_col="1" value_col="2">
<filter type="data_meta" data_ref="input1" meta_key="dbkey" meta_key_col="0"/>
<options from_file="binned_scores.loc">
<column name="name" index="1"/>
<column name="value" index="2"/>
<column name="dbkey" index="0"/>
<filter type="data_meta" ref="input1" key="dbkey" column="0" />
</options>
</param>
</when>
<when value="user">
<param format="wig" name="input2" type="data" label="Score file">
<options>
<filter type="data_meta" data_ref="input1" meta_key="dbkey" />
<filter type="data_meta" ref="input1" key="dbkey" />
</options>
</param>
</when>
tools/visualization/GMAJ.xml
+1 -1
View File
@@ -6,7 +6,7 @@
<repeat name="annotations" title="Annotations">
<param name="species" type="select" label="Species of Annotation" multiple="False">
<options>
<filter type="data_meta" data_ref="maf_input" meta_key="species" />
<filter type="data_meta" ref="maf_input" key="species" />
</options>
</param>
<param name="chromosome" label="Chromosome" value="" type="text"/>